ID: 925157593

View in Genome Browser
Species Human (GRCh38)
Location 2:1659293-1659315
Sequence GGCTGAAAAGAATTTCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925157593 Original CRISPR GGCTGAAAAGAATTTCAGCT AGG Intronic
903289548 1:22299597-22299619 GTTTGAAAATAATTTCAGCTTGG + Intergenic
903568754 1:24288428-24288450 GGCTCACAGGAATTTCACCTTGG - Intergenic
904665621 1:32118857-32118879 GCCTGTAAAGCATTTTAGCTCGG + Intronic
904958168 1:34306308-34306330 CACTGAGAAGCATTTCAGCTGGG - Intergenic
906465367 1:46073992-46074014 GGCCAAAAACAAATTCAGCTGGG + Intronic
907374190 1:54022150-54022172 GGCTGAAAATAATTGAGGCTGGG - Intergenic
909521162 1:76569315-76569337 GTCTGAAATGGATTTCAGCTTGG + Intronic
912760623 1:112363393-112363415 TGCTGAAAAGTATTCCAGCGTGG + Intergenic
913964899 1:143368371-143368393 GGTTGAAAAGAATGTTAGATGGG + Intergenic
914059272 1:144193974-144193996 GGTTGAAAAGAATGTTAGATGGG + Intergenic
914119878 1:144772397-144772419 GGTTGAAAAGAATGTTAGATGGG - Intergenic
914930291 1:151925185-151925207 GGCAGAGAAGAAATTAAGCTAGG + Intergenic
919004590 1:191880382-191880404 GCCTGTTACGAATTTCAGCTTGG - Intergenic
920153161 1:203925749-203925771 AACTGAAAAGGACTTCAGCTAGG - Intergenic
920679591 1:208062432-208062454 GTCTGAACAGCATATCAGCTGGG - Intronic
922429532 1:225535972-225535994 ATCTGAAAAAAATTTAAGCTTGG + Intronic
923466722 1:234254280-234254302 GGCTGAAATGAGTTCCAGATGGG - Intronic
1065176572 10:23082077-23082099 GGCAGAGAAGTATTTCAGCATGG - Intergenic
1065307911 10:24385697-24385719 CACTGAAAAGAATTTCAGCTGGG - Intronic
1066071634 10:31820742-31820764 GGGTAAAAAAAATTTCAGTTTGG - Intronic
1067078629 10:43201922-43201944 GGCTGAGAAAGACTTCAGCTTGG + Exonic
1067738398 10:48877090-48877112 GGCTGGGAAGAAGGTCAGCTGGG - Exonic
1068072979 10:52219166-52219188 GGATGAATAGATTTTGAGCTGGG + Intronic
1068359755 10:55962031-55962053 GAGTGGACAGAATTTCAGCTGGG - Intergenic
1070123331 10:73599589-73599611 GGCTGAAATGAATTACATTTCGG - Intronic
1070726147 10:78792394-78792416 GGCTGGAAAGAAACTCAGCTGGG + Intergenic
1071156916 10:82700480-82700502 TGAAGAAAAGAATTGCAGCTAGG + Intronic
1071976942 10:90964727-90964749 GGCTGAGGAGACATTCAGCTAGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1078514583 11:12010484-12010506 GGCAGAAGACAATCTCAGCTGGG - Intergenic
1080368748 11:31609485-31609507 GGCGGGAAAGAAATTCAGCAGGG + Intronic
1080699523 11:34632631-34632653 CCTTGAAAAGAATTTCAGCTAGG - Exonic
1081374204 11:42339799-42339821 GGCTGGAAAAGAGTTCAGCTGGG + Intergenic
1082019747 11:47522206-47522228 TGATAAAAAAAATTTCAGCTGGG - Intronic
1082877654 11:58004262-58004284 GACTAAAAAGTATCTCAGCTGGG - Intergenic
1085179358 11:74520504-74520526 GGCAGAATGGAATTTCAGCCTGG + Intronic
1087378558 11:97375374-97375396 GTGTGAAAAGAATTTTAGGTTGG + Intergenic
1088364068 11:109020428-109020450 GGTAGAAAAGAAGTTCTGCTTGG - Intergenic
1088558673 11:111090115-111090137 GGCTGAAATCAATGTCAGCCAGG + Intergenic
1090104068 11:123832974-123832996 GGATGAAAAAAAATTCAGATCGG + Intergenic
1091553673 12:1555643-1555665 TTCTGAACAGAATTTCAGTTGGG - Intronic
1098426746 12:70372892-70372914 GGATGAACAGAGTTTCATCTTGG + Intronic
1098766625 12:74498545-74498567 GTCAGTAAAGAATTTCAGATTGG - Intergenic
1100004282 12:89875285-89875307 GCCTGAAAAGAACTTAAGGTGGG - Intergenic
1103581169 12:121916657-121916679 GGGTCATAAGAAATTCAGCTGGG - Exonic
1105737814 13:23289522-23289544 ATCTGAGAAAAATTTCAGCTGGG - Intronic
1106453241 13:29903619-29903641 TGCTGTTAAGTATTTCAGCTGGG - Intergenic
1106829277 13:33561578-33561600 GGCAGTAAAGAATTTCAGGCAGG - Intergenic
1108405316 13:50095199-50095221 AGCTAAAAAGAATTCTAGCTTGG - Intronic
1110474806 13:75901500-75901522 GAGTGAAAAGAATTTCAACACGG - Intergenic
1111677234 13:91401817-91401839 GGCTTAAAAGAATTGGAGCAGGG - Intronic
1112391664 13:98990693-98990715 GGCTGAAAAGAACTTGACCATGG - Intronic
1114150375 14:20031833-20031855 GGCTGAAAACAAGTGCAGCAAGG + Intergenic
1114177497 14:20336155-20336177 AGCTGAAGAGAATTTCATCATGG - Intergenic
1117106510 14:52402523-52402545 GGCTGAAAAGAATGAATGCTTGG + Intergenic
1117842406 14:59873413-59873435 GGCTGGAAAGAATTTCATCTTGG - Intergenic
1118783178 14:69023937-69023959 GGCTGGAAAGCATTACAGTTAGG - Intergenic
1120157726 14:81112534-81112556 GCAAGAAAAGAATTTCAGCTGGG - Intronic
1125067750 15:35510664-35510686 GGTTGAAAAAATTTTCTGCTGGG - Intronic
1127304457 15:57691068-57691090 GGCTGAAAATAAGTTCCCCTGGG - Intronic
1128028176 15:64457023-64457045 GGCTGCTAAGAATTTCCACTAGG - Intergenic
1128239264 15:66090096-66090118 GGCCTTAAAAAATTTCAGCTAGG + Intronic
1128959290 15:71984295-71984317 GACTTAAAATATTTTCAGCTTGG + Intronic
1129043014 15:72706614-72706636 GTCTTAGAAGAATTTCAGATCGG + Intronic
1135713563 16:24740038-24740060 TGTTGAAAAGACTTTCATCTTGG + Intronic
1135822890 16:25700282-25700304 GGCTCAAGAGAATGTCAGCATGG - Intronic
1137346147 16:47662032-47662054 GTCTGAAAAGTATTGGAGCTTGG + Intronic
1138558371 16:57785983-57786005 GGCTGCAAGGAATCGCAGCTGGG + Intronic
1140635834 16:76912084-76912106 GGCTGTAAAGAATTGCAAGTAGG + Intergenic
1140731026 16:77856403-77856425 GGGTAAAAAGAATTTCAACTGGG + Intronic
1144215307 17:13050044-13050066 GGCAGAAAAGAATCTCAGGTTGG - Intergenic
1144348601 17:14372608-14372630 GGTTAAAAAGAACATCAGCTAGG - Intergenic
1145039320 17:19565416-19565438 AGCTGAAAAGAAGTTTGGCTGGG - Intronic
1146755059 17:35423051-35423073 TACAGAAAAGAATTTCTGCTTGG - Exonic
1149479319 17:56989624-56989646 GGCTGCAAAGGGTTTCATCTTGG - Intronic
1151546110 17:74794181-74794203 GGGTGAGAAGAATTCCACCTGGG - Intronic
1153922024 18:9800292-9800314 GGCTGAAGAAAGTTTCAGGTTGG - Intronic
1154168922 18:12036753-12036775 GGCTAAAAAGAAGCTCAGATAGG + Intergenic
1155552622 18:26981879-26981901 AGCTGATAAGAACTTCAACTAGG - Intronic
1155571717 18:27202015-27202037 GGATTAAAACAATGTCAGCTGGG + Intergenic
1157804289 18:50646559-50646581 GGCTGCAAAGACTTTCAGCAGGG + Intronic
1158715143 18:59872164-59872186 GGCTGAAATGACTTTAAGCTTGG + Intergenic
1163082667 19:14954806-14954828 GGGTGAAGAGATCTTCAGCTTGG - Intronic
1202698675 1_KI270712v1_random:145861-145883 GGTTGAAAAGAATGTTAGATGGG + Intergenic
925157593 2:1659293-1659315 GGCTGAAAAGAATTTCAGCTAGG + Intronic
925355072 2:3235008-3235030 GTGAGAAAAGAATTTCAGCAAGG + Intronic
929599393 2:43195531-43195553 GGCTGAAAAGAAGCTGAGCTTGG - Intergenic
930351560 2:50262593-50262615 GGCTCATAAGAATTTCAGCTTGG - Intronic
931287220 2:60842734-60842756 GACAGAAAAGAATTTAAACTAGG + Intergenic
932438287 2:71716086-71716108 GGCAGAAAAGTAGTACAGCTTGG + Intergenic
934279922 2:91603645-91603667 GGTTGAAAAGAATGTTAGATGGG + Intergenic
934924648 2:98373757-98373779 TGCTGCAGAGAATTGCAGCTAGG + Intronic
936698472 2:114981176-114981198 TCCTGAAAAGACTTTCAGCTGGG + Intronic
941968453 2:171323558-171323580 GCCTGAAAATAATGTCAGCATGG + Exonic
942702881 2:178733324-178733346 AGCTGAATAAAATTTGAGCTGGG + Exonic
945280231 2:208028929-208028951 GGCTGAGAATAATCTCAGCTAGG + Intergenic
945895958 2:215481923-215481945 GGCTAAAAAGAAATAGAGCTGGG + Intergenic
946270222 2:218585935-218585957 AGTTTAAAAAAATTTCAGCTAGG - Intronic
1169748357 20:8965660-8965682 AGCTGACAAGAAATTCAGCCTGG - Intronic
1170198987 20:13721845-13721867 CCCTGAAAAAAATTTCAGATAGG - Intronic
1170845890 20:19961646-19961668 GGCTGAGTAGAATCTCATCTCGG - Intronic
1170886803 20:20346661-20346683 GACTGAATAAAATTTCACCTTGG - Intronic
1171489162 20:25504451-25504473 GGCTGAGAAGAACTCCAGCAAGG + Intronic
1173589942 20:44216892-44216914 GGCTGAAAATAAGTTCAGGAGGG - Intergenic
1174125032 20:48298072-48298094 GGCTGCAAACAGTATCAGCTGGG + Intergenic
1175313547 20:58028605-58028627 GGCTGAAAGGGATTTCAGGCAGG - Intergenic
1175427275 20:58876413-58876435 TTCTGAAAATAATTTCAGGTGGG - Intronic
1175608648 20:60331991-60332013 GACTGTAAATATTTTCAGCTTGG + Intergenic
1175760329 20:61558388-61558410 CGCTGAAAAGAATTTCTCCATGG - Intronic
1176071974 20:63231817-63231839 GGCTGACAAGAATTGCATGTCGG - Intergenic
1176409243 21:6438878-6438900 GGCTGAGAACAGTTTCAGTTCGG - Intergenic
1178131726 21:29580960-29580982 GGCTGAAATGAATCTCAGTAGGG + Intronic
1179684738 21:43047200-43047222 GGCTGAGAACAGTTTCAGTTCGG - Intergenic
1180172549 21:46067303-46067325 GGCTGAAAAGGAGCTCGGCTGGG + Intergenic
1181780093 22:25186265-25186287 GGCAGAAAAGACTTCCAGCTGGG + Intronic
1181985028 22:26794467-26794489 GGCAGAAAAGAACTTGACCTTGG - Intergenic
1182113235 22:27739305-27739327 AGCTGTCAAGAGTTTCAGCTGGG - Intergenic
1183082440 22:35465156-35465178 GGATGAAAAGAAACCCAGCTGGG + Intergenic
949323787 3:2841206-2841228 GGATCAAAAGAGTTACAGCTGGG + Intronic
949750380 3:7345613-7345635 GGCTGCAAACAATTTCTGCCGGG - Intronic
949841545 3:8325667-8325689 GGCTGAAAAGAAGGTCATGTTGG + Intergenic
950493765 3:13321647-13321669 TGCTCAAAAGGATTTCAGCCTGG + Exonic
954120097 3:48492832-48492854 GGCTGAAAACAACTCCATCTTGG - Intronic
954543725 3:51415195-51415217 GGCTGTAAATACTATCAGCTGGG + Intronic
955671843 3:61410640-61410662 TGCTGTTAAGTATTTCAGCTGGG + Intergenic
955992011 3:64637964-64637986 GGCTGTAAGGAATTACAGCAAGG - Intronic
958270717 3:91495910-91495932 GTCGGAAAATAATTTAAGCTTGG + Intergenic
959648290 3:108726880-108726902 GGCTGAAAAGCCTTTTAGCCGGG + Intergenic
960942916 3:122946245-122946267 GGCTGAAGAGAAACACAGCTTGG + Intronic
962426412 3:135272616-135272638 GAGAGAAAAGAATTTCAGCCTGG + Intergenic
964003340 3:151803277-151803299 GAAGGAAAAGAATTTCAACTTGG - Intergenic
964186276 3:153947658-153947680 GGCTGAAATCAAGGTCAGCTGGG - Intergenic
965961885 3:174439438-174439460 GAATGGAAGGAATTTCAGCTAGG - Intronic
966291855 3:178368663-178368685 GGTAGCAAAGAATTTCAGGTTGG - Intergenic
968032535 3:195512922-195512944 TACTGAAAAAAATTTCAGGTTGG + Intergenic
969030837 4:4212202-4212224 GGTTGAAAAGAATGTTAGATGGG - Intronic
970349717 4:15189864-15189886 GGTTAAAAAGAATTTCAAATAGG + Intergenic
971030384 4:22630631-22630653 AGCTGATAAGAACTTCAACTAGG - Intergenic
971579650 4:28319046-28319068 GACTGAAAAAAAATTCAGCAAGG + Intergenic
975286459 4:72627151-72627173 GTCTGAAAAGGATTCCAGCAGGG - Intergenic
976062994 4:81152680-81152702 GGCTGAATAGAAATTCTGTTTGG + Intronic
979121065 4:116902289-116902311 GGAAGAAAAGAATTTCAAATAGG + Intergenic
979772591 4:124546994-124547016 TGCTGAAAAGGATTCCAACTGGG - Intergenic
981974522 4:150709474-150709496 GGCTGAAAATAATTCTACCTTGG + Intronic
983403521 4:167296029-167296051 GACTGAAAAGAATTTCTACTAGG - Intergenic
984959040 4:185076721-185076743 GGATGACAAGAGTTACAGCTTGG - Intergenic
985910835 5:2879977-2879999 TGCTGAAAATAATTCCAGATTGG - Intergenic
987739461 5:21887245-21887267 GTCTGAAAACAATATCAGCAAGG - Intronic
989297427 5:39846404-39846426 GGCTGAAACCAATTTCTGCAGGG - Intergenic
990791561 5:59486214-59486236 TTCTGAAAAGAATGTCATCTAGG + Intronic
991141096 5:63243959-63243981 TACAGAAAAGAATTTCGGCTGGG - Intergenic
991344641 5:65650455-65650477 GGATTAAAAAAATTCCAGCTGGG - Intronic
992121438 5:73597347-73597369 TCCTGAAATGAATCTCAGCTGGG - Intergenic
993033078 5:82727054-82727076 GGCTGAGAAGAAGTGCATCTTGG + Intergenic
994045250 5:95301852-95301874 GACTGAAAAACATTTCAGTTTGG + Intergenic
994716520 5:103328237-103328259 GGTTGAAAAGATTTTCAACTAGG - Intergenic
996208629 5:120776204-120776226 GGATGAATAGAATTTCAACAAGG - Intergenic
996696450 5:126402092-126402114 GGCTGAAAACCAATTCAGCTGGG - Intronic
997089097 5:130835502-130835524 GGCTGAGATGAATTTCATTTGGG - Intergenic
997318154 5:132955106-132955128 GGTTGGAGAGGATTTCAGCTAGG - Intronic
997752593 5:136361679-136361701 GGCTGAATTGATTTTAAGCTTGG - Intronic
999224861 5:150012790-150012812 TGCTGAAAAAAATATCAACTGGG - Intronic
999738873 5:154534183-154534205 GGCTGAAAATATTTTCAGCTGGG - Intergenic
1002073387 5:176694041-176694063 GGCTGATGAGAGCTTCAGCTTGG + Intergenic
1005328851 6:24729436-24729458 GGCTGACAGGAAGTTCAGTTTGG - Intergenic
1009737267 6:67692029-67692051 GGCTGAAAAAATTTTAAGCAAGG - Intergenic
1010975857 6:82312967-82312989 GGCTCAAGAAAATTTGAGCTTGG - Intergenic
1013121553 6:107145808-107145830 GGCTGAACAGAATTAAAGGTGGG + Intergenic
1014066985 6:117138566-117138588 GGATGGAAAGAATATCAGCTAGG + Intergenic
1021314472 7:19130284-19130306 TGCTCATAAGAATTTCAGCTTGG + Intergenic
1022926950 7:35066218-35066240 GGATGAAAATGATTTGAGCTGGG - Intergenic
1023247248 7:38218054-38218076 TGTGGAGAAGAATTTCAGCTTGG - Intronic
1024371339 7:48587230-48587252 GGCTGTAGAGAGTTTCCGCTTGG - Exonic
1025875604 7:65477692-65477714 GGCGGGAAAGAAATTCAGCAGGG - Intergenic
1026544383 7:71309075-71309097 GACTCAAAAGGATTTGAGCTAGG - Intronic
1028706591 7:93855466-93855488 GTCTGAAAAGCATCTCACCTAGG - Intronic
1029795283 7:102888240-102888262 GACTGAAAAGAATTCCAGGCTGG + Intronic
1031195316 7:118606632-118606654 GGCAGAAAAGTATTTCAGACAGG - Intergenic
1033162379 7:139009115-139009137 GGCTCTAAAGATTTTCAGATTGG - Intergenic
1033841904 7:145385878-145385900 GGCTGAAAGGAACTTTTGCTGGG + Intergenic
1035981436 8:4376744-4376766 GGCTGAAAAATATTGCAGCTGGG - Intronic
1036744406 8:11394010-11394032 GGCTGAAAGCATCTTCAGCTGGG + Intronic
1038718926 8:30015823-30015845 GGCTGTAAAGAATTTTAGGAAGG - Intergenic
1042569916 8:70152515-70152537 GTCTAAAAAGAATTTCTTCTTGG - Intronic
1042885815 8:73549485-73549507 GGTTTAAAAGAATTTGAGCTTGG + Intronic
1042906268 8:73775574-73775596 GGCTGTAAAGAAGGTCATCTTGG - Intronic
1043321166 8:78988632-78988654 GGATGAAAACATTTTCAGTTTGG + Intergenic
1043341386 8:79244108-79244130 AGCTCAAAAGAATTTCAGGGGGG - Intergenic
1043926362 8:86041307-86041329 GACTGAAAAGAATTTCTTGTGGG - Intronic
1044308433 8:90665380-90665402 GGCTGCAGAGAATTTTGGCTAGG + Intronic
1044377171 8:91489171-91489193 GGCAAAAACCAATTTCAGCTTGG + Intergenic
1044937318 8:97305578-97305600 GGTTGAAAAGAATTGCTTCTTGG + Intergenic
1046096306 8:109566143-109566165 AGCTGAAAAGTATTTAAGTTTGG + Intergenic
1046281494 8:112039213-112039235 TGCTGACAAGAATTTCAGATAGG + Intergenic
1046361893 8:113170535-113170557 GAGTGCAAGGAATTTCAGCTAGG - Intronic
1046961892 8:120121718-120121740 GGGGGAAAAGAATCACAGCTGGG + Intronic
1053365798 9:37521677-37521699 GGCTCAAGAGAACTTCAGCGAGG - Exonic
1056423262 9:86451077-86451099 GGCTGAAAAGAATTTCCAAATGG + Intergenic
1056666673 9:88586876-88586898 GGCTGAAAATAATTTTCCCTTGG + Intergenic
1057535389 9:95898178-95898200 GGCAAAACAGAATTTCAGCTTGG + Intronic
1058825948 9:108776103-108776125 GGCTGAGAAGGGTTTCAGCTGGG - Intergenic
1059938052 9:119331412-119331434 GCCTTAAAACAATTTCAGTTTGG + Intronic
1062311626 9:135941039-135941061 GGCAGAAAAAGACTTCAGCTGGG + Intronic
1185915768 X:4033718-4033740 CGGTGGAAAGAATTACAGCTAGG + Intergenic
1186819084 X:13268184-13268206 AGCTGAAAAAAATTTAAGCCAGG - Intergenic
1192355758 X:70401694-70401716 AACTGAAAAAAATTTTAGCTGGG - Intronic
1194939499 X:99992914-99992936 GGCTGAAAAGAAATTCAGTTTGG + Intergenic
1196810020 X:119621414-119621436 GGCTGCAAAGAGTCACAGCTGGG + Intronic
1198217636 X:134570341-134570363 GGCTAAAAATACCTTCAGCTGGG - Intronic
1198546243 X:137695608-137695630 TACTAAAAAGATTTTCAGCTGGG - Intergenic
1199438066 X:147836580-147836602 AGTAGAAAAGAATTTCAGCTAGG - Intergenic
1200704403 Y:6429311-6429333 GGATGAAAAGAACTTCAGGTAGG - Intergenic
1201029708 Y:9735397-9735419 GGATGAAAAGAACTTCAGGTAGG + Intergenic