ID: 925159070

View in Genome Browser
Species Human (GRCh38)
Location 2:1670237-1670259
Sequence TTATTTAACAAGTTCTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 0, 2: 8, 3: 56, 4: 555}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925159070_925159072 0 Left 925159070 2:1670237-1670259 CCAAAAGAGAACTTGTTAAATAA 0: 1
1: 0
2: 8
3: 56
4: 555
Right 925159072 2:1670260-1670282 ATTATGGTGCATTTAGATCATGG 0: 1
1: 0
2: 2
3: 27
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925159070 Original CRISPR TTATTTAACAAGTTCTCTTT TGG (reversed) Intronic
901848933 1:12002858-12002880 TTATGTAAAAAGTACTGTTTGGG - Intronic
904061998 1:27718936-27718958 TTTTTTAAAAAGTTTTATTTCGG + Intergenic
904643679 1:31949526-31949548 TTATTTAACAGGTTCCCTATTGG + Intergenic
905713827 1:40131197-40131219 TTATATAGCAAGTTTTTTTTTGG - Intergenic
905724487 1:40238754-40238776 ACATTTGACAAGTTCCCTTTTGG - Exonic
906001316 1:42428424-42428446 TTGTTTTAGAACTTCTCTTTTGG + Intergenic
906916435 1:50016024-50016046 GTATTTCCCAAGTTTTCTTTAGG - Intronic
908694659 1:66825136-66825158 TTATTTAAGAAGTTGTGTTAGGG - Intronic
910012022 1:82476052-82476074 TTATTTGAAAAGTTGCCTTTTGG + Intergenic
910346142 1:86240941-86240963 TTATTTAACAAGTACACATCAGG - Intergenic
911757338 1:101574205-101574227 TTATTTAAAAAATTCTGTTTTGG + Intergenic
911899052 1:103477814-103477836 ATATTTCCCAAGTTCTCTTATGG + Intergenic
912119243 1:106449872-106449894 ATATCTAACAGGTTTTCTTTTGG + Intergenic
913015025 1:114724210-114724232 TTATTTAAACAATTCTATTTAGG - Intronic
913448517 1:118975397-118975419 CAATTTAACAATTTCTGTTTTGG + Intronic
913547904 1:119887636-119887658 TTTATAGACAAGTTCTCTTTGGG + Intergenic
914046198 1:144094953-144094975 TTATTTAACCAGTCTCCTTTAGG - Intergenic
914131912 1:144865732-144865754 TTATTTAACCAGTCTCCTTTAGG + Intergenic
914749660 1:150526060-150526082 TTTTTTAAAAAGTTTTTTTTTGG + Intergenic
916323654 1:163533551-163533573 TTATCTACCTGGTTCTCTTTGGG + Intergenic
916865403 1:168851016-168851038 TCATTTAATAAGTTCTTTCTGGG - Intergenic
917021035 1:170587267-170587289 TTTTTAAAAAACTTCTCTTTTGG + Intergenic
917299268 1:173555948-173555970 TTATTTAATACCTTCTTTTTGGG - Intronic
918694240 1:187523457-187523479 TTATTTAACAAATATTCGTTGGG - Intergenic
918732841 1:188020152-188020174 GTATGTAGCAAATTCTCTTTTGG - Intergenic
918765077 1:188471280-188471302 TTATTGAATAATTTATCTTTTGG - Intergenic
919486337 1:198152477-198152499 TAATTTAAAAAATTATCTTTGGG + Intergenic
919737375 1:200961166-200961188 TTATTTACGAATTTCACTTTAGG - Intergenic
920146178 1:203863012-203863034 TCATTTAATAAGTTCTATATTGG - Intronic
920163476 1:204017992-204018014 CTAGGTAAGAAGTTCTCTTTGGG - Intergenic
920331788 1:205213686-205213708 TTATTTAACAAGTCTTCTATTGG + Intergenic
921242754 1:213202921-213202943 TTATTTAATTCGTTCTCTTTAGG + Intronic
921324114 1:213973611-213973633 TTATTCAACAAATACTTTTTGGG - Intergenic
921549790 1:216521112-216521134 TTATTTGACAGGATTTCTTTTGG + Intronic
922000479 1:221472785-221472807 TTTTGTAATAAGTACTCTTTAGG - Intergenic
922991199 1:229913208-229913230 TTATTTAATAAGTGATTTTTGGG - Intergenic
923785141 1:237059320-237059342 TTATTTATCAGATTCTGTTTGGG - Intronic
923867721 1:237957848-237957870 TAATTTAGCACTTTCTCTTTTGG + Intergenic
1062985327 10:1763106-1763128 TTTTTTAAAAAGTTGTCTTGGGG - Intergenic
1063084403 10:2802386-2802408 TTATTTATCATTTTCTCATTTGG - Intergenic
1063270290 10:4501425-4501447 TTAGTTAATCATTTCTCTTTAGG - Intergenic
1063768919 10:9175679-9175701 TTATTTCACATGTTCTGTTGGGG - Intergenic
1063949077 10:11205716-11205738 TCATTTAAGAAATTCACTTTTGG - Intronic
1064809656 10:19181186-19181208 TGATTTAGCAATCTCTCTTTTGG + Intronic
1064918934 10:20494307-20494329 TTATTTAAGAAGAACTCTCTAGG + Intergenic
1064927406 10:20584438-20584460 TTATTTAAGAAGGAGTCTTTAGG - Intergenic
1065064128 10:21942346-21942368 GTTTTTATCAAGTTCTATTTAGG - Intronic
1065933703 10:30501558-30501580 TTGTTTAACAAGTATTGTTTGGG + Intergenic
1068189535 10:53633247-53633269 TTATTTAGCATCTTTTCTTTGGG + Intergenic
1068379076 10:56225081-56225103 TTATACAACAAGTTGCCTTTTGG - Intergenic
1068756910 10:60666037-60666059 TTATCCAACAACTTCACTTTGGG + Intronic
1069432097 10:68346875-68346897 TTATTTTATAAGACCTCTTTAGG + Intronic
1070066820 10:73043575-73043597 TCATTAAACAAGGCCTCTTTTGG - Intronic
1070236505 10:74633347-74633369 TTATTTTACTAATCCTCTTTTGG + Intronic
1070910588 10:80114589-80114611 TTATTTCAAAAATTATCTTTTGG + Intergenic
1071351785 10:84753858-84753880 TTATTTAGATATTTCTCTTTTGG + Intergenic
1071619976 10:87110307-87110329 ATAAATAAAAAGTTCTCTTTTGG + Intronic
1073012845 10:100374694-100374716 TTATTCTATAATTTCTCTTTAGG - Intergenic
1073209191 10:101784683-101784705 TTTTTTAGCAAGTTTGCTTTTGG - Exonic
1073549395 10:104383394-104383416 TTGTTTAACAAATACTTTTTTGG - Intronic
1074599989 10:114904319-114904341 TTATTGAACAGGTCATCTTTTGG + Intergenic
1074675458 10:115844098-115844120 TTAGTTTACAAGTTCTGCTTTGG + Intronic
1074835902 10:117293331-117293353 TCATTTTAAAAGTTCTATTTTGG - Intronic
1075304673 10:121356963-121356985 AAATTTAACATTTTCTCTTTAGG - Intergenic
1077894681 11:6444855-6444877 ATATTTAACAACTGCTCTCTAGG + Intergenic
1078721778 11:13891195-13891217 TTATTTAGTAAAGTCTCTTTGGG - Intergenic
1078849782 11:15153169-15153191 TTATTCAGTAACTTCTCTTTTGG + Intronic
1078863530 11:15275617-15275639 TTTTGTTTCAAGTTCTCTTTAGG + Intergenic
1079872781 11:25821307-25821329 TGATTTAGCAACTTCTCTCTTGG + Intergenic
1080889278 11:36395200-36395222 TTATTTAACCAGTCCCCTATGGG - Intronic
1080901696 11:36499635-36499657 TGACTTAACAAGATCTATTTTGG - Intronic
1081067182 11:38558784-38558806 TGTTTTAACAAGATCTCATTAGG + Intergenic
1081554631 11:44147042-44147064 TAAATTAACAATCTCTCTTTAGG - Intronic
1085004322 11:73071106-73071128 TTATTTTACAAGAACACTTTTGG + Intronic
1085021204 11:73210069-73210091 GTATTTAACCAGTCCTCTGTTGG - Intergenic
1086389927 11:86353328-86353350 TTGTTTATGCAGTTCTCTTTAGG - Intergenic
1086563080 11:88191456-88191478 ATATTTAAAAAGCTCTATTTGGG - Intergenic
1087592247 11:100205215-100205237 TCATTTTGCAATTTCTCTTTCGG + Intronic
1087897087 11:103598363-103598385 TTATTCAACTAGTCCTCTATCGG + Intergenic
1088149501 11:106726784-106726806 AAAATTAACAAGTTCCCTTTGGG + Intronic
1088159039 11:106845852-106845874 GTAATTAACAAGTTATCTGTAGG - Intronic
1088819471 11:113445336-113445358 TTATATAAAACGTTCACTTTAGG + Intronic
1089135942 11:116249189-116249211 TTCTTTCCCAAGTTCTCTTATGG - Intergenic
1089211585 11:116807640-116807662 AAATTTGTCAAGTTCTCTTTGGG - Intergenic
1090795700 11:130134111-130134133 TTATTCAACAAGTTTTATTATGG + Intronic
1091899014 12:4128439-4128461 ATATTTTAAAATTTCTCTTTGGG - Intergenic
1092501811 12:9055183-9055205 TTAATTAATAAGTTATGTTTAGG - Intergenic
1092694754 12:11158688-11158710 ATATTTAACAATTTCTTTTTTGG - Intronic
1093250458 12:16796952-16796974 ATATTTAACAATTTCTGCTTTGG - Intergenic
1093458812 12:19389750-19389772 TTATTTAACCAGTTCGCTGCAGG - Intergenic
1093819813 12:23600367-23600389 TTATTTAATTTGTTCCCTTTTGG - Intronic
1094241137 12:28226098-28226120 TGATTTAACCAGTTTTATTTTGG + Intronic
1095391455 12:41712217-41712239 TTTTTTAAAAAGTACTATTTTGG - Intergenic
1095406570 12:41873035-41873057 TTATTTAACCAGTAGTCATTTGG - Intergenic
1096349633 12:50885428-50885450 TTGTTTGACAAGTTCCCTTCTGG - Intronic
1096597307 12:52704331-52704353 TTTTTTAAAAAATTATCTTTAGG - Intergenic
1096625505 12:52893107-52893129 TTACTTAACCAGTCCTCTATTGG - Intergenic
1097089861 12:56496442-56496464 TTATTTAACAAATTCCCTATTGG + Intergenic
1097238821 12:57559106-57559128 TTATTTAACCAGGCCTCTGTTGG + Intronic
1097705511 12:62864669-62864691 TGATTTAAGAAGTTCTCAGTGGG - Intronic
1098361439 12:69658060-69658082 TTAGTGAACAAGTTCACTTGTGG - Intronic
1098427262 12:70378835-70378857 TTATTTAAAAAATACACTTTGGG - Intronic
1098607529 12:72410759-72410781 ACATTTAACATTTTCTCTTTTGG + Intronic
1099630405 12:85135525-85135547 TTATTTAACTAGTTATCCTAAGG + Intronic
1100562300 12:95759954-95759976 TTATTCATCAATTTTTCTTTTGG + Intronic
1100763534 12:97836322-97836344 TTATTTTACAATATCCCTTTAGG - Intergenic
1101178264 12:102180271-102180293 CTGTTTAACAAGTTTGCTTTTGG + Intronic
1101182445 12:102234005-102234027 TTATTTAAAAAATACTCTTATGG + Intergenic
1101734910 12:107455896-107455918 GAATTGAACAAGTTTTCTTTAGG + Intronic
1101899478 12:108780619-108780641 ATAGCTAACAAATTCTCTTTGGG - Intergenic
1102424948 12:112836581-112836603 TTTTTTAACCATCTCTCTTTAGG - Intronic
1102431213 12:112884500-112884522 TTATTTAGCCAATTCCCTTTGGG + Intronic
1103272431 12:119684562-119684584 CTATTAAGCAAATTCTCTTTTGG + Intergenic
1103279084 12:119739881-119739903 TTATTTAATAACTGCTCTTTGGG - Intronic
1103308399 12:119985780-119985802 TTATTTAAAAACTTTTTTTTTGG + Intergenic
1104099865 12:125597262-125597284 TTTTTTATCAATTTTTCTTTTGG - Intronic
1105765561 13:23555212-23555234 TCATTCAACAAATGCTCTTTTGG + Intergenic
1106472432 13:30069195-30069217 TTACTTAACAATTCCTCTTTTGG - Intergenic
1106727261 13:32498700-32498722 TTTTTTAAAAATTTATCTTTTGG + Intronic
1107575603 13:41717377-41717399 TTACTTAACTAATTCTCTATTGG - Intronic
1108252404 13:48580315-48580337 TTTTTTAACAAGCTCTTTCTAGG - Intergenic
1108864157 13:54902357-54902379 TTATGTAAAAAGTTTTATTTGGG - Intergenic
1108983668 13:56555000-56555022 TTATTTATAAATTTATCTTTAGG - Intergenic
1110087536 13:71400481-71400503 CTTTTCAACAAGATCTCTTTTGG - Intergenic
1110171434 13:72505610-72505632 TTATTTAAAAAAATCTCCTTTGG + Intergenic
1110527926 13:76561087-76561109 TTATTTATTATTTTCTCTTTAGG - Intergenic
1110634527 13:77751352-77751374 TTATTTTAGATTTTCTCTTTAGG + Intronic
1110733216 13:78905241-78905263 TTATTTAAATATGTCTCTTTAGG + Intergenic
1111088712 13:83412959-83412981 TTATTTAAAAATTTCCATTTTGG - Intergenic
1111144242 13:84159026-84159048 TTATTCAACACGTGCTCATTAGG + Intergenic
1111331305 13:86763772-86763794 GTATTTAGCACGATCTCTTTGGG + Intergenic
1111340882 13:86883776-86883798 TTATTTGAAAAGTACTCTGTTGG + Intergenic
1111465917 13:88610563-88610585 TTATTTTTCAAGTGCTTTTTTGG + Intergenic
1111506984 13:89203889-89203911 TAAGTAAACAAGTTCTCTATGGG + Intergenic
1111625141 13:90775230-90775252 TTATTCAACAAGTACTTATTGGG - Intergenic
1111693520 13:91593969-91593991 TTTTTGAACAAGTTCTTATTTGG + Intronic
1111766213 13:92533177-92533199 TTATTTAAAAAGTACTTTTAAGG - Intronic
1112662313 13:101524330-101524352 TTATAAAAGAAGTTCTTTTTTGG + Intronic
1112724464 13:102286581-102286603 TTATTTAACAAGTACCCATTAGG - Intronic
1113439390 13:110315839-110315861 TTATGTAACAAGCTCTGTTGAGG - Intronic
1114041163 14:18679947-18679969 TTATTTCAAAAGTTATCTTTTGG + Intergenic
1114046189 14:18878415-18878437 TTATTTCAAAAGTTATCTTTTGG + Intergenic
1114118021 14:19641035-19641057 TTATTTCAAAAGTTATCTTTTGG - Intergenic
1114507308 14:23227110-23227132 TTATATAAGAAGTTATCGTTGGG + Intronic
1114897966 14:27016155-27016177 TTATTTCACATGAACTCTTTGGG - Intergenic
1114926359 14:27404505-27404527 TTTTTTAACATATTATCTTTAGG + Intergenic
1115387782 14:32817916-32817938 TAACTAAAAAAGTTCTCTTTGGG - Intronic
1115513819 14:34165299-34165321 GTATTTTAGAAGTGCTCTTTGGG - Intronic
1115823483 14:37237519-37237541 TTTTTTAAAAAATTCTCTCTGGG + Intronic
1116169226 14:41377767-41377789 TGATTTACCTAGTTCTATTTTGG - Intergenic
1116574597 14:46557089-46557111 TTATTTCTGAATTTCTCTTTTGG + Intergenic
1117260267 14:54025482-54025504 TTATTTAAGAATCTGTCTTTAGG - Intergenic
1117876177 14:60251733-60251755 TTATTTAACAAATTCTAAGTTGG + Intronic
1118071949 14:62255157-62255179 TCATTTAAAAAGTTCTCCTAAGG - Intergenic
1118306109 14:64656860-64656882 TTAAATAATAACTTCTCTTTTGG - Intergenic
1118393215 14:65313986-65314008 TAATTTAAAAAGTACTCTATAGG - Intergenic
1118658847 14:67984893-67984915 TTATTTTACACTTTCTATTTGGG - Intronic
1119622651 14:76144073-76144095 TTCTTTAAAAAAATCTCTTTCGG + Intergenic
1120006599 14:79365025-79365047 TTATTTGTCAGATTCTCTTTTGG + Intronic
1120241581 14:81955941-81955963 ATGTTTAACAAGTTTCCTTTTGG - Intergenic
1120449260 14:84645287-84645309 TTACTTAAAACTTTCTCTTTTGG - Intergenic
1120656374 14:87194988-87195010 TTATTTAACTAGTTCTTCATTGG - Intergenic
1122236658 14:100334354-100334376 TTACTTATCAATTTCTTTTTGGG + Exonic
1122333000 14:100939206-100939228 TTATTTTACACGTTCCCTTATGG + Intergenic
1122506641 14:102235895-102235917 GTATTTAGCACGATCTCTTTGGG - Intronic
1123665061 15:22602230-22602252 TTTCTTAAAAAGTTCTTTTTTGG - Intergenic
1123752699 15:23370423-23370445 TTTCTTAAAAAGTTCTTTTTTGG + Intergenic
1123855642 15:24408367-24408389 GTATTTAAAAAGTTCTTTTGAGG + Intergenic
1124318893 15:28696652-28696674 TTTCTTAAAAAGTTCTTTTTTGG - Intergenic
1124562379 15:30786914-30786936 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1125456552 15:39865958-39865980 TTATTTAACTGGTTCCCTCTTGG - Intronic
1125890112 15:43259342-43259364 ATTTTTAACTAGTTCTCTATGGG - Intronic
1125963828 15:43856169-43856191 TTATTTAACCAGATCTCTCTTGG + Intronic
1127392553 15:58518472-58518494 TTATCTAAAAAGTTCTCTTCTGG + Intronic
1127514939 15:59684398-59684420 TTATTTAGCACTTTCTCTGTTGG + Intronic
1127777306 15:62275203-62275225 TTATTGAACCAGTTCCCTGTTGG + Intergenic
1127860404 15:62989187-62989209 GAATTTAACAAAGTCTCTTTGGG + Intergenic
1128990125 15:72252872-72252894 TGATTTTTCAAGTTCTCTTTAGG - Intronic
1130267936 15:82425670-82425692 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1130504089 15:84521164-84521186 TTACTTAACCAGTTCCCTGTTGG + Intergenic
1130639602 15:85659540-85659562 TTATTTAACAACTTATTTTCTGG - Intronic
1131497698 15:92928332-92928354 TTAATTAACACATTCTCTGTAGG + Intronic
1131856271 15:96599344-96599366 TTATTTCACAATTACTCTTGTGG + Intergenic
1132183945 15:99787218-99787240 TTACTTAACCAGTTCCCATTTGG - Intergenic
1132434436 15:101785927-101785949 TTACTTAACCAATTCCCTTTTGG + Intergenic
1133452074 16:5912000-5912022 TTATTTTAGAGGTTCTCCTTTGG - Intergenic
1133650441 16:7807568-7807590 TCATAAAACAGGTTCTCTTTTGG - Intergenic
1134836104 16:17362482-17362504 TTATTTAAACAGTTACCTTTGGG - Intronic
1137267548 16:46881507-46881529 TAATTTAACAAATTCTTCTTGGG - Intergenic
1137395590 16:48114477-48114499 TTATGTAACATGTTCTCTGCAGG + Intronic
1137926984 16:52548846-52548868 TTTTTTAAAAAATTCTTTTTTGG - Intergenic
1138149827 16:54646462-54646484 TTGTTTTATAAGTACTCTTTGGG - Intergenic
1138257086 16:55575023-55575045 TTATTTATAAACTTCCCTTTGGG - Intronic
1138906951 16:61348335-61348357 ATATTTCAAATGTTCTCTTTTGG + Intergenic
1139216138 16:65125386-65125408 CTATTCAGCAAGTTCTATTTTGG + Intronic
1140131021 16:72161651-72161673 TTATTTAAGAAGTTAACCTTAGG - Intronic
1140673335 16:77301003-77301025 ACAGTTAACAAATTCTCTTTGGG - Intronic
1140822428 16:78675444-78675466 TTATTTAACAAATACTTTTATGG + Intronic
1140933799 16:79652456-79652478 ATATTTAAAAACGTCTCTTTGGG + Intergenic
1142368454 16:89663814-89663836 TTATATAAAACGTTCGCTTTGGG + Intronic
1142665483 17:1460871-1460893 TTCTTTAAAAAATTCTTTTTTGG - Intronic
1144836726 17:18160297-18160319 TGAATCAACAAGTTCCCTTTTGG - Intronic
1145931490 17:28689264-28689286 TTATTTAACCAGTTCCCCATTGG + Intronic
1147029883 17:37624344-37624366 CTTTTTAACAAGTTCTCTCACGG + Exonic
1147467702 17:40623766-40623788 ATATTTTAGTAGTTCTCTTTAGG - Intergenic
1147696159 17:42355130-42355152 TTATTTCACAATTTCAATTTTGG + Intronic
1147860086 17:43514771-43514793 TTATTAAACTACTTCCCTTTTGG - Intronic
1148006710 17:44437655-44437677 TTTTTTAAAAAGTTTTTTTTGGG - Intronic
1149806864 17:59626345-59626367 TTATTTAAAAGTTTCTTTTTGGG - Intronic
1152061692 17:78080877-78080899 TGAATTAACACGTTCTCTTTTGG - Intronic
1153135045 18:1907359-1907381 ATATGAAACAAGTTTTCTTTAGG + Intergenic
1153386780 18:4507262-4507284 TTCTTTATCTAGTTCTCTATAGG - Intergenic
1153505867 18:5797112-5797134 TTAATTAAAATGTTCACTTTGGG + Intergenic
1153902665 18:9631957-9631979 TTGTTTAATAAGTTCTCTATTGG - Intergenic
1153968376 18:10202645-10202667 TTATTTATCAACTTATTTTTTGG + Intergenic
1155511176 18:26578899-26578921 TTACTTAAGAAGTGCTCATTAGG + Intronic
1155777849 18:29791001-29791023 TTATTTAAAACTTTCACTTTAGG + Intergenic
1155865378 18:30958459-30958481 TTTTTTAAAATATTCTCTTTTGG + Intergenic
1156849631 18:41711479-41711501 TTAGTTTACAAATTCTCTCTAGG - Intergenic
1156849695 18:41712152-41712174 TTACTTTACAAATTCTCTCTAGG - Intergenic
1157023204 18:43811870-43811892 TTACTCAACAAGTTCTCTCCTGG + Intergenic
1157205013 18:45690497-45690519 TTATTTAAAATTTTTTCTTTTGG - Intergenic
1157676779 18:49574449-49574471 ATACTTTGCAAGTTCTCTTTTGG + Intronic
1157685041 18:49636395-49636417 TTGTTTAATAACTTCTGTTTAGG - Intergenic
1157844087 18:50986272-50986294 TTATTTAATAAGCTCACCTTTGG - Intronic
1158123484 18:54076538-54076560 TTACTTGACATTTTCTCTTTAGG + Intergenic
1158186031 18:54772755-54772777 TTATTTAACAAGTTTTCATTAGG + Intronic
1158240754 18:55375423-55375445 TTATTAAATAAGTTTTCTGTAGG - Intronic
1158439564 18:57462632-57462654 ATATATAACTATTTCTCTTTGGG + Intronic
1158635819 18:59156475-59156497 TTATTTAACCAATCCCCTTTTGG + Intronic
1158721009 18:59924710-59924732 TTGTTAAACAACTTCTATTTTGG - Intergenic
1158798114 18:60872946-60872968 ATATTTAACAAAATATCTTTTGG + Intergenic
1158800967 18:60908259-60908281 TTATTTATCAACTTTTCTATTGG - Intergenic
1159163884 18:64678154-64678176 TTACTTAGCTACTTCTCTTTGGG + Intergenic
1159537803 18:69737113-69737135 TTATTTAAAATGTGTTCTTTTGG - Intronic
1163883357 19:19946087-19946109 GTATTTAGCAAGATCTCTTTAGG - Intergenic
1164308318 19:24024542-24024564 TAATTTAACAATTTCTCCCTAGG + Intergenic
1164976739 19:32579277-32579299 TTATCCAACAATTTCTCTTCTGG + Intergenic
1165715434 19:38042608-38042630 TTTTGGAACAAGTGCTCTTTGGG - Intronic
1202685751 1_KI270712v1_random:48368-48390 TTATTTAACCAGTCTCCTTTAGG - Intergenic
925159070 2:1670237-1670259 TTATTTAACAAGTTCTCTTTTGG - Intronic
925968300 2:9086937-9086959 TTTTTTAAGACATTCTCTTTTGG + Intergenic
926545754 2:14237195-14237217 TTATTTAACAAGTTCCAGATGGG + Intergenic
926651989 2:15356900-15356922 TTCCTTAACAAATTCTCGTTGGG + Intronic
926855822 2:17254953-17254975 TTTCTTAAAAAGTTCACTTTTGG - Intergenic
927244679 2:20948027-20948049 TTATTGAATTAGTTCTCTATGGG + Intergenic
928831073 2:35483490-35483512 TTATTTAATAATGTCTTTTTTGG - Intergenic
928961198 2:36927966-36927988 TTATTTAACCAGTCTCCTTTAGG - Intronic
928995174 2:37281738-37281760 TTAATTAACATTTTCTCTTGTGG - Intronic
929409366 2:41679593-41679615 TTGTTTTACAAGTTTTCCTTTGG + Intergenic
930344879 2:50167537-50167559 TTTTTTAACAGTTTCTCCTTAGG - Intronic
930989413 2:57633142-57633164 TTGTTTAACAATTTTTCTATTGG + Intergenic
931132634 2:59354463-59354485 TTATTTAGCAGTTTTTCTTTGGG - Intergenic
931523282 2:63124007-63124029 TTATTTAACCACTCCTTTTTTGG + Intronic
932211455 2:69934821-69934843 TTATTTAACCAGTTCCCTCCTGG + Intronic
932890159 2:75587847-75587869 TAAATTAAAATGTTCTCTTTAGG - Intergenic
932915914 2:75857673-75857695 TTACATAACAAGTTCTCCTGTGG + Intergenic
933017763 2:77151421-77151443 TTATCTAACAAATCCACTTTTGG + Intronic
933513725 2:83274570-83274592 TTATTAAACAAATACTTTTTTGG - Intergenic
934245973 2:90306456-90306478 TTATTTAACCAGTCTCCTTTAGG + Intergenic
934262773 2:91490579-91490601 TTATTTAACCAGTCTCCTTTAGG - Intergenic
935606453 2:104976225-104976247 TTATTTTATCAGCTCTCTTTAGG + Intergenic
935950885 2:108327299-108327321 TTATTTAAAAAGTTTCCATTTGG - Intergenic
936388168 2:112049045-112049067 TTATATAACAAGTGTTCTGTAGG + Intergenic
937940598 2:127282658-127282680 TTATTTAACATTTGCTCTCTGGG + Intronic
938234082 2:129687322-129687344 TAATTTCACAAATTCTATTTAGG + Intergenic
938269031 2:129952546-129952568 TTATTTCAAAAGTTATCTTTTGG - Intergenic
938334881 2:130483944-130483966 TTATTTAACAAGTATTTATTAGG + Intronic
938354941 2:130636725-130636747 TTATTTAACAAGTATTTATTAGG - Intronic
938419872 2:131136467-131136489 GTATTTAACAAAATCACTTTGGG - Intronic
938456027 2:131465120-131465142 TTATTTAAAAAGTGCACTCTGGG + Intronic
938509293 2:131924001-131924023 ATATTTAACATGTTTTCTTCAGG - Intergenic
939315786 2:140547859-140547881 TTATTTAAAAAATTATATTTAGG - Intronic
939681117 2:145134425-145134447 TTATTGAAAATGTTCACTTTAGG + Intergenic
939719572 2:145631924-145631946 TTGTTTAAAAAGTGCTATTTAGG - Intergenic
940038509 2:149334237-149334259 TTTTTTAACAAATTCACTTTTGG - Intronic
940605251 2:155915640-155915662 TTCTTTAACAAATGTTCTTTTGG - Intergenic
941059484 2:160829177-160829199 TGATATAACAATTTCTCTTAAGG + Intergenic
941751301 2:169137634-169137656 TTTTTTTGCAAGTTCTCTTTTGG - Intronic
941782364 2:169459022-169459044 TTATGTAAAAAGCACTCTTTGGG + Intergenic
941987185 2:171521363-171521385 GCATGTAACATGTTCTCTTTGGG + Intergenic
941999656 2:171633273-171633295 ACATTTACCAAGCTCTCTTTGGG + Intergenic
943431385 2:187806651-187806673 GTAATTAACAATTTCACTTTAGG - Intergenic
943990549 2:194685165-194685187 TAATTTAACAAACTCACTTTTGG - Intergenic
944852296 2:203732414-203732436 TTTTTTAAAAAGATTTCTTTAGG - Intronic
945270716 2:207936820-207936842 TTATCTAACCAGTTCTTTTTTGG - Intronic
945676748 2:212864087-212864109 TTTTTTAAAAAATTCTTTTTTGG - Intergenic
945795385 2:214356255-214356277 TTATTTAACATGTTTACTTCAGG - Intronic
946250694 2:218409893-218409915 GTATTTAACCAGTTCTTTATTGG - Intergenic
946377209 2:219318910-219318932 TAATTTAAAAATTTCTCTTGGGG + Intergenic
946453024 2:219797527-219797549 TGATTTAACATGTCCTCTGTTGG + Intergenic
946454169 2:219809495-219809517 TTTTTTTACAAGTCCTCTTTAGG + Intergenic
946498671 2:220222235-220222257 TTCTTAAACAAGTTCCCGTTAGG - Intergenic
946505133 2:220291511-220291533 TTATCTAATCAGTTCCCTTTTGG + Intergenic
946768332 2:223061048-223061070 TTATTTTACATTTTCTCTTTGGG + Intronic
948827729 2:240581232-240581254 TTATTTCAAAAGTCGTCTTTAGG - Exonic
1168763583 20:366621-366643 CTATTTAACAATTTATCTTGGGG - Intronic
1168867197 20:1097356-1097378 CTATTTGACAAGTCCTTTTTTGG + Intergenic
1169005117 20:2200413-2200435 TTATTTACCCAGTTCCCTATTGG + Intergenic
1169282948 20:4282477-4282499 TTAATTAACCAGTTCTCTACAGG + Intergenic
1169694031 20:8367061-8367083 TATTTTAATAATTTCTCTTTAGG - Intronic
1170255984 20:14343588-14343610 TGCTTTAACAATTTATCTTTGGG + Intronic
1170787993 20:19484088-19484110 TTATTTATCCATTTATCTTTTGG - Intronic
1172499769 20:35417480-35417502 ATATTTAAGAAGTTGACTTTGGG + Intergenic
1172655717 20:36536365-36536387 CTATTTAAAAATTTGTCTTTTGG - Intergenic
1173058331 20:39637487-39637509 TTATTTGACTTGTTTTCTTTCGG + Intergenic
1173139431 20:40469476-40469498 CTATATAACTAGTTCCCTTTAGG + Intergenic
1173367593 20:42401175-42401197 TTATTTAAAAAAGTCTCTATCGG + Intronic
1174765029 20:53245615-53245637 TCATTTAACAAGGTCTCTAGAGG - Intronic
1176784191 21:13234545-13234567 ATATTTAACATGTTTTCTTCAGG + Intergenic
1176910037 21:14553894-14553916 TTATTTAAAAACTTCTCTTTAGG + Intronic
1177033116 21:16007398-16007420 TGAGTTAACAAGTTCTTTATTGG + Intergenic
1177099969 21:16888861-16888883 TTCTTTAAAATGTTGTCTTTAGG + Intergenic
1177242380 21:18475856-18475878 TTCTTTAACAAGATCACTTTTGG + Intronic
1177397326 21:20554058-20554080 TTATTTAACAATTTATTTGTGGG - Intergenic
1177732853 21:25051235-25051257 TTTTTTAAAAAATTTTCTTTTGG - Intergenic
1177982233 21:27928392-27928414 ATATTTAACATGTTTTCTTCAGG + Intergenic
1178574628 21:33774300-33774322 TTAAGTAATAATTTCTCTTTTGG + Intronic
1178846815 21:36180914-36180936 TTATTTAAGAAGAACTCTTAAGG - Intronic
1179082742 21:38188345-38188367 TTATTCAACAAATGCTTTTTAGG - Intronic
1179363063 21:40730852-40730874 TTTTGTAACAATTTCTGTTTTGG - Intronic
1180464727 22:15601052-15601074 TTATTTCAAAAGTTATCTTTTGG + Intergenic
1185215038 22:49593912-49593934 GGATTGAACAAATTCTCTTTTGG - Intronic
949147219 3:716715-716737 TTCTTTCCAAAGTTCTCTTTTGG + Intergenic
949267863 3:2181088-2181110 TGATTTTGCAAGTTCACTTTAGG - Intronic
949388129 3:3528210-3528232 TGAATTAACAACTTCTGTTTGGG - Intergenic
950191976 3:10983210-10983232 TATTTTAACAATTTCTATTTTGG - Intergenic
950629229 3:14271041-14271063 TTATTTAACCAGTTCCCTGTTGG + Intergenic
951142089 3:19174499-19174521 TTATTTAAAAAGTTCTAATTTGG + Intronic
951706683 3:25550956-25550978 ATATGTACCAAGTTTTCTTTAGG + Intronic
951747908 3:25999547-25999569 TTTTTTAAGAAGTTGTCTTTTGG - Intergenic
951789296 3:26462004-26462026 TTTTTTAAAAAATTCCCTTTGGG + Intergenic
952065403 3:29563660-29563682 TTTTTTAAAAAGTTATTTTTTGG - Intronic
952763610 3:36936554-36936576 TTTTTAAAAAAGTTCTTTTTTGG - Intronic
953290698 3:41658556-41658578 TGATTTAACAAGTCCCCTTTAGG - Intronic
953301618 3:41782707-41782729 TTTCTTAAAAAGTTCTTTTTTGG - Intronic
954252145 3:49376288-49376310 TTATTCTAAAAGTTTTCTTTAGG - Intronic
954515114 3:51167398-51167420 TTATTTCACAAGATTGCTTTGGG + Intronic
956005134 3:64770630-64770652 TTATTCAACAAGTATTCCTTGGG - Intergenic
957654515 3:83057864-83057886 TTATGTAACAAAATCTTTTTTGG - Intergenic
957659726 3:83132573-83132595 TTTCTTACCAAGTTTTCTTTTGG + Intergenic
959123358 3:102259715-102259737 TTATTTAACCAGTTCTGTATTGG + Intronic
959234543 3:103702518-103702540 TTGTATAACATGATCTCTTTTGG - Intergenic
959641999 3:108650213-108650235 TTATTTCTCAAATTCCCTTTTGG - Intronic
960020281 3:112943397-112943419 ATATTTTAAAATTTCTCTTTAGG - Intronic
960517761 3:118620959-118620981 TTTTTTAAAAAGGTCTCTTTGGG + Intergenic
960520595 3:118650360-118650382 ATATTTAACAAGTAGTTTTTAGG + Intergenic
961431366 3:126886233-126886255 CTGATTCACAAGTTCTCTTTTGG + Intronic
961848066 3:129785497-129785519 TCAATTAACACATTCTCTTTGGG - Intronic
962223063 3:133580400-133580422 TTATTTAAAAAAATTTCTTTTGG + Intronic
962905958 3:139802854-139802876 ATATTTAAAAAGATCACTTTGGG + Intergenic
963261291 3:143193684-143193706 TTATTTAAAATGTCTTCTTTGGG + Intergenic
963657795 3:148080640-148080662 ATATAAAACAATTTCTCTTTGGG - Intergenic
963955563 3:151249779-151249801 TTCTTTAACAAGTTCTTCCTGGG + Intronic
964162135 3:153658292-153658314 ATGTTTAACTAGTTCTCTTGGGG + Intergenic
964682411 3:159356921-159356943 TCATTTGCCATGTTCTCTTTGGG - Intronic
965080251 3:164023991-164024013 GTATTTAGCATGATCTCTTTGGG + Intergenic
965425145 3:168513778-168513800 TTATATAATAATTTCACTTTAGG - Intergenic
966139601 3:176740869-176740891 TTATTTAACATGATGTTTTTGGG - Intergenic
966504529 3:180684732-180684754 CTCTTTAAAGAGTTCTCTTTTGG + Intronic
966826618 3:183970341-183970363 TTATTTAAAAAGTAGTATTTGGG - Intronic
967058968 3:185854589-185854611 TTATTTAGCATGTTTGCTTTGGG - Intergenic
967457672 3:189707493-189707515 TTGTTTTACAAATTTTCTTTTGG + Intronic
967791464 3:193553523-193553545 TTCTTTAAAGAGTTTTCTTTAGG - Intronic
967862552 3:194163014-194163036 TTATGTAACTGGTTCACTTTAGG + Intergenic
969152600 4:5182758-5182780 TTATTTAAGAAGTACATTTTGGG - Intronic
969940678 4:10727923-10727945 TTTTTTAACAAGCTCTCTAGGGG + Intergenic
970646499 4:18127628-18127650 TCATTTAAAAACTTCTCTTTAGG + Intergenic
970760099 4:19475433-19475455 TTACTTAACTATTTCTCTTATGG + Intergenic
970904295 4:21197957-21197979 TTATTTAACAACTTCATTTGAGG + Intronic
971009041 4:22410411-22410433 TTATTTACTAAGGTCTCATTGGG - Intronic
971926267 4:33013029-33013051 TTATTTAAAAATTTCAGTTTGGG + Intergenic
972151040 4:36091368-36091390 TTATTTAATAAGATCTTTTAGGG + Intronic
972200752 4:36712145-36712167 TTATTTCACAACTTGGCTTTTGG + Intergenic
972364201 4:38358603-38358625 TTATTTATCCATTTCTCTTCTGG - Intergenic
972432066 4:38992603-38992625 TGATTTAACATGTTCTCTCTTGG - Intronic
972715958 4:41646256-41646278 TTCTTGAACAATTTCTCTGTAGG - Exonic
973533532 4:51857412-51857434 TTATTTAAAAAGATCACTCTAGG - Intronic
973934148 4:55825778-55825800 TTATTTGAAAATTACTCTTTTGG + Intergenic
974211697 4:58785167-58785189 TTATTTTAAAAATTATCTTTAGG - Intergenic
974220756 4:58968110-58968132 TCATTGAACCAGTTTTCTTTTGG + Intergenic
974461802 4:62198100-62198122 CTATTTCAAAAGTTTTCTTTGGG - Intergenic
974664970 4:64949792-64949814 TTATTCAACATCTTCACTTTAGG + Intergenic
974761079 4:66274994-66275016 TTATTTTATAATTTCTATTTGGG - Intergenic
974866415 4:67586737-67586759 AAATTTAATAAGTTCACTTTTGG + Intronic
975025846 4:69547704-69547726 TTATTTCAAATATTCTCTTTTGG - Intergenic
975777985 4:77809424-77809446 TTAATTAACAGGTTATATTTTGG + Intronic
976873597 4:89826838-89826860 TTACTTAACTACTTCTCTGTTGG + Intronic
976980610 4:91221910-91221932 TTATTTAACAATTTCCCTTTCGG - Intronic
977092745 4:92700015-92700037 TTTTTCAACAAGTTTTCTGTTGG + Intronic
977115986 4:93029404-93029426 TTATTTAAGAAGCTCACATTTGG - Intronic
977375065 4:96192092-96192114 TTATTTCACCAATTCTCTCTTGG + Intergenic
977529311 4:98181417-98181439 TTCTTTAAAAAGTGCTTTTTAGG - Intergenic
977825456 4:101526024-101526046 TTATTTGCAAAGTTCTCTGTTGG - Intronic
978414151 4:108457987-108458009 TTATTTAACTAGTCCGCTATTGG - Intergenic
978708649 4:111749040-111749062 TTAATTAACAATTGCTCTTTAGG - Intergenic
979253172 4:118586335-118586357 TTATTTCACAAGTTCAGTGTCGG - Intergenic
979590009 4:122467745-122467767 TTTTTTAAAAAAATCTCTTTGGG - Intergenic
980040971 4:127939666-127939688 TCATTTATCAGGTTGTCTTTTGG + Intronic
980048757 4:128017566-128017588 TTATTTTAAAAATTCACTTTAGG + Intronic
980162287 4:129180216-129180238 TTATTCAATAAATTCTCTTGAGG - Intergenic
980423010 4:132588345-132588367 TTACTTAAAAAGTACCCTTTTGG + Intergenic
980862500 4:138516407-138516429 TTATTTAACAAATATTCATTTGG + Intergenic
981346167 4:143679005-143679027 ATACATAACAAGTTCACTTTTGG + Intronic
983040710 4:162922213-162922235 TTATTTTAGAACTTCTGTTTTGG - Intergenic
983458160 4:167991213-167991235 TTATTTTACAACTTTTCTGTGGG - Intergenic
983809735 4:172046266-172046288 TGATTTAACAAGCTCACTTCTGG - Intronic
983908316 4:173207338-173207360 AAATTTAGCAAGTTGTCTTTGGG - Intronic
983919512 4:173331027-173331049 TTGTTTAACAAGTTTATTTTGGG - Intergenic
985156217 4:186989593-186989615 TTATTTAACATTATGTCTTTTGG + Intergenic
985179899 4:187248065-187248087 ATTTTTAACAAGTGCTCTTTAGG + Intergenic
986309180 5:6539098-6539120 TCATTTAACAACTTCTCGCTGGG - Intergenic
986453287 5:7888739-7888761 TTATTTCTCAAGGGCTCTTTAGG - Intronic
986504376 5:8433459-8433481 TTATTAAACAAGGTCACTGTTGG + Intergenic
986848493 5:11782933-11782955 GGACATAACAAGTTCTCTTTTGG + Intronic
987401415 5:17481160-17481182 TTATTTTATAATTTCTGTTTAGG - Intergenic
987810834 5:22833658-22833680 TTATTTGAAAAGCTCTCTGTCGG + Intronic
987824648 5:23014121-23014143 TTCTTTCACAGATTCTCTTTTGG - Intergenic
988069194 5:26265567-26265589 TCATTTAAAAAGTTCTTTTTTGG + Intergenic
989267849 5:39498237-39498259 CTATTTAACAATTTCACTTGAGG + Intergenic
990004216 5:50926105-50926127 TTTTTTTAAAATTTCTCTTTTGG - Intergenic
990453304 5:55958261-55958283 GTATTTAACAATTTATGTTTTGG - Intronic
990566419 5:57033966-57033988 TTATTTAACTACTTCTCTATTGG - Intergenic
991299244 5:65112967-65112989 GAGTTTACCAAGTTCTCTTTGGG + Intergenic
993139983 5:84019708-84019730 TTATTTAACATATTGTCCTTGGG + Intronic
993344520 5:86765930-86765952 TTATTTGCCAAGTCCTCTCTGGG + Intergenic
993928835 5:93910623-93910645 GTATTTATCATGTTCTATTTCGG - Intronic
995296258 5:110526810-110526832 TTATTTAACCAATTTTCTATTGG - Intronic
996729970 5:126707499-126707521 CTATTTAAAAAGTTATGTTTGGG + Intergenic
997693654 5:135844780-135844802 GTATTTATAAATTTCTCTTTGGG + Intronic
998047814 5:139003531-139003553 TTATTTAAAAATTAGTCTTTGGG - Intronic
998314527 5:141169707-141169729 CTATTTAAAGAGCTCTCTTTTGG - Intergenic
998842955 5:146275565-146275587 TTTTTTAAAAAGTTCTTTCTGGG - Intronic
998843275 5:146279146-146279168 TTTTTTAAAAAGTACTTTTTAGG + Intronic
998992771 5:147836880-147836902 ATATCTAACAAGTTCTTTTCAGG + Intergenic
999534057 5:152497988-152498010 TTATTGAAAAAGTGGTCTTTTGG + Intergenic
999592867 5:153167972-153167994 TGATTTAACAAGGCCTCTTCAGG - Intergenic
999652103 5:153777750-153777772 TTTTTTAGCATGTTCTCTGTGGG - Intronic
999726701 5:154444537-154444559 TTACTTAACCACTTCCCTTTTGG + Intergenic
1000022641 5:157331817-157331839 TTATTTTTCAACTTCTCTTTTGG - Intronic
1000547055 5:162616465-162616487 ATATTTAAAATGTTCTTTTTGGG + Intergenic
1000662680 5:163955458-163955480 TTAATTAACAAATTATCTGTAGG + Intergenic
1000756985 5:165173735-165173757 TTATTTAAGAAAGTCTCTGTCGG - Intergenic
1000907499 5:166980048-166980070 TTTTTAAAGAAATTCTCTTTTGG - Intergenic
1000927797 5:167214999-167215021 TTATTTATATAGTTCTCTCTAGG + Intergenic
1001777051 5:174336963-174336985 TTATCTAACCAGTTCTTTTCAGG + Intergenic
1002989650 6:2226805-2226827 TTAACTAACAAGATCTCTTGAGG + Intronic
1003216865 6:4121942-4121964 TTTTTGAATAAGTTTTCTTTTGG - Exonic
1003311707 6:4974612-4974634 TTTTCTAACAAGTGCACTTTCGG - Intergenic
1003757165 6:9135003-9135025 TTTTTTAAAAAGTTCTGTCTTGG + Intergenic
1004620266 6:17325275-17325297 GTATTTAGCACGATCTCTTTGGG + Intergenic
1005139514 6:22611876-22611898 TTATTTAAAAAATTATCCTTTGG - Intergenic
1005215347 6:23521034-23521056 TTATTTAATAAGTTTTCAGTTGG - Intergenic
1005720446 6:28596219-28596241 TTATTTAACCAGTTCTCTGTTGG - Intronic
1008168343 6:48168443-48168465 TAATTTAAGAAGTTCTGTATGGG + Intergenic
1009370599 6:62895864-62895886 TTATTTAATAAATGATCTTTAGG - Intergenic
1009468731 6:64005480-64005502 TTATTTGTCAAGTTTTGTTTCGG + Intronic
1009511690 6:64558977-64558999 TTAGTTAACAAGTTATATTGTGG - Intronic
1009644947 6:66388843-66388865 TTAATTAATATGTTCTCTTTGGG + Intergenic
1009981074 6:70726452-70726474 TTATTTTAAAAGTGCTCTTGGGG + Intronic
1010110093 6:72217067-72217089 TTATTTAAAATGTTGTATTTTGG + Intronic
1010247605 6:73676323-73676345 ATATTGAACAAATTCTATTTTGG + Intergenic
1010265602 6:73862487-73862509 TTATTTCACTAGTTGTTTTTGGG + Intergenic
1010519498 6:76816024-76816046 TTCATTAAAAAGTACTCTTTTGG - Intergenic
1010625085 6:78129159-78129181 TTATTTAACAAATTTTATTAAGG + Intergenic
1011095926 6:83662501-83662523 TTTTTTAACAAATTCTCATTGGG + Intronic
1011418490 6:87147896-87147918 TGATCTAACAACTCCTCTTTAGG + Intergenic
1011709632 6:90039165-90039187 TTATATAACCAATTCTCTATTGG + Intronic
1011711781 6:90062255-90062277 TTATTTGCCAAGTTCTCATGAGG + Intronic
1012303998 6:97627333-97627355 GATTTTATCAAGTTCTCTTTTGG - Intergenic
1013615202 6:111836419-111836441 TAATTTAAAAATTTTTCTTTTGG - Intronic
1013924954 6:115461023-115461045 TTATTTACTATCTTCTCTTTAGG - Intergenic
1013986276 6:116198072-116198094 TTATTTACCAGGATCTCTCTTGG - Intronic
1014081382 6:117290447-117290469 TTATTTAATAAGTAGTCTATGGG + Intronic
1014264796 6:119264235-119264257 TATTTTAACAAGCTCTCCTTGGG + Intronic
1014530849 6:122557502-122557524 ATCTTACACAAGTTCTCTTTTGG - Intronic
1014699986 6:124673403-124673425 TCATTCAACAATTTCACTTTTGG - Intronic
1014727708 6:124992357-124992379 TTATTTATCAAGTTTTCATTTGG - Intronic
1015072814 6:129117102-129117124 TAATTTAACATTTTCTTTTTTGG - Intronic
1015637695 6:135294550-135294572 TTATTTTTCTATTTCTCTTTTGG - Intronic
1015840752 6:137474462-137474484 ATATTACAGAAGTTCTCTTTGGG + Intergenic
1015915655 6:138213548-138213570 TTATTTAACATAATATCTTTTGG - Intronic
1016087111 6:139927757-139927779 TCATTTTAAAAGATCTCTTTGGG + Intergenic
1016124418 6:140382786-140382808 TTAGTAAACAATTTTTCTTTAGG + Intergenic
1016716198 6:147233138-147233160 TTGTTTAAAAATGTCTCTTTTGG - Intronic
1020341807 7:7119310-7119332 TTATTTAAAAAGTCCTTTTTAGG - Intergenic
1020404986 7:7822874-7822896 TTTGTTAACAAGTTTTTTTTAGG + Intronic
1020475519 7:8589657-8589679 TTATTCACCAACTTCTCTTCAGG - Intronic
1020713203 7:11635482-11635504 TTATTTAACAAATTATCTTTGGG - Intronic
1020788050 7:12593270-12593292 GTATTTAGCACGATCTCTTTGGG + Intronic
1021198794 7:17703415-17703437 TTATCTATCAAGGTCTATTTTGG - Intergenic
1022752627 7:33246640-33246662 TTCTTTAATAATTTTTCTTTTGG + Intronic
1023196681 7:37647834-37647856 TTATTTAAAATGATGTCTTTTGG - Intergenic
1023258247 7:38332934-38332956 TTATTTACTATGTTCTCCTTTGG + Intergenic
1023258826 7:38338062-38338084 TTATGTAATAAGTTCTCTTTTGG + Intergenic
1023260283 7:38351372-38351394 TTATTTTATAAGTTCTCTTTTGG + Intergenic
1023261261 7:38360522-38360544 TTATTTTATAAGTTCTGTTTTGG + Intergenic
1023261776 7:38365334-38365356 TTATTTCATAAGTTCTCTTTTGG + Intergenic
1023325854 7:39055018-39055040 CTATTTAAAAAGATCACTTTGGG + Intronic
1023660339 7:42464947-42464969 TCATTTTATAAGTTCTCTTTTGG + Intergenic
1026325867 7:69309864-69309886 TTATTTCACCAGTCCTCTCTTGG - Intergenic
1026421071 7:70238008-70238030 CATTTTAATAAGTTCTCTTTGGG - Intronic
1029721398 7:102367100-102367122 TTATGCACCAAGTTCTCCTTGGG - Intronic
1029830499 7:103251581-103251603 TTTTTAAAAAAGTTCTGTTTTGG - Intergenic
1029864785 7:103615742-103615764 TTATTTAACAAACATTCTTTGGG - Intronic
1030000827 7:105059597-105059619 TTATTTAACAATTTCCCCTACGG - Intronic
1030067066 7:105667861-105667883 TTGTTTAGCAATTTCTTTTTCGG + Intronic
1030766601 7:113418214-113418236 TTACATAATAAGTTATCTTTGGG - Intergenic
1031466715 7:122121676-122121698 TTATTTTAAAACTTTTCTTTAGG - Intronic
1031961375 7:127993307-127993329 TTATTTCATAAGTTGTCTTGGGG + Intronic
1033930982 7:146521105-146521127 TTATTTAAGAAGTAATCATTGGG - Intronic
1034069547 7:148170303-148170325 TTATTTAATAAAATGTCTTTTGG + Intronic
1034515477 7:151574193-151574215 TTATTTAACTAGTCCTATTTGGG - Intronic
1034636771 7:152573566-152573588 TTATTTAAAATGTTTCCTTTAGG - Intergenic
1034871565 7:154689558-154689580 TTTTTTAACATATTTTCTTTAGG + Intronic
1036467913 8:9019122-9019144 TCATTTAACAAATGCTTTTTGGG - Intronic
1036540837 8:9708063-9708085 TTATTTAACTGGTTTCCTTTTGG + Intronic
1036724277 8:11205633-11205655 TTATTTAACTAGTTCCCCTTTGG - Intergenic
1036929835 8:12944936-12944958 TTATATAACACATTCTCTGTTGG + Intergenic
1037131213 8:15409914-15409936 ATATTTAACAAGGCATCTTTAGG + Intergenic
1037332803 8:17760853-17760875 TAATTTCTCAAGTTCTCTTTTGG + Intronic
1037453659 8:19041946-19041968 TTTTTTAAAAAATTCTATTTTGG + Intronic
1037849758 8:22317547-22317569 TTATTTAACCAATCCTCTCTTGG + Intronic
1038169846 8:25120591-25120613 TTCTTTAAAAAGTACACTTTTGG - Intergenic
1038381753 8:27101876-27101898 TTATTTTAAAAGTAGTCTTTTGG + Intergenic
1039017393 8:33166909-33166931 TTATTTAGCCAGTTCTCTATTGG - Intergenic
1039128982 8:34239570-34239592 TTATTTATGAAGTTTTCTTAAGG - Intergenic
1040099699 8:43487656-43487678 TTATTTAAAAATTTCATTTTAGG + Intergenic
1040499904 8:47996997-47997019 GTATTTAGCACGATCTCTTTGGG + Intergenic
1040514024 8:48120014-48120036 TTTTTTAAAAAGTTCTTTTTTGG + Intergenic
1040710430 8:50181798-50181820 TTCTTTAAAAAGTTCAATTTGGG + Intronic
1041422755 8:57687331-57687353 TCTTTTCACAAGTTCTCATTTGG + Intergenic
1041594133 8:59626506-59626528 TAATTTAAAAAGTTATATTTGGG + Intergenic
1041744644 8:61194575-61194597 TTATTTATCTATTTCCCTTTGGG - Intronic
1042037419 8:64550659-64550681 TTATTCAACCAGTCCTCTCTTGG + Intergenic
1043268769 8:78301928-78301950 TTATGAAACAACTTCTCTTCTGG - Intergenic
1043306106 8:78798414-78798436 TTATTTTGCAATTACTCTTTAGG + Intronic
1043991396 8:86760060-86760082 GAATTTAACAATTTCACTTTAGG + Intergenic
1044421746 8:92004443-92004465 TTATTCAACAATTACTCTGTAGG + Intronic
1045092836 8:98764668-98764690 CTATTTAATAATTTCTGTTTGGG - Intronic
1045776841 8:105814590-105814612 TCATTTAGCAAGTTATCTCTGGG + Intergenic
1046296806 8:112230486-112230508 TTTTTTAAAAAGTTCATTTTTGG + Intronic
1046580778 8:116089811-116089833 TTTTTTAAGAAGTTCACTTCTGG + Intergenic
1047396627 8:124505939-124505961 TTATTTGGCAATTTCTTTTTTGG + Intronic
1048737003 8:137513124-137513146 GTATTTACCAGGTTCTATTTTGG + Intergenic
1050427534 9:5526896-5526918 TTATTTAACCACTTCCCTGTTGG + Intronic
1050436176 9:5613003-5613025 TTCTTTCAGAAGTTCTCTCTTGG + Intergenic
1050568000 9:6906748-6906770 GTTTTTAAAAATTTCTCTTTGGG + Intronic
1050689631 9:8210832-8210854 TTATCTAAAAAGTGATCTTTGGG - Intergenic
1050881508 9:10705730-10705752 CTCTTTAACAATTTTTCTTTTGG + Intergenic
1051130807 9:13858230-13858252 TTAGTAAACAAATTTTCTTTGGG + Intergenic
1051187760 9:14478486-14478508 TTTTTATACAAGATCTCTTTAGG - Intergenic
1051537252 9:18173844-18173866 TTATTGACAAAGTTCTCTTTCGG - Intergenic
1052000755 9:23277407-23277429 TTATTTAACAGATACTCTTCTGG + Intergenic
1052051711 9:23856066-23856088 TAATTTAAAATGTCCTCTTTAGG + Intergenic
1052394162 9:27917483-27917505 TTATCTTGCAAGTTTTCTTTTGG + Intergenic
1052455779 9:28695981-28696003 TTTTTTATCAAGTTGTTTTTAGG - Intergenic
1052639795 9:31152745-31152767 TTATTTTGTATGTTCTCTTTTGG - Intergenic
1052680810 9:31689960-31689982 TTAGTTAACAATTTCTCATTAGG + Intergenic
1052876306 9:33568899-33568921 TTATATGACCATTTCTCTTTTGG + Intronic
1053152185 9:35750092-35750114 TTATTTAATGGTTTCTCTTTGGG + Intronic
1053499708 9:38575448-38575470 TTATATGACCATTTCTCTTTTGG - Intronic
1054164472 9:61708812-61708834 TTATTTAACATATTCAATTTTGG + Intergenic
1055004480 9:71489743-71489765 TTATTTTAAAATTTCTCTTTTGG - Intergenic
1056038898 9:82639229-82639251 TATTTTAACAAGTTCTCTTCTGG - Intergenic
1056257077 9:84810813-84810835 TAATTTAACATGTTTTCTTGAGG - Intronic
1056311944 9:85349554-85349576 TCATGTAACAAGGTCTCTTAGGG + Intergenic
1056349554 9:85735743-85735765 TATTTTAACAAGAACTCTTTAGG - Intronic
1056398518 9:86203973-86203995 TTATTTAACATGTATTCCTTGGG - Intergenic
1056635980 9:88331579-88331601 TTATTCAATAACTTCTCTTCTGG - Intergenic
1056902835 9:90616390-90616412 ATATTTATGAAGTTATCTTTTGG - Intronic
1058220999 9:102302218-102302240 TATTTTAACAAGTTATCTTCTGG - Intergenic
1058656551 9:107227320-107227342 CTGTTTAAGAAGTACTCTTTTGG - Intergenic
1058815132 9:108675980-108676002 TGACTTGAGAAGTTCTCTTTTGG - Intergenic
1060130317 9:121090973-121090995 TTCCTTCACAAGCTCTCTTTAGG - Intronic
1060381127 9:123173708-123173730 GTATTTAACAGGGTCTCTGTGGG + Exonic
1060686664 9:125620614-125620636 TTATGTAACTAATTCTCTGTCGG - Intronic
1062203133 9:135318986-135319008 TTCTTTTCCAAGTTCTTTTTTGG - Intergenic
1203548355 Un_KI270743v1:147063-147085 TTATATGACCATTTCTCTTTAGG - Intergenic
1186484305 X:9922222-9922244 TTTTTTAAAAACTTTTCTTTCGG + Intronic
1186546358 X:10453982-10454004 TTATTTAACAAGCCCTCATATGG - Intronic
1186597938 X:11004872-11004894 TTTTTTAAGAAGTTCCCTTATGG - Intergenic
1187117507 X:16367551-16367573 TTATTTGACAAGTATTCATTGGG - Intergenic
1187165985 X:16804308-16804330 TTATTTAACCAGTTCCCTATTGG + Intronic
1188002217 X:24993742-24993764 TTATTGATTAAATTCTCTTTGGG + Intronic
1188023889 X:25188109-25188131 TCATTTTACATGTTCTCCTTGGG + Intergenic
1188302069 X:28516660-28516682 TTATTTAACAAATTCTCTACTGG + Intergenic
1188809659 X:34637587-34637609 TTTTTAAGCAATTTCTCTTTTGG - Intronic
1189024592 X:37379495-37379517 TTATTTAATCAGTCCTCTATTGG - Intronic
1189845864 X:45137543-45137565 GTCTTTAACAAGTATTCTTTTGG - Intergenic
1190341818 X:49303304-49303326 ACATTTAACAATTTCTTTTTGGG + Intergenic
1190703806 X:53008401-53008423 TTATTTAAAAAGATTTTTTTTGG + Intergenic
1192470415 X:71393841-71393863 TTATTTATCAAGTTGTCTCCAGG + Intronic
1192863180 X:75100827-75100849 TTATTCAACAAATACTCATTAGG - Intronic
1192980026 X:76329513-76329535 TTATTTATCAATTCCTGTTTTGG - Intergenic
1193254808 X:79335227-79335249 TTATTTATCCAATTCTCTGTTGG + Intergenic
1193744827 X:85264525-85264547 TTTTTTAATACGTTTTCTTTGGG + Intronic
1193909399 X:87283076-87283098 TTATATAACAAATGCTCATTTGG - Intergenic
1195239976 X:102941435-102941457 TTATTTGCCAAGTCCTTTTTAGG + Intergenic
1195355268 X:104033560-104033582 TTCTTTAACAAGGTTTCTGTTGG + Intergenic
1196233536 X:113253213-113253235 TGAATCAGCAAGTTCTCTTTTGG + Intergenic
1196291731 X:113949885-113949907 TTATTTAAGGGTTTCTCTTTAGG - Intergenic
1196318201 X:114254838-114254860 TTATTTAACAAGCTCCCTGAGGG - Intergenic
1197193127 X:123670807-123670829 TTATTTAATAGGTACTCTATTGG - Intronic
1197507589 X:127326910-127326932 TTATTGACCAAGTTCACTGTGGG - Intergenic
1197610828 X:128636359-128636381 TTATTTAGCAAATACTCATTGGG + Intergenic
1198593013 X:138205106-138205128 TTGTTGAATAAGTGCTCTTTGGG + Intergenic
1198717241 X:139571205-139571227 TTACTTAACATGTTATCATTTGG + Intergenic
1199083519 X:143604307-143604329 TTTTTTAACCAGTTTTATTTTGG + Intergenic
1199118866 X:144027090-144027112 TTATTTAAAAAATTCTGCTTTGG - Intergenic
1199134888 X:144237249-144237271 TGAATTAACATGTTCTCTCTTGG + Intergenic
1199665974 X:150096776-150096798 TTATTTAGCAAGTACTCTGGGGG - Intergenic
1200277463 X:154748135-154748157 TAATATAACAATTTCTCTATTGG - Intronic
1200819433 Y:7567108-7567130 TTGTTTAATAATTTCACTTTAGG + Intergenic
1200893703 Y:8352066-8352088 GTCTTTAACAAGTTCTCATATGG + Intergenic
1201175294 Y:11305163-11305185 TTATGTCACAAATTCCCTTTAGG + Intergenic
1201427434 Y:13868248-13868270 TTTCTTAACAAATTCCCTTTCGG + Intergenic
1201980673 Y:19906391-19906413 TTATTTGACAGTTTCTTTTTTGG + Intergenic
1202365817 Y:24163432-24163454 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1202504965 Y:25506690-25506712 TTACTTAACCAGTTCCCTGTTGG + Intergenic