ID: 925160239

View in Genome Browser
Species Human (GRCh38)
Location 2:1678307-1678329
Sequence GGTGATGGGGAGCCATGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1175
Summary {0: 1, 1: 1, 2: 20, 3: 142, 4: 1011}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925160239_925160247 20 Left 925160239 2:1678307-1678329 CCCTCCCATGGCTCCCCATCACC 0: 1
1: 1
2: 20
3: 142
4: 1011
Right 925160247 2:1678350-1678372 CGCTGCTTTCTTCATTATTTAGG 0: 1
1: 0
2: 0
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925160239 Original CRISPR GGTGATGGGGAGCCATGGGA GGG (reversed) Intronic
900131273 1:1088290-1088312 GGTCCTGGGGAGGCGTGGGAGGG - Intronic
900212322 1:1462212-1462234 GGTGTCGGGGAGCCCAGGGAAGG - Intronic
900323625 1:2096777-2096799 GGTCAGGGGCAGCCAAGGGAAGG + Intronic
900394434 1:2447402-2447424 GGGGAGGGGGAGCCCTGAGAAGG - Intronic
900404199 1:2485373-2485395 GGGGACAGGGATCCATGGGAGGG + Intronic
900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG + Intronic
900599134 1:3495669-3495691 GGGGCTGGGGTGGCATGGGACGG + Intronic
900959888 1:5912170-5912192 GGGGCAGGGGAGCAATGGGATGG + Intronic
901083300 1:6595822-6595844 GGTGATGGGGAGGCACTGAATGG - Intronic
901233690 1:7655960-7655982 GGAGGTGGGGCCCCATGGGAGGG + Intronic
902039744 1:13484039-13484061 AGAGATGGGGAGCCACTGGAGGG - Intronic
902064060 1:13669634-13669656 GGTGGTGGGGGGCAAGGGGAGGG - Intergenic
902299852 1:15494041-15494063 GGTGGTGGGGAGCCGGCGGAGGG - Intronic
902659434 1:17890986-17891008 GGTGATGAGGAGAGATGGAAGGG - Intergenic
902925592 1:19693876-19693898 GCTGTTGGGGAGCCCTGGGTGGG + Intronic
902929541 1:19721159-19721181 AGTGAGGGGGAGGCCTGGGAGGG + Intronic
903269349 1:22178004-22178026 GGTGCGGGGGAGCCATGGGCAGG - Intergenic
903372032 1:22842587-22842609 TGTGATGGCAAACCATGGGAGGG - Intronic
904329291 1:29747451-29747473 GGAGATGGGCAGCCCTGGGCAGG - Intergenic
904387656 1:30155236-30155258 GGTGATGGGGGGCTAGGGGAGGG - Intergenic
904850924 1:33459072-33459094 TGTGATGGGAAGCCATTGAAGGG + Intergenic
905229832 1:36508095-36508117 AGCCATGGGGAGCCATTGGAAGG - Intergenic
906128350 1:43441391-43441413 GGTGGTGGTGTGCCCTGGGAGGG + Intronic
906331979 1:44893277-44893299 GGGGATAGGCAGCCATGGCAAGG - Intronic
906739418 1:48167579-48167601 GGTGGTGGGGGGACAGGGGAGGG - Intergenic
906778967 1:48555608-48555630 GATAATGGGAAGCCAGGGGAGGG + Intronic
906818372 1:48902843-48902865 GGCAATGGGGAGTTATGGGAAGG - Intronic
907034193 1:51201726-51201748 AGAGATGGGTAGCCATTGGAAGG - Intergenic
907053208 1:51343744-51343766 GGTGGTGGAGAGCCATGGAAGGG + Intronic
907107271 1:51895110-51895132 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
907426121 1:54380284-54380306 GGTGAGGAGGAACCATGGGGAGG - Intronic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
907711620 1:56887982-56888004 GGGGATGGGGGGCTAGGGGAGGG + Intronic
907729209 1:57049691-57049713 GGTTAAGGGGAGGCATGTGAGGG - Intronic
907822016 1:57979413-57979435 GGGGATGGGGGGCTAGGGGAGGG + Intronic
907908295 1:58805040-58805062 GGTGATGAGAAGCCACCGGAGGG - Intergenic
908104214 1:60824861-60824883 GGGGATTGGGAGGCAGGGGAAGG - Intergenic
908123021 1:61003743-61003765 GGTGAAGGGAAGCCACGGAAGGG - Intronic
908621583 1:65987129-65987151 GGTGATGAGGTGTCATTGGAGGG + Intronic
908633439 1:66136123-66136145 GGTGAGTGGGAGGGATGGGAAGG - Intronic
908856213 1:68432702-68432724 AGTGATGGGAAGCCATTGGAGGG + Intronic
908958634 1:69668286-69668308 GGGGATGGGGGGCTAGGGGAGGG - Intronic
909179643 1:72405363-72405385 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
909238291 1:73180733-73180755 GTGCATGGGCAGCCATGGGAGGG + Intergenic
909282314 1:73770878-73770900 GTTCATGGGCAGCCATGGGTGGG - Intergenic
909297406 1:73968265-73968287 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
910293915 1:85625982-85626004 GGGGGTGGGGAGTCAGGGGAGGG - Intergenic
910322050 1:85957190-85957212 GGGGATGGGGTGCAAGGGGAGGG + Intronic
910827259 1:91422522-91422544 TAGGGTGGGGAGCCATGGGAGGG - Intergenic
911488817 1:98536801-98536823 GGGGATGGGGGGCTAGGGGAGGG - Intergenic
911974708 1:104477389-104477411 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
912409016 1:109467006-109467028 GGCGGTGGGGAACCCTGGGAAGG - Intronic
912700867 1:111877416-111877438 GGGGATGGGGAGGCAAGGGCAGG + Intronic
912954481 1:114144938-114144960 GGTGTTGGGAAGGCTTGGGAAGG - Intronic
913131631 1:115842827-115842849 GGTGTTGGGGAGTCATGACAGGG + Exonic
913499120 1:119454384-119454406 TGGAATGGGAAGCCATGGGAAGG - Intergenic
915059642 1:153170788-153170810 GGTGGTGGGCAGCCGTGGGGAGG - Intergenic
915227043 1:154419001-154419023 GGTGGTGGGGAGCCCAGAGAAGG + Intronic
915301348 1:154953319-154953341 GGTGATGTGGAGACGTGGGTTGG - Intronic
916830639 1:168487215-168487237 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
916858928 1:168781617-168781639 AGTGATGTGGAGTCATAGGATGG - Intergenic
917248924 1:173035851-173035873 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
918077290 1:181180324-181180346 GGTGAGGAGGAGCCTGGGGAAGG + Intergenic
918678617 1:187322709-187322731 GGGGTTGGGGAGCAAGGGGAAGG + Intergenic
918892371 1:190292141-190292163 GGGGATATGGAGCCATGGGAGGG + Intronic
919326321 1:196111260-196111282 GGGGGTGGGGGGCTATGGGAGGG + Intergenic
919595202 1:199552885-199552907 TATGATGGGGAGCCATTGGCTGG - Intergenic
919703342 1:200653575-200653597 TGTGATGGGAAACCATTGGAGGG - Intronic
919820830 1:201470862-201470884 GGTGGGGAGGAGCCATGGGAGGG - Intergenic
919847857 1:201652678-201652700 GGTAAGGATGAGCCATGGGAGGG - Intronic
919989115 1:202696910-202696932 GGTGATGGGGAGGAAAGGTATGG - Intronic
920455538 1:206098313-206098335 GGGGAGGGGGAGCGGTGGGAAGG - Intronic
920892395 1:210001936-210001958 GGAAATGAGGAGCCATTGGAAGG + Intronic
921159348 1:212462389-212462411 GGTGCAGGGGAGCCATGGAGTGG + Intergenic
921551879 1:216546946-216546968 GGGGATGGGGGGCTAGGGGAGGG - Intronic
922116019 1:222615675-222615697 GGAAATGGGAAGCCATGGGAAGG + Intergenic
922237509 1:223733207-223733229 AGAGTTGGGGAGCCAGGGGAGGG - Intronic
922716619 1:227878136-227878158 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
922789856 1:228305627-228305649 GGTGATGGGAGGCAGTGGGAGGG - Intronic
922793648 1:228325160-228325182 CTGGATGGGCAGCCATGGGATGG + Intronic
922831253 1:228555648-228555670 GGAGCTCGGGAGCCACGGGAAGG + Intergenic
923422294 1:233828230-233828252 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
923696146 1:236254443-236254465 GGTGATGGGAAGCCACAGGAAGG - Intronic
923744216 1:236686160-236686182 GGTGATCGCGAGCCAGGGGAGGG - Intergenic
924255349 1:242177415-242177437 GGTGGTAGGGGGCTATGGGAGGG + Intronic
924265017 1:242273067-242273089 GGGGATGGGGGGCAAGGGGAGGG - Intronic
924613596 1:245593312-245593334 GGGGCTGGGGAGCTAGGGGAGGG - Intronic
924885839 1:248215514-248215536 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
1062931437 10:1355092-1355114 GGAGGTGGGCAGCCAGGGGAGGG - Intronic
1062987566 10:1783471-1783493 GGGGATGGGGAGCTAGGGGAGGG - Intergenic
1063363994 10:5478844-5478866 GGTGTTGAGGAGCCAGGGCAGGG + Intergenic
1063414213 10:5860051-5860073 GGTGATGGGTATGCCTGGGAAGG + Intergenic
1063441205 10:6074800-6074822 GTTGATGGGAAACTATGGGAAGG + Intergenic
1063801768 10:9588015-9588037 GGGGTTGGGGGGCCAGGGGAGGG - Intergenic
1065365915 10:24936804-24936826 GGTCCTGGGGACCTATGGGAGGG - Intronic
1065503343 10:26403297-26403319 GGTGGTGGGGGGCAAGGGGAGGG + Intergenic
1065626977 10:27639644-27639666 TGAGATGGGAAGCCATTGGAAGG + Intergenic
1065735389 10:28746749-28746771 GGTGATGGGGGGTAAGGGGAGGG - Intergenic
1066348251 10:34610890-34610912 GGTGATGGGGAGAGGTGGGGGGG + Intronic
1066719792 10:38325423-38325445 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1067382088 10:45783930-45783952 AGTGATGGACAGCCATAGGAAGG + Intronic
1067889784 10:50124572-50124594 AGTGATGGACAGCCATAGGAAGG + Intronic
1068002381 10:51350906-51350928 GGGGATGGGGGGCTAGGGGAGGG - Intronic
1068105349 10:52607954-52607976 GGGGTTGGGGAGCTAGGGGACGG + Intergenic
1068685900 10:59869745-59869767 TGTGATGGGAAGCCTTTGGAGGG - Intronic
1069030294 10:63589077-63589099 AATGATTGGGAACCATGGGAGGG + Intronic
1069247890 10:66230729-66230751 GGTGATGGAAAGCCCTGGGCAGG + Intronic
1069615758 10:69805184-69805206 AGTAATGGGGAGCCATTGAAGGG + Intronic
1069650556 10:70044119-70044141 GGGGATGGGGGGCGAGGGGAGGG - Intergenic
1069835936 10:71308235-71308257 GGCAATGGGAAGCTATGGGAAGG + Intergenic
1069884729 10:71616390-71616412 GGTGTGGGTTAGCCATGGGAGGG + Intronic
1070411934 10:76149918-76149940 GATGAGGGGAAGCCCTGGGAGGG + Intronic
1070623121 10:78029260-78029282 AGAGATGGGGTGCAATGGGAAGG - Intronic
1070972514 10:80579139-80579161 GGTGATGGAGAGAGATGGGCTGG + Intronic
1071053573 10:81480958-81480980 AGTAATGGGGAGCCATTGAAAGG + Intergenic
1071487613 10:86113201-86113223 TGTGATGGGAAGTCATTGGAGGG - Intronic
1072396972 10:95053765-95053787 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
1072407330 10:95167789-95167811 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
1072872856 10:99138742-99138764 GGCGATGGGGGGCTAGGGGAGGG + Intronic
1072980848 10:100095814-100095836 AGTAATGGGAAGCCATTGGATGG + Intergenic
1073272770 10:102280221-102280243 GGGGATGGGGAGGCAAGGGTAGG + Intronic
1073933734 10:108605486-108605508 GGGGGTGGGGGGCCAGGGGAGGG - Intergenic
1074325594 10:112447494-112447516 GGTGCTGGGGAGAGCTGGGAGGG + Intronic
1074485544 10:113874350-113874372 GGTGGTGGGGAGGAGTGGGAAGG - Intronic
1074676800 10:115860353-115860375 TGTGATGGTGAGCAAAGGGAAGG - Intronic
1074890231 10:117729815-117729837 GGGGTTGGGGAGCAAGGGGAGGG - Intergenic
1075084508 10:119405546-119405568 GGGGGTGGGGAGCCAGAGGAGGG - Intronic
1075205390 10:120443489-120443511 GGGGTTGGGGAGCAAGGGGAGGG + Intergenic
1075573598 10:123562687-123562709 GGGGATGGGGAGCCTGGTGAAGG - Intergenic
1075939675 10:126379544-126379566 GGGGATGGGGAGCTAGGGGAGGG + Intronic
1076441451 10:130483838-130483860 GGTGATGGGGAGTAATGGGCTGG + Intergenic
1077026032 11:440368-440390 GGCAGTGGGGAGCCATGGAAGGG + Intronic
1077102540 11:828556-828578 GGTGCTGTGAAGCCAAGGGAGGG - Exonic
1077192297 11:1260514-1260536 GGTCCTGGAGGGCCATGGGAGGG + Intronic
1077368104 11:2169377-2169399 GGTGAGGGGGATCCAGGGGATGG + Intronic
1077382432 11:2250391-2250413 GCAGATGGGGACCCAAGGGAGGG - Intergenic
1077405210 11:2379513-2379535 GCTGAAGGGGAGTCACGGGAGGG + Intronic
1078124266 11:8544151-8544173 GGGGATGGGGGGCTATGGGAGGG - Intronic
1078262455 11:9723075-9723097 GGTGATAGGGAGCCAGGGCAGGG + Intronic
1078318319 11:10309845-10309867 GGTGAAGGGGAGTGATGGGGAGG + Intronic
1078349372 11:10580207-10580229 GGTCAGGGGCAGTCATGGGAAGG - Intronic
1078372239 11:10758186-10758208 AGAGATGGGAAGCCATTGGAGGG + Intronic
1078399290 11:11010092-11010114 GGTGATGGGGAATCCAGGGATGG + Intergenic
1079110603 11:17603055-17603077 GGCAATGGGGAGCCATGGAAGGG + Intronic
1079267617 11:18949322-18949344 GGTGGTGGGGATCAAGGGGAGGG + Intergenic
1079283175 11:19106227-19106249 GGAGATGGGGAGGCCTGGGCTGG - Intergenic
1079472905 11:20797142-20797164 GGGCATTGGGAGCCATGGAAAGG + Intronic
1079613476 11:22462090-22462112 GATGATGAGGAGAAATGGGAAGG - Intergenic
1080220769 11:29900989-29901011 GGAGTTGGGGAGCTAGGGGAGGG - Intergenic
1080303029 11:30805916-30805938 GGGGATGGGGGGCAAAGGGAGGG - Intergenic
1080874756 11:36265501-36265523 GGGGATGGGGGGACATGGCAAGG - Intergenic
1081219996 11:40448391-40448413 GGGGGTGGGGAGCTAGGGGAGGG - Intronic
1081387142 11:42485221-42485243 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
1081431563 11:42982283-42982305 AGGGGTGGGGAGCAATGGGAAGG + Intergenic
1082269560 11:50155258-50155280 GGGGATGGGGAGGAAGGGGAAGG - Intergenic
1082304904 11:50560460-50560482 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1082629406 11:55524086-55524108 GGGGGTGAGGAGCAATGGGAGGG - Intergenic
1082687358 11:56257375-56257397 GGGGATGGGGTGCCAGGGGAGGG + Intergenic
1083206461 11:61152555-61152577 AATGCTGGGGAGCCATGGGAGGG - Intronic
1083755748 11:64790681-64790703 AGTCACGGGGAGCCACGGGAGGG + Intronic
1083944261 11:65915409-65915431 GGCTGTGGGGAGCCATGGAAGGG + Intergenic
1084372135 11:68751233-68751255 GGTGAGGAGCAGCCAGGGGAGGG + Intronic
1084437870 11:69154795-69154817 TGTGATGGGGAGACACAGGAGGG + Intergenic
1084582941 11:70035678-70035700 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1084730705 11:71071742-71071764 GCTGGTGAGGAGCCATGGAAGGG + Intronic
1084873573 11:72114284-72114306 GGAGTTGGGGAGCCAGTGGAGGG + Intergenic
1084893201 11:72247105-72247127 GGCAATGGAGAGCCATGGGAGGG - Intergenic
1084991135 11:72926254-72926276 GTCTATGGGCAGCCATGGGAAGG - Intronic
1085198082 11:74684094-74684116 TGTGACGGGGAGCCACGGGAGGG + Intergenic
1085313678 11:75530872-75530894 GGTGGAGGGGAGCCATGGGAGGG + Intergenic
1085358007 11:75857212-75857234 TGAGATGGGAAGCCATGGGAGGG - Intronic
1085385307 11:76154349-76154371 GGAGGTGGGAAGCCCTGGGAGGG + Intergenic
1085449431 11:76623055-76623077 GGTGCTGGGAAGCCATGGAAGGG - Intergenic
1085772062 11:79334499-79334521 AGTGCTGGGCAGCCATGGAAAGG - Intronic
1085868160 11:80319328-80319350 GGTAATGGGGAGCCATTGAAAGG - Intergenic
1085909425 11:80803768-80803790 GGGGATGGGGAGCTAGGGGAGGG + Intergenic
1086284261 11:85227695-85227717 TGAGATGGGAAGCCATTGGAGGG - Intronic
1086664622 11:89465130-89465152 GGTGGTGGGGGGCTAGGGGAGGG - Intronic
1087052622 11:93901519-93901541 GGGGATGGGGGGCTAGGGGACGG + Intergenic
1087199787 11:95333831-95333853 GGTGATGGGAAGCCATTGGAAGG + Intergenic
1087706428 11:101497845-101497867 GGGGGTGGGGGGCAATGGGAGGG - Intronic
1087888340 11:103506450-103506472 GGGGTTGGGGGGCCAGGGGAGGG + Intergenic
1088205472 11:107387483-107387505 AATGATGGGGAGCCATTTGAAGG - Intronic
1088436119 11:109814985-109815007 TCTGATGGGAAGCCATTGGAAGG + Intergenic
1088541905 11:110921722-110921744 GGTGCTGGGGGGCCGTGGGGAGG - Intergenic
1088676534 11:112199099-112199121 GGGGGTGGGGAGCTAGGGGAGGG - Intronic
1088763037 11:112950075-112950097 GGAAATGGGGAGCCATGACAGGG + Intergenic
1088916106 11:114228931-114228953 GGGGATGGGGCGCCAGGGAAGGG - Intronic
1089051370 11:115548894-115548916 GGAGATGGTGAGCCAGAGGAAGG + Intergenic
1089586463 11:119512737-119512759 GGGGATGGGTAGCCTTGGGCAGG + Intergenic
1090085874 11:123650618-123650640 GGTGTTGGGGAGAGATGGGACGG + Intronic
1091174138 11:133544790-133544812 GGTGCAGGGGAGGCCTGGGAGGG - Intergenic
1091232338 11:133996857-133996879 GGTGACAGCGAGCCATCGGAGGG - Intergenic
1091689214 12:2584324-2584346 GGTGATGGGGAGGAAGGGGAGGG + Intronic
1091804115 12:3343659-3343681 AGTGATGGGGAGCAAGGGGTGGG + Intergenic
1092320333 12:7465925-7465947 GGAGGTGGGGAGTCAGGGGAGGG + Intronic
1092488027 12:8919660-8919682 TGTGAAAGGGGGCCATGGGAAGG - Intronic
1093502852 12:19832286-19832308 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
1094274374 12:28654616-28654638 GGGGATGGGGAGTAAGGGGAGGG - Intergenic
1094310661 12:29077222-29077244 GGTGTTGGGGAGCTAGGGGAGGG + Intergenic
1095562525 12:43583040-43583062 GGGGATGGGGAGTTAGGGGAGGG + Intergenic
1095604370 12:44049416-44049438 GGTGGTGGGGGGCGAGGGGAAGG + Intronic
1095647357 12:44563164-44563186 GGGGATTGGGAGACAGGGGAGGG + Intronic
1095721765 12:45408684-45408706 GGAAATGAGGAGCCATTGGAGGG - Intronic
1095990325 12:48029918-48029940 GGTGATGAGGGGCCAGGGCAAGG + Intergenic
1096080899 12:48831821-48831843 GGTGAGGTGGAGCCAGGGAAAGG - Intronic
1096335959 12:50756843-50756865 TGAGATAGGGAGCCATGGGTGGG + Intergenic
1096529887 12:52235904-52235926 GGTCATTGTGAGCCATGCGAGGG + Intronic
1097421195 12:59382033-59382055 GGGGATGGGGGGCTAGGGGAGGG - Intergenic
1097813607 12:64046290-64046312 TGTGATGGGGAGCCATTGAAGGG + Intronic
1097953336 12:65457361-65457383 GGTGATTGGGGGCTAGGGGAGGG - Intronic
1098438169 12:70490953-70490975 GGGGGTGGGGAGCTAAGGGAGGG - Intergenic
1098439315 12:70501318-70501340 GGGGATGGGGAGCAAGGGAAGGG - Intergenic
1098465634 12:70783592-70783614 GTTCATGGGCAGCCATGGGTGGG + Intronic
1098785600 12:74750008-74750030 TGAAATGGGGAGCCATTGGAAGG - Intergenic
1098906075 12:76163850-76163872 GGGGATGGGGGGCTAGGGGAGGG - Intergenic
1099238403 12:80110394-80110416 GGTGATGGGGAGCAAGGGGAGGG - Intergenic
1099549645 12:84026891-84026913 GGGGGTGGGGAGTAATGGGATGG + Intergenic
1099683413 12:85856905-85856927 GTTCATGGGCAGCCATGGGTGGG + Intergenic
1099822466 12:87730260-87730282 TGAGATGGGAAGCGATGGGATGG - Intergenic
1099882005 12:88478224-88478246 GGGGATGGGGGGCCAGGGGAGGG + Intergenic
1099892815 12:88610407-88610429 GGTGTTGGGGGGCTAGGGGAGGG + Intergenic
1099898088 12:88673445-88673467 GGTGCTGGGGGGCTAGGGGAGGG + Intergenic
1099920386 12:88950119-88950141 GGTGGTGGGGGGCTAGGGGAGGG + Intergenic
1100219495 12:92489155-92489177 GGTGACTGGGAGCCCAGGGAAGG - Intergenic
1100289676 12:93201891-93201913 CATGATGGGAAGCCACGGGAAGG - Intergenic
1100374588 12:94002480-94002502 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1100565209 12:95789386-95789408 GGTGAGGGGGAGAGATGTGAGGG - Intronic
1100647346 12:96545247-96545269 GGGGGTGGGGAGCTAGGGGAAGG + Intronic
1100740639 12:97587717-97587739 GGGGATGGGGAGCAAGGGAAGGG + Intergenic
1100764848 12:97852330-97852352 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1101287133 12:103326433-103326455 TGTAATGGGAAGCCATTGGAAGG - Intronic
1101707363 12:107232989-107233011 CGTGATGGGGAACCACTGGAGGG - Intergenic
1101731043 12:107426885-107426907 GGTGATGGTGACTCAAGGGAAGG - Intronic
1102251070 12:111387974-111387996 GGCCATGGGGAGCCATGGAAAGG - Intergenic
1102345893 12:112161309-112161331 GGTGATGGGGAGTGCTGGGTGGG + Exonic
1102455656 12:113069442-113069464 GGTGGTGGGGAGACAAGGGGAGG - Intronic
1102500844 12:113351278-113351300 AGATATGGGGAGCCATGGGAGGG + Intronic
1103021975 12:117541311-117541333 GCTGATGTGGAGGCATGGGAGGG + Intronic
1103298648 12:119909797-119909819 GAGGATGGTCAGCCATGGGATGG - Intergenic
1103516197 12:121509877-121509899 GGTGAAGTGGAGCCATCGGTGGG + Exonic
1103984922 12:124760739-124760761 GGAGAGAGGGAGCCATGGAAGGG + Intergenic
1104742332 12:131187880-131187902 AGTGAAGGGGAGCCAGGTGAAGG + Intergenic
1104984550 12:132589381-132589403 GGTGAGGGGGAACCCTGGGGAGG - Intergenic
1105034264 12:132907639-132907661 GGGGGTGGGGGGCCAGGGGAGGG - Intronic
1105322671 13:19343901-19343923 GGGGGTGGGGGGCCAGGGGAGGG + Intergenic
1105430328 13:20331248-20331270 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1105492482 13:20902444-20902466 GGTGCTGGGCAGCCAGGGGAAGG + Intronic
1105722901 13:23134622-23134644 GGTGATGGTGGGCCTGGGGAAGG - Intergenic
1106054966 13:26229212-26229234 GGTGCTGGGGTGCTAGGGGAGGG - Intergenic
1106129162 13:26925307-26925329 TGCGATGGGAAGCCTTGGGAGGG + Intergenic
1106190318 13:27446830-27446852 GGTGATGGGGGCGGATGGGAAGG + Intronic
1106204801 13:27582741-27582763 GGGGATGGGGGGCTAGGGGAGGG + Intronic
1106376816 13:29197210-29197232 GGGGATGGGGGGCAAGGGGAGGG - Intronic
1106730798 13:32539539-32539561 GGGGATGGGGAACCAATGGAGGG - Intergenic
1107135318 13:36938223-36938245 AGGGAAGGGGAGCCAAGGGATGG - Intergenic
1107222469 13:38001357-38001379 GGGGATGGGGGGCTAGGGGAGGG - Intergenic
1107430953 13:40339726-40339748 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1107440131 13:40419225-40419247 GGGGGTGGGGAGCTGTGGGAGGG + Intergenic
1107603602 13:42038497-42038519 GGCTATGGGGAGCCATTGGCAGG + Intergenic
1108039795 13:46329484-46329506 GAAGATGGGAAGCCCTGGGAAGG + Intergenic
1108074600 13:46666872-46666894 GGTGAGAGAGAGCCTTGGGAGGG + Intronic
1108305185 13:49124341-49124363 AGGGATGGGGAGCTAGGGGAGGG + Intronic
1108384404 13:49885680-49885702 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1109244546 13:59937796-59937818 GGAGGTGGGGAGGCAGGGGAGGG + Intronic
1109369113 13:61398230-61398252 GGGGATGGGGGGACAAGGGAAGG - Intergenic
1110138268 13:72096296-72096318 GGGGATGGGGGGCTAGGGGAGGG - Intergenic
1110540586 13:76702436-76702458 GGGGCTGGGGAGCTAAGGGAGGG + Intergenic
1110642476 13:77841450-77841472 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
1110878211 13:80537470-80537492 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1111073184 13:83196898-83196920 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1111364537 13:87224696-87224718 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
1111404857 13:87790721-87790743 GGTGGTGGGGGGCAAGGGGAGGG - Intergenic
1111504150 13:89164203-89164225 AGTGATGGGGAGCCTAGGGAGGG + Intergenic
1111595372 13:90404079-90404101 GTTCATGGGCAGCCATGGGAAGG - Intergenic
1111956189 13:94761211-94761233 GGAGATGGGGAGAAAGGGGAAGG - Intergenic
1112166395 13:96924710-96924732 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
1112691876 13:101905552-101905574 GGAGGTGGGGAGCTAGGGGAGGG + Intronic
1112752341 13:102596357-102596379 GGTGAGGGGGAGCAATAGGGTGG - Intergenic
1113282441 13:108803797-108803819 ACTGATGGAGAGCCATGGGAAGG + Intronic
1113469085 13:110531693-110531715 GGACATGGGCAGCCCTGGGACGG - Intronic
1113538284 13:111085080-111085102 TGTGTTGGGGAGCTAAGGGAGGG - Intergenic
1113571916 13:111363816-111363838 GCTGATGGGCAGCTATGGGAAGG + Intergenic
1113584669 13:111456974-111456996 GGTGAGGGGGACCCACAGGAGGG + Intergenic
1113890804 13:113734704-113734726 GGGGATGGGGCCCCAGGGGAAGG + Intronic
1114560105 14:23583786-23583808 GGGGGTGGGGGGCTATGGGACGG - Intergenic
1114649012 14:24271440-24271462 GGTGCCCGGGAGCCGTGGGACGG - Exonic
1115823276 14:37235749-37235771 GGTTATCAGGAGCCAGGGGAGGG - Intronic
1115871906 14:37814095-37814117 TGTGATGGGAAGCCATCAGAGGG - Intronic
1115928287 14:38462208-38462230 GGGGATGGGGAGTCGGGGGAGGG - Intergenic
1116337410 14:43675089-43675111 GGGGATGGGGGGCTATGGGAGGG - Intergenic
1116752961 14:48909916-48909938 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1116770908 14:49126001-49126023 GGGGTTGGGGAGCTAGGGGAGGG - Intergenic
1117970507 14:61246600-61246622 GATAATGGGGAGCCAGGGCAGGG - Intronic
1118045549 14:61967324-61967346 GGTAATGGGATGCCATTGGATGG + Intergenic
1118931070 14:70241278-70241300 GGTGATGGAGGGCTAGGGGAAGG - Intergenic
1119434103 14:74586755-74586777 GGAGATGGAGAACAATGGGAAGG - Intronic
1120535490 14:85689863-85689885 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
1120636053 14:86952300-86952322 GGGGATGGGGAGCAAGGGGAGGG + Intergenic
1120860158 14:89247776-89247798 TGTGATGGGAAGCCACTGGAAGG - Intronic
1120996781 14:90423549-90423571 GATGATGTGGAGCCAGGGCAGGG - Intergenic
1121452863 14:94020466-94020488 GGCAATAGGGAGCCATGGAAGGG - Intergenic
1121540710 14:94723930-94723952 GATGATGTGGAGCAATGGGTCGG + Intergenic
1121661374 14:95637720-95637742 GATGATGGGGAGCTATTGAAGGG + Intergenic
1121674207 14:95739360-95739382 GGTGCTGGGGGGCCAGGGGTAGG - Intergenic
1122052945 14:99072625-99072647 GGCTATGTGGAGCCATGGGCAGG - Intergenic
1122386060 14:101349089-101349111 GTTCATGGGCAGCCATGGGTGGG + Intergenic
1122395756 14:101428909-101428931 GGGGATGGGGAGTGAGGGGAGGG - Intergenic
1122434083 14:101680888-101680910 GGGGCTGGGGAGCAAGGGGAGGG - Intergenic
1122598562 14:102909546-102909568 GGCGCTGGGGAGCCATGGTGTGG + Exonic
1122659886 14:103288118-103288140 TGTGATGGGGGGCCATAGGGCGG - Intergenic
1122809351 14:104280365-104280387 AATGATGGGAAGCCATGGGTGGG + Intergenic
1123048954 14:105531483-105531505 GGTGATGAGCAGCCGTGGAAAGG + Intergenic
1124014504 15:25863769-25863791 GCTCCTGGGGAGCCCTGGGAAGG + Intronic
1124015431 15:25869922-25869944 GGGGATGTGGAGCCCTGGGTGGG - Intergenic
1124036023 15:26054339-26054361 GGGGAGGGGGTCCCATGGGATGG - Intergenic
1124062868 15:26310903-26310925 GCAGGTGGGGAGTCATGGGAGGG + Intergenic
1124102778 15:26711577-26711599 GGAGATGGGGAGCCTGGGGCGGG - Intronic
1125060208 15:35410960-35410982 GGTGAGGAGGGGCCAAGGGAAGG - Intronic
1125063389 15:35452071-35452093 AGTGATGGGGAGCCACTGGAGGG - Intronic
1125084547 15:35714813-35714835 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1125468844 15:39982686-39982708 GGGGGTGGGGAGCTAGGGGAGGG - Intronic
1125754812 15:42056359-42056381 GGTGCTGGGGTGCTGTGGGAGGG + Intergenic
1126293363 15:47108593-47108615 GGGGATGTGGAGCAAGGGGAGGG - Intergenic
1126523911 15:49628977-49628999 GGGGGTGGGGAGCTAGGGGAGGG - Intronic
1126799895 15:52289161-52289183 GGGGCAGGGGAGCCAGGGGAGGG - Intronic
1126935250 15:53699885-53699907 GGTGAAGGAGAGCCACGGAATGG + Exonic
1127128252 15:55834770-55834792 GGTGATGTGGAGGCTTGAGAAGG - Intronic
1127263853 15:57345805-57345827 GGCGATGGGGAGCTAGGGAAGGG - Intergenic
1128154496 15:65384235-65384257 GGTGTTGGGGATCCAGGGCAGGG - Exonic
1128194957 15:65744551-65744573 GGTGATGGGGAGGACTGGGCAGG - Intronic
1128525142 15:68407216-68407238 GGTGGTGGGGGCCCAGGGGAAGG + Intronic
1128567743 15:68712232-68712254 GGTCATGGGGAGAGATGGAATGG + Intronic
1128620650 15:69146714-69146736 GGGGATTGGGGGCTATGGGAGGG - Intergenic
1128991201 15:72261878-72261900 GGTGAAGGGGTGCTCTGGGATGG - Intronic
1129571268 15:76687582-76687604 GGGGATGGGGTGCTAGGGGAGGG - Intronic
1129708269 15:77806928-77806950 GGTAACGGGGAGCCCTGGAAGGG - Intronic
1129932012 15:79419138-79419160 GGGGATGGGGAGCGGTGGCATGG + Intronic
1130108820 15:80948715-80948737 GGCGATGGGGAGCCATGGAACGG + Intronic
1130375482 15:83325255-83325277 GTAGATAGGGACCCATGGGATGG - Intergenic
1130583151 15:85156428-85156450 GGGGATGGGAAGAAATGGGAAGG - Intergenic
1131716843 15:95120878-95120900 GATAGTGGGGAGCCATGGAAAGG + Intergenic
1132575007 16:660212-660234 GGTGCTGGGGAGCCCTGCGGGGG - Intronic
1132689286 16:1175307-1175329 GGTTCTGGGGAGCCCCGGGAGGG + Intronic
1133422333 16:5656932-5656954 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1133659251 16:7899805-7899827 GGTGAGGGTGAGTAATGGGATGG + Intergenic
1134058135 16:11182904-11182926 GGTGAGGCGGGGGCATGGGAGGG - Intergenic
1134093892 16:11406151-11406173 GGTGAGAGGGAGCCAAGGGTTGG - Intronic
1134346505 16:13396825-13396847 AGTGATGGGGACTCATGGGGAGG - Intergenic
1134514574 16:14876375-14876397 GCTGATCGAGATCCATGGGAAGG + Exonic
1135185722 16:20314073-20314095 GGGGATGGGGGGCAAGGGGAGGG + Intronic
1135823604 16:25706523-25706545 GGGGGTGGGGAGCTAGGGGACGG - Intronic
1135934152 16:26765161-26765183 TGCAATTGGGAGCCATGGGAGGG - Intergenic
1135993039 16:27229036-27229058 GGTGGTGGGAAGCCCTGGGGTGG - Intronic
1136361100 16:29780304-29780326 GGTGTTGGGGTGCAAGGGGACGG - Exonic
1136429111 16:30186727-30186749 GGTGGTGGGGACCCAGGGGCTGG + Intronic
1136507361 16:30713386-30713408 GGAGATGGGGATTCATGGGAGGG + Intronic
1136556032 16:31008398-31008420 GGTAAGGGGGAGGCAGGGGAGGG - Intronic
1136751224 16:32637800-32637822 GGTGCTGGAGGGGCATGGGAGGG + Intergenic
1136784174 16:32925055-32925077 GGTGAGGGGCAGCCTGGGGAGGG + Intergenic
1136885610 16:33928751-33928773 GGTGAGGGGCAGCCTGGGGAGGG - Intergenic
1137462755 16:48680272-48680294 GGGGGTGGGGGGCCAGGGGAGGG + Intergenic
1137553179 16:49454303-49454325 GGTGAGAGGGAGCAATGGAAAGG + Intergenic
1137954904 16:52819450-52819472 GGTTATGGGGTGCTATGTGATGG + Intergenic
1138161248 16:54756783-54756805 GGTCATGGGGAGCCATTGATTGG - Intergenic
1138399233 16:56731908-56731930 TGAGATGGGGACCCATTGGAGGG - Intronic
1138460009 16:57142538-57142560 GGCGGTGGGGAGCCACTGGAAGG + Intronic
1138476205 16:57271953-57271975 GGTGCTGGGGAGGCTTGGGTAGG - Intronic
1138848499 16:60596918-60596940 GGTGGTGGGGAGATATGGGAGGG + Intergenic
1139261604 16:65599583-65599605 TGAGATGGGGAGCCGGGGGAAGG + Intergenic
1139428172 16:66895932-66895954 GGTGAGGGGGAGCCATGGTTCGG - Intergenic
1139447390 16:67006311-67006333 GGTGAGTGGGAGGCATGGGGTGG + Intronic
1139449173 16:67016478-67016500 GGCACTAGGGAGCCATGGGAGGG + Intergenic
1139946776 16:70647277-70647299 GGTGTTGGGGAGCCCCGGGCGGG + Intronic
1140039552 16:71397028-71397050 GGTGAGGGGGAGCCCTGAAAGGG - Intergenic
1140157325 16:72445282-72445304 GGTGCTGGGGGGCTAGGGGAGGG - Intergenic
1140691352 16:77487532-77487554 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
1141020417 16:80490683-80490705 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
1141768568 16:86074782-86074804 GGTGGTGGGCAGGCATGGGCGGG + Intergenic
1141799317 16:86296285-86296307 GGTGATGGGGGAACATGGGCTGG + Intergenic
1142029167 16:87829862-87829884 GGTGGGGGTGAGCCATGGGCGGG - Intergenic
1142076798 16:88123136-88123158 GGTGATGGGTAGTCTCGGGATGG - Intergenic
1203053358 16_KI270728v1_random:897055-897077 GGTGCTGGAGGGGCATGGGAGGG + Intergenic
1203086829 16_KI270728v1_random:1189061-1189083 GGTGAGGGGCAGCCTGGGGAGGG + Intergenic
1143283054 17:5769106-5769128 GGTGGTGGGGAGCAAGGGGAGGG + Intergenic
1143307692 17:5960615-5960637 GGTGGTGGGGAGCTAGGGGAGGG + Intronic
1143311263 17:5991507-5991529 GGTAATGAGGAGCCAGGGAAGGG + Intronic
1143426759 17:6845730-6845752 GGGGATGGGGCGCAAGGGGAGGG - Intergenic
1143522368 17:7451983-7452005 GGAGAGGGGGAGCCACTGGAAGG + Intronic
1143911919 17:10257539-10257561 AGGGATGGGGAGCTAGGGGAGGG + Intergenic
1144368960 17:14571688-14571710 GGTAATGGGGAGATGTGGGAAGG - Intergenic
1144738505 17:17568257-17568279 GGTGATGGTGGGCCATAGGCAGG - Intronic
1144871787 17:18376538-18376560 CTTGAGGGGGAGCCAGGGGATGG - Intergenic
1145414293 17:22702696-22702718 GGTGATGAGCAGCCATGGGGTGG + Intergenic
1145889040 17:28402158-28402180 GCTGATGGGCAGCCATGGCTGGG - Exonic
1146482561 17:33216735-33216757 GGTGATGGGGAGCCCCAAGAGGG + Intronic
1146550549 17:33776992-33777014 GGTAATGGGAAGCCATCGCAGGG - Intronic
1146745758 17:35328046-35328068 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1147386963 17:40088681-40088703 AGGGATGGGGAGGCAAGGGATGG - Intronic
1147392429 17:40118490-40118512 TGAGATGGGAAGCCATGAGAGGG + Intergenic
1147522960 17:41191988-41192010 GGGGATGGGGGGCAAGGGGAGGG + Intronic
1147920550 17:43913925-43913947 GGAGATGTGGAGCCCTGGGAAGG + Intergenic
1148065122 17:44863540-44863562 GGGGATGGGGAGGCAAGGGTGGG + Intronic
1148205326 17:45776107-45776129 GGTGAAGGGGAGCCCAGGGAGGG - Intergenic
1148330957 17:46813717-46813739 GGGGATAAGGAGCCAGGGGATGG - Intronic
1148680653 17:49471689-49471711 TGTGATGGAAAGCCATGAGAGGG - Intronic
1149033560 17:52110180-52110202 GGTTATGGGGATCCAGGGGAGGG - Intronic
1149061355 17:52426014-52426036 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1149206422 17:54253503-54253525 ATTGATGGGGAGCCAGAGGAGGG + Intergenic
1149301475 17:55308105-55308127 GGCAATGGGAAGCCTTGGGAGGG + Intronic
1149576293 17:57715838-57715860 GGTGATGGGCAGCCTCGGGTGGG + Intergenic
1150134819 17:62689869-62689891 GGGCATGGGGGGCCATGGGGTGG - Intronic
1151005948 17:70436140-70436162 GGGGATGGGGGGCTAGGGGAGGG - Intergenic
1151323834 17:73366976-73366998 TATGCTGGGAAGCCATGGGAGGG - Intronic
1151749503 17:76028527-76028549 CTTGAGGGGGAGCCAGGGGATGG + Intergenic
1152263874 17:79282171-79282193 GGGCATGGGGAGCTATGGGTGGG + Intronic
1152717669 17:81907665-81907687 GGGGATGGGGAGCAGTGGGCAGG + Intronic
1152851537 17:82639485-82639507 GGTGGTGGGTAGCTTTGGGAAGG - Intronic
1153152586 18:2111773-2111795 AGTGATGGAGAGACATGGAAGGG - Intergenic
1153463368 18:5362064-5362086 GGGGGTGGGGAGCAAAGGGAGGG + Intergenic
1153730340 18:8004907-8004929 GGTGAGGGGGAACCATTTGAGGG - Intronic
1153741765 18:8137491-8137513 GAAGTTGGGGAGCCATGGGAAGG - Intronic
1154045759 18:10903347-10903369 AGTAATGGGGAGCCATTGAAGGG - Intronic
1155048951 18:22129975-22129997 GGGGAAGGGGAGGCAAGGGAAGG - Intergenic
1155072471 18:22328534-22328556 GGAGATGGGGAATGATGGGAAGG - Intergenic
1155566727 18:27143792-27143814 GGGGATGGGGGGCAAGGGGAGGG + Intronic
1156429836 18:37060008-37060030 GGGGATGGGGGGCTAGGGGAGGG + Intronic
1156688677 18:39680220-39680242 GGTGATGGGTGGACATGGGTGGG - Intergenic
1156722429 18:40086225-40086247 GGTGGGGGAGAGTCATGGGATGG + Intergenic
1157104814 18:44764096-44764118 TGAAATGGGGAGCCATGGGAGGG - Intronic
1157191379 18:45585075-45585097 GGAGATGGGAAGCCACTGGAAGG - Intronic
1157311175 18:46554388-46554410 GGTCATGGAGAGCCTAGGGAAGG + Intronic
1157584476 18:48792304-48792326 GGTGGGTGGGAGCCATGGGAAGG + Intronic
1158297116 18:56010704-56010726 GGGGATGGGGGGCGAGGGGAGGG - Intergenic
1158418198 18:57268569-57268591 GGTGATGGGGGGCTGGGGGAGGG - Intergenic
1158442970 18:57493606-57493628 GCTGGTGGGAAGCCCTGGGAAGG + Intergenic
1158658777 18:59365903-59365925 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1158671806 18:59482038-59482060 AGGGATGGGGAGCAAGGGGAGGG - Intronic
1158890349 18:61866491-61866513 GGTACTAAGGAGCCATGGGATGG - Intronic
1159082296 18:63748930-63748952 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1159130634 18:64276919-64276941 TGTGACGGGAAGCTATGGGAAGG + Intergenic
1159210588 18:65316353-65316375 GGGGGTGGGGAGCTAAGGGAGGG + Intergenic
1159349168 18:67249698-67249720 GGGGATGGGGGGCTAGGGGAGGG - Intergenic
1159467969 18:68810831-68810853 GGTGGTGGGGAGCAAGGGGAGGG - Intronic
1159923448 18:74246894-74246916 GGGGATGGGGAGATAGGGGATGG - Intergenic
1160074519 18:75659884-75659906 GGGGATGGGAAGGGATGGGATGG - Intergenic
1160376770 18:78419858-78419880 GGTGATGGGGAGGCTGGAGACGG - Intergenic
1160741388 19:687746-687768 GGCAATCGGGAGCCGTGGGAGGG - Intronic
1160808512 19:1002960-1002982 GGTGATGGGGAACGATGGAAGGG + Intronic
1161173217 19:2823848-2823870 GTTCATGGGCGGCCATGGGAGGG + Intronic
1161204576 19:3034343-3034365 GGCAATAGGGAGCCAGGGGAGGG - Intronic
1161209050 19:3056846-3056868 GGTGACAGGGAGCCATGGGAGGG - Intronic
1161283783 19:3458755-3458777 GGTAGTGGGGAGCCATAGAAGGG + Intronic
1161311724 19:3598234-3598256 GGCAACAGGGAGCCATGGGAGGG + Intronic
1161318055 19:3627506-3627528 GGTGCTGGGGACCCGTGGGAGGG + Intergenic
1161345946 19:3768790-3768812 GGTGATGGGGAGGCCAGGCAGGG - Intergenic
1161436640 19:4267596-4267618 GGTGATGGGGACACATGTGGGGG - Intronic
1161851839 19:6741165-6741187 GGCGACGGGGAGCGGTGGGAGGG + Intronic
1161871895 19:6876743-6876765 GGCAATAGGGAGCCATGGAAGGG + Intergenic
1162013322 19:7830698-7830720 GGGGATGGGGAGCCCTGAGGGGG - Intronic
1162074112 19:8173266-8173288 GAAGATGGGGCCCCATGGGAGGG + Intronic
1162362151 19:10226933-10226955 GGTGGAGGGGAGGGATGGGAGGG - Intronic
1162362170 19:10226978-10227000 GGCGATGGGGGGGGATGGGAGGG - Intronic
1162475298 19:10896060-10896082 GGTGCTGGGGAACCGTGGGGCGG + Intronic
1162792058 19:13068294-13068316 GGTGAGGGGGAGGCAAAGGAAGG + Intronic
1163036318 19:14571274-14571296 GGACGTGGGGAGTCATGGGAGGG - Intronic
1163504970 19:17700175-17700197 GGTAATAGGGAGCCACGGGAGGG + Intergenic
1163552499 19:17973609-17973631 GGCACTGGGGAGCCATGGCAGGG + Intronic
1163597669 19:18229814-18229836 GGCAATGGGGGGCCATGGGAGGG - Intronic
1163636320 19:18438604-18438626 GGACATGGGGAGCCAGGGGATGG - Intergenic
1163650667 19:18515943-18515965 GATGATGTGCACCCATGGGAAGG + Intronic
1163767243 19:19170436-19170458 GATGCTGGGGCGCCATGGGTGGG + Intronic
1163778072 19:19229498-19229520 GGTGCTGGGGAGCCATGCAAGGG + Intronic
1164035044 19:21446281-21446303 GGTGCTGGGGGGCTAAGGGAGGG - Intronic
1164535868 19:29086287-29086309 GGTGAAGGAGAGCCAGGGAATGG - Intergenic
1164795271 19:31021736-31021758 GATGATGGGGAGAGATGGAAGGG - Intergenic
1165254030 19:34562330-34562352 GGGGGTGGGGGGCTATGGGAGGG - Intergenic
1165323853 19:35102707-35102729 AGTGAGGTGGAGCCATGGGAGGG - Intergenic
1165537010 19:36456582-36456604 GGGGGTGGGGAGCTAGGGGAGGG + Intronic
1165760003 19:38315556-38315578 GGTACTGGGGAGCCACGGAAGGG + Intronic
1165796741 19:38524073-38524095 GGTGGTGGGGAGGGAAGGGAAGG - Intronic
1165863240 19:38920057-38920079 GGGCGTGGGGAGCCAGGGGAGGG + Intronic
1165895018 19:39136294-39136316 GGAGAGGTGGAGCCAGGGGAGGG - Intronic
1166126926 19:40720540-40720562 GGAGATAGGGAGGCCTGGGAGGG - Intronic
1166385132 19:42376462-42376484 GGCCCTGGGGACCCATGGGAGGG + Exonic
1166388927 19:42398001-42398023 GGTAGTGGAGAGCCATGGAAGGG + Intergenic
1166543672 19:43622028-43622050 GGTGATGGGGAGCTAGGCAAAGG + Intergenic
1166583574 19:43925349-43925371 GATGATGGGGAAACATGGGCTGG + Exonic
1166810011 19:45508931-45508953 GATTATGGGGGGCCAGGGGAGGG - Intronic
1166886134 19:45962045-45962067 AGTGAGATGGAGCCATGGGAGGG + Intronic
1166959421 19:46488804-46488826 AGCGCTGGGGAGCCATGGGAGGG - Intronic
1167077593 19:47258743-47258765 AGTGATGGGGAGCCATGAAAAGG - Intronic
1167158765 19:47754757-47754779 GGTGAGGGGGAGCCAGGCCAGGG + Exonic
1167254348 19:48418429-48418451 GGTGCTAGGGAGCCTGGGGAGGG + Intronic
1167270214 19:48502057-48502079 GGGGAGGAGGAGCCAGGGGAGGG - Intronic
1167376917 19:49117371-49117393 GGTGCTGGGGAGCTATGGGAGGG + Intronic
1167411685 19:49347719-49347741 GCTGCTGGGGAGCTATGGGAGGG - Intronic
1167442175 19:49514633-49514655 GGCGCTGGGGAGCCATGGGAGGG - Intronic
1167476206 19:49702732-49702754 GGTACTAGGGAGCCATGGGAGGG + Intronic
1167525803 19:49983139-49983161 TGTGCTGGGGAGCCATGGGAGGG - Intronic
1167562262 19:50232912-50232934 GGTGCTGGGGAGCTGTGGGAGGG + Intronic
1167571299 19:50290601-50290623 GGCACTGGGGAACCATGGGAGGG + Intronic
1167573410 19:50305087-50305109 GGCAATGGGGAGCCATGGGAAGG + Intronic
1167605704 19:50480455-50480477 GGTAACAGGGAGCCATGGGAAGG + Intronic
1167631985 19:50631041-50631063 GGCACTGAGGAGCCATGGGAGGG - Intronic
1167634604 19:50647266-50647288 GGCACTGGGGAGCCCTGGGAGGG + Intronic
1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG + Intergenic
1167721050 19:51180734-51180756 GGTGATGGGAAGCCACTGAAGGG - Intergenic
1167735705 19:51293498-51293520 GGGACTGGGAAGCCATGGGAGGG + Intergenic
1167744581 19:51342985-51343007 GGCACTGGGGAGCCAGGGGAGGG - Intergenic
1167747982 19:51364024-51364046 GGTGCTGGGGAGCCACAGGCAGG + Intronic
1167799000 19:51728316-51728338 GGCAATGGGGAGCCATGGAAGGG + Intergenic
1167973667 19:53206067-53206089 GGGGATGGGGAGGTAGGGGAGGG - Intergenic
1168103037 19:54151228-54151250 GGTGGTCGGGAACCATGGCAAGG + Intronic
1168126458 19:54286114-54286136 TGTGATGGGGAGGGATGGGCTGG - Intergenic
1168175436 19:54624750-54624772 TGTGATGGGGAGGGATGGGCTGG + Intronic
1168238445 19:55077974-55077996 GGTAATGGGGAGCGATGGAAGGG - Intronic
1168333919 19:55586116-55586138 GGAGATGGGGAGCCATGGACGGG - Intergenic
1168349144 19:55666108-55666130 GGTGATGGGGTGCTCTGGCAGGG + Intronic
924978727 2:200878-200900 GGTGATTGGGAGTCATGGCTGGG + Intergenic
925002639 2:418098-418120 GGTTATGGAGAGCCATGAAAAGG - Intergenic
925160239 2:1678307-1678329 GGTGATGGGGAGCCATGGGAGGG - Intronic
925473411 2:4186790-4186812 GGAGGTGGGGAGCAAGGGGAGGG - Intergenic
925566725 2:5262620-5262642 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
925885479 2:8390912-8390934 GGGGATGGGATGGCATGGGATGG + Intergenic
925942431 2:8834040-8834062 GGAGATAGAGAACCATGGGAGGG - Intronic
926478998 2:13364501-13364523 GGTGGTGGGGGGCAAGGGGATGG + Intergenic
926728286 2:16015256-16015278 GGGGATGGGGTACCATGGCAGGG - Intergenic
927168992 2:20352375-20352397 GGTGATGGGGAGCAATGAGATGG - Intergenic
927266897 2:21162160-21162182 GTTCATGGGCAGCCATGGGTGGG + Intergenic
927307950 2:21595396-21595418 GGGAATGGGGAGCCAGGGCAGGG - Intergenic
927433393 2:23046225-23046247 GGTGGTGGGGGGCAAGGGGAGGG + Intergenic
928475366 2:31621260-31621282 GGAGATGAGGAGCAATGGAAAGG - Intergenic
928957708 2:36888352-36888374 TGAGATGGGGAGCCATGGGAGGG - Intronic
929064193 2:37956797-37956819 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
929428350 2:41866667-41866689 GGTGGGAGGGAGCCAGGGGAAGG - Intergenic
929817561 2:45246945-45246967 GGTGGTGGGGAGCAAGGGGAGGG + Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930116587 2:47723396-47723418 GGTGATGGGGAGTCTTTGGAAGG - Intronic
930222467 2:48759108-48759130 GGGGATGGGGGGCAAGGGGAGGG - Intronic
930254096 2:49069087-49069109 TGAGATGAGGAGCCATTGGAAGG - Intronic
930359887 2:50364090-50364112 GGGGTTGGGGAGCAAGGGGAGGG + Intronic
930447385 2:51491008-51491030 AGGGATGGGGAGCCCTGGGAAGG - Intergenic
930959514 2:57242268-57242290 GGAGGTGGGGAGCAAGGGGAAGG + Intergenic
931072365 2:58667290-58667312 CGTGATGGAAAGCCATTGGAGGG - Intergenic
931160924 2:59689272-59689294 GGTGGTGGGGGGCAAGGGGAGGG + Intergenic
931503521 2:62898138-62898160 GGTTATGGGAAGCCATTGGTGGG + Intronic
932006905 2:67936531-67936553 GGGGATGGGGGGCTAAGGGAGGG + Intergenic
932137218 2:69242050-69242072 GGTGGTGGGGAGTGAGGGGAGGG + Intronic
932235692 2:70119431-70119453 TGAGATGGGGAGCCGTGGGGAGG + Intergenic
932536549 2:72603358-72603380 GGTGCTGGGGGGCCAGGGGAGGG - Intronic
932569425 2:72930613-72930635 GGGGATGGGGAGGCATGTGCAGG + Intronic
932688763 2:73894884-73894906 GGCTATGGGGAGCCATGGAAGGG + Intronic
932692930 2:73928710-73928732 CGAGATGGGTAGCCATTGGAAGG + Intronic
933063595 2:77768184-77768206 GTTCATGGGCAGCCATGGGTGGG - Intergenic
933633294 2:84680618-84680640 GGACATGGGGAGCAATGGAAGGG + Intronic
934542302 2:95185736-95185758 GGTGATGGGGATCCTAGTGAGGG + Intergenic
934575296 2:95396788-95396810 TCTGCTGGGAAGCCATGGGAAGG + Intergenic
934585790 2:95493247-95493269 GGGGGTGGGGGGCCAGGGGAGGG + Intergenic
934593677 2:95583523-95583545 GGGGGTGGGGAGCCAGGGGAGGG - Intergenic
935627764 2:105185310-105185332 TGCGATGGGAAGCCATGGGAAGG + Intergenic
936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG + Intergenic
936480479 2:112880459-112880481 GCTGCTGGGGAGGCTTGGGAAGG + Intergenic
936999406 2:118451448-118451470 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
937072783 2:119076894-119076916 GGTGATGAGAAAGCATGGGAAGG - Intergenic
937085864 2:119171278-119171300 GGGGGTGGGGAGCGAGGGGAAGG - Intergenic
937735437 2:125282133-125282155 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
937741230 2:125356953-125356975 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
937939066 2:127271051-127271073 GGTGAGAGGGAGCCAGGGCAAGG - Intronic
938100216 2:128493244-128493266 GGTGATGGGGGTCCAGAGGACGG + Intergenic
938997960 2:136700755-136700777 GGGGATGGGGAGCTAGGGGAGGG + Intergenic
939723830 2:145689305-145689327 GGGGATGGGGGGCTAGGGGAGGG - Intergenic
939753151 2:146074304-146074326 GGGGATGGGGAGCTAGGGGAGGG - Intergenic
939986682 2:148835753-148835775 TGTGATGGGAAGCCATGGGAAGG - Intergenic
941040939 2:160622858-160622880 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
941076948 2:161016288-161016310 GGGGATGAGGAGCTAGGGGAAGG + Intergenic
942245512 2:174004340-174004362 TGAGATGGGGAGCCACTGGAGGG - Intergenic
942504331 2:176625745-176625767 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
942899326 2:181095218-181095240 GGTGGTGGGGGGCAAGGGGAAGG + Intergenic
944041049 2:195355250-195355272 GGGGGTGGGGGGCCAAGGGATGG + Intergenic
944556380 2:200891457-200891479 AGGGGTGGGGAGCCTTGGGAAGG + Intronic
945341353 2:208659818-208659840 GGGAATGGAGAGCTATGGGAGGG - Intronic
945371689 2:209026137-209026159 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
946242374 2:218364563-218364585 GATGATGGGGAGCCCTTGGCGGG + Intronic
946263407 2:218516540-218516562 GGGGATGGGGGGCAAGGGGAGGG + Intronic
946389887 2:219408923-219408945 GGGGATGGGGATGCATGGGAGGG + Intergenic
946431727 2:219629978-219630000 GGAAAGGGGGAGCCACGGGATGG + Intronic
946481219 2:220058571-220058593 GGGAATGGGCAGGCATGGGAAGG - Intergenic
947002237 2:225469850-225469872 GGGGATGGGGGGCTAGGGGAGGG + Intronic
947342697 2:229156740-229156762 GGAGATGGGAAGACATGGGAGGG - Intronic
947533879 2:230928935-230928957 CCAGATGGGGAGCCATAGGATGG - Intronic
947866731 2:233402999-233403021 GGTGGTGGTTAGCCTTGGGAGGG + Intronic
947940859 2:234053915-234053937 GGAGATGGGGAGGGAGGGGAAGG + Intronic
948031483 2:234821296-234821318 GGTGATGGGGATCCACCGAAGGG - Intergenic
948550202 2:238765939-238765961 GGGGGTGGGGAGCCGTGGGGAGG - Intergenic
948662717 2:239516827-239516849 TGTGATGGTGAGCACTGGGATGG - Intergenic
948751305 2:240134963-240134985 GGCGATGTGGAGCCACCGGAGGG - Intronic
948815563 2:240508541-240508563 GGGGATGGAGAGTGATGGGAAGG - Intronic
949060854 2:241956560-241956582 GATGATGGGCAGACATGGCAGGG + Intergenic
949069870 2:242018049-242018071 GGTGCTGGGGACGCAGGGGAGGG + Intergenic
1168760195 20:345478-345500 GGTAGTGGGGAGCCATGGAAGGG - Intergenic
1168764029 20:369714-369736 AGTCATGGGGAGGCAGGGGAGGG - Intronic
1168787310 20:551057-551079 TGAGGTGGGGAGCTATGGGAGGG + Intergenic
1168792834 20:591451-591473 AGTGATGGGAAGCCATCGGAGGG + Intergenic
1169120990 20:3095415-3095437 GGCAATGGGGAGCCATGGACAGG - Intergenic
1169193925 20:3673493-3673515 GGTCCTGGGGGGCCGTGGGAGGG + Exonic
1170603922 20:17861864-17861886 AAGGATGAGGAGCCATGGGATGG + Intergenic
1170693663 20:18638028-18638050 CGTGATGGGGAGCCAAAGGCAGG - Intronic
1170719911 20:18867565-18867587 GGAGATGGGGGGCTGTGGGAGGG - Intergenic
1170884650 20:20329614-20329636 AGTGATGGAAAGCCATGGGAAGG - Intronic
1170959523 20:21012805-21012827 GGTGATTCGCAGCCATGGGCAGG + Intergenic
1171255394 20:23686153-23686175 GGTGACTTGGAGCCTTGGGAGGG - Intronic
1171262737 20:23748075-23748097 GGTGACTTGGAGCCTTGGGAGGG - Intronic
1171271874 20:23824279-23824301 GGTGACTTGGAGCCTTGGGAGGG - Intronic
1171278239 20:23876454-23876476 GGTGACTTGGAGCCTTGGGAGGG - Intronic
1172013032 20:31857476-31857498 GGCAATGGGGAGCTATGGTAGGG - Intronic
1172030804 20:31980741-31980763 AGTGATGGAGAGCCACAGGAAGG - Intronic
1172188988 20:33050242-33050264 GGTGATGGGAAGCCAAGGAAGGG - Intergenic
1172954952 20:38749539-38749561 TGAAATGGGGAGCCATGGCAGGG + Intronic
1173179202 20:40789568-40789590 GGAAATCGGGAGCCATGGAAGGG + Intergenic
1173189950 20:40868572-40868594 GGCTGTGGGGAGCCATGGAAGGG + Intergenic
1173387176 20:42599489-42599511 AGAGATGGGGTGCAATGGGAGGG + Intronic
1173622338 20:44446104-44446126 AATGATGGGAAGCCATTGGAGGG - Intergenic
1173846405 20:46191427-46191449 GGGGATGGGGGCCAATGGGAAGG + Intronic
1173864192 20:46303815-46303837 GGCAATGGGGAGCCATGGAAGGG + Intronic
1173939817 20:46901155-46901177 CGTGAGAGGGAGCCATGGGGAGG - Intronic
1173994442 20:47326992-47327014 GGGGATGGGGAGTTACGGGAGGG + Intronic
1174189531 20:48730290-48730312 TGGGATGGGAAGCCGTGGGAGGG - Intronic
1174323608 20:49761740-49761762 AGTACTGGGGAGCCATGGGAGGG - Intergenic
1174330206 20:49812006-49812028 GGAGATTGGAAGCCATTGGAGGG + Intergenic
1174355980 20:49998171-49998193 GGCAATGGGGAGCCATGGGAGGG + Intergenic
1174398243 20:50261072-50261094 AGTAACGGGGAGCCATGGAAGGG - Intergenic
1174453100 20:50631594-50631616 GGTGACTGGGAGCCATGGGAGGG + Intronic
1174522038 20:51139101-51139123 GGTGATAGGGAGCCCCTGGAAGG - Intergenic
1174524987 20:51163479-51163501 GGTAATGGGGAGCCAAGGGGGGG + Intergenic
1174832238 20:53823508-53823530 GGAAATAGGGAGCCATGGGAGGG + Intergenic
1174838020 20:53876527-53876549 TGTGAAGGGAAGCCATGGGGAGG - Intergenic
1175303164 20:57957273-57957295 GCTGATGTGAAGCCATGGGGAGG - Intergenic
1175632780 20:60556217-60556239 AGTGATGGGAAGCCACTGGAGGG + Intergenic
1175900705 20:62358906-62358928 GATGGTGGAGACCCATGGGAGGG - Intronic
1175970665 20:62685166-62685188 GGTGGTGGGGAGGCACGGGCAGG + Intronic
1176125960 20:63474789-63474811 GGTCTTGGGGAGCCATCGGCTGG + Intergenic
1177341038 21:19800617-19800639 GGGGATGGGGAGCAAGGAGAGGG - Intergenic
1177853205 21:26373403-26373425 GGGGCTGGGGAGCTAGGGGAGGG - Intergenic
1178617549 21:34146803-34146825 GGAGCTGGGGATCCTTGGGAGGG + Intergenic
1179102321 21:38365049-38365071 GGAGGTGGGGGGCAATGGGAGGG + Intergenic
1179129389 21:38621133-38621155 TGGGATTGGAAGCCATGGGATGG + Intronic
1179254563 21:39704052-39704074 GGTGATGGAGGGCAAGGGGAGGG - Intergenic
1179887122 21:44318958-44318980 GGTGATGGGGAACACTGGGGTGG + Intronic
1180037774 21:45258559-45258581 GGTGATGAGGAGCCGCTGGAGGG + Intergenic
1180915073 22:19480088-19480110 GGTGACCGGGAGGCAGGGGAGGG + Intronic
1181015640 22:20066894-20066916 GCTGCTGGGGAGCCCTGGGCAGG - Intergenic
1181025734 22:20126368-20126390 GGTGACGTGGTGCCATGGGTTGG + Exonic
1181908432 22:26218397-26218419 GGAGGTGGGGAGCAAGGGGAGGG - Intronic
1181976813 22:26736378-26736400 GGCGATGGGGTGGGATGGGATGG - Intergenic
1182001951 22:26926884-26926906 GGCAATAGGGGGCCATGGGAGGG + Intergenic
1182282809 22:29226890-29226912 GGTGATGGAGCCCCATGGGAGGG - Intronic
1182295760 22:29310637-29310659 GGTGCTGAGGAGCCACGTGATGG + Exonic
1182548515 22:31089158-31089180 GGTGAGGGGCAGCCCTGGGACGG - Intronic
1182649184 22:31836899-31836921 TGGGATGGGGGGCCAGGGGAGGG - Intronic
1182921178 22:34081015-34081037 GGGGGTGGGGGGCCAGGGGAGGG - Intergenic
1182977715 22:34639014-34639036 GGGGATGGGGAGGGATGGGGAGG - Intergenic
1183348153 22:37319239-37319261 GGTGACGGGGAGCCAGGAAAGGG + Intergenic
1183352314 22:37341171-37341193 GGTGATGTGGCAGCATGGGAGGG + Intergenic
1183581772 22:38730706-38730728 GGTGAGGGTGGGCCAGGGGAAGG - Exonic
1183647490 22:39134876-39134898 GGTGATGGCCAGCCGTGGCATGG - Intronic
1183747185 22:39698646-39698668 GATGATGGGGAGTGATGGGGGGG - Intergenic
1183747300 22:39699033-39699055 GGTGATGGGGAGTGATGAGGAGG - Intergenic
1183747313 22:39699088-39699110 GGTGATGAGGAGTGATGGGCAGG - Intergenic
1183747320 22:39699121-39699143 GGTGATGGGGAATGATGGGGAGG - Intergenic
1183747337 22:39699193-39699215 GGTGATGGGGAGTGATGGGGAGG - Intergenic
1183747349 22:39699226-39699248 GGTGATGGGGAGTGATGGGGAGG - Intergenic
1184102450 22:42347904-42347926 GGTGATGGGGACCCAGGGGCGGG + Intergenic
1184285220 22:43466841-43466863 GGTGAGGGGGAAACATGGGCAGG - Intronic
1184330356 22:43823388-43823410 TAAGATAGGGAGCCATGGGAGGG - Intergenic
1184564819 22:45285566-45285588 GGCGCTGGGGGACCATGGGAGGG + Intronic
1185075162 22:48679028-48679050 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075229 22:48679220-48679242 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075426 22:48679734-48679756 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185082322 22:48716518-48716540 GGAGGTGGGGGGCCAGGGGAGGG + Intronic
1185256593 22:49836783-49836805 GGAGATGGGAAGCCAGTGGAAGG - Intergenic
1185291710 22:50030738-50030760 GGTGATGGGGGTCCCTGGGCAGG + Exonic
949356133 3:3182485-3182507 GGAGATGGGGAGCCAAGGAAGGG - Intergenic
949856554 3:8467180-8467202 TGTGATGGGAAGCCACTGGAGGG - Intergenic
950202820 3:11056975-11056997 GGTGGTGGGGAGCCATGGGAAGG - Intergenic
950339906 3:12234019-12234041 GGTGATGGTCAGCCCTGGGGAGG - Intergenic
950561419 3:13730539-13730561 GGGGATGGGGGGCTAGGGGAAGG - Intergenic
951450507 3:22832256-22832278 GGAGGTGGGGAGCTAGGGGAGGG + Intergenic
951510163 3:23491612-23491634 GTTGAAGGGGAGCTTTGGGATGG + Intronic
951575501 3:24109382-24109404 GGGGATGGGAAGCTAGGGGAGGG - Intergenic
952269375 3:31817120-31817142 GGCCATGGGCAGCCATGGGCGGG + Intronic
952503123 3:33982930-33982952 GGGGATGGGGAGCAAAGGGAGGG - Intergenic
953000511 3:38928371-38928393 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
953191389 3:40691134-40691156 GGGAATGGGGAGGCATGGGGAGG - Intergenic
953265072 3:41379055-41379077 GGAGATGGGAAGCAAGGGGAGGG + Intronic
953306151 3:41831690-41831712 GGGGATGGGGAGCAAGGGGAGGG - Intronic
954149757 3:48651536-48651558 GGCGATGGGGAGACCTGGCAGGG - Intronic
954198344 3:49009294-49009316 GGGGGTGGGGAGCAATGGGAGGG - Intronic
954442615 3:50530077-50530099 GGCAATGGTGAGCCATGGAAGGG + Intergenic
954490056 3:50895656-50895678 GGGGTTGGGGAGCTAGGGGAGGG - Intronic
954531619 3:51325912-51325934 GGGGATGGGGGGCTAGGGGAGGG + Intronic
954718132 3:52537145-52537167 GGTGAAGGGCAGGCATGAGAGGG - Intronic
954930707 3:54278834-54278856 GGGGATGGGGGGCAAGGGGAGGG + Intronic
954947252 3:54436778-54436800 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
955429531 3:58828158-58828180 GGTGATGGGGAGTCACTGAAAGG + Intronic
956092032 3:65678171-65678193 GAGGATGGGGAGCTAGGGGAGGG + Intronic
956230618 3:67012031-67012053 GGAGATGGGAAGCCATTGGAAGG - Intergenic
957150068 3:76475390-76475412 GGTGATGTGCAGCCATGGTGAGG + Intronic
957459384 3:80497330-80497352 GTCCATGGGCAGCCATGGGAGGG + Intergenic
957475944 3:80724412-80724434 GGTGGTGGGGGGCTAGGGGAGGG - Intergenic
957583274 3:82104270-82104292 AGGGATGGGGGGCCAGGGGAGGG - Intergenic
957883820 3:86256648-86256670 TGAGATGGGAAGCCATTGGAGGG + Intergenic
957964395 3:87303891-87303913 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
959345823 3:105193050-105193072 GGGGATGGGAAGCAAGGGGAAGG + Intergenic
959476818 3:106821849-106821871 GTTTATGGGTAGCCATGGGTGGG - Intergenic
959506480 3:107162255-107162277 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
959739157 3:109695752-109695774 GCTGCTGGGTAGCCATGGAATGG + Intergenic
959848624 3:111062663-111062685 TGTTATGGGGGGCCAGGGGAAGG + Intergenic
960684425 3:120282816-120282838 TGTGAGGGGAAGCCATTGGAGGG + Intronic
960721228 3:120626317-120626339 GGGGATGGGGAGAGGTGGGAAGG - Intergenic
960777065 3:121268405-121268427 GGGGATGGGGTGCTAGGGGAGGG + Intronic
960915963 3:122695099-122695121 GGTAATGGGGAGCCATTGAAGGG + Intronic
961051662 3:123752074-123752096 TGTGAGGGGAAGCCATGGGAGGG + Intronic
961081881 3:124034166-124034188 GGGGAGGGGGAGCCAAGGGAGGG - Intergenic
961354097 3:126323646-126323668 GGGGGTGGGGGGCCAGGGGAGGG - Intergenic
961607939 3:128111393-128111415 GGAGATGGGGAAGAATGGGAGGG - Intronic
961826463 3:129601756-129601778 AGTGGTGGGGAGTGATGGGATGG - Intronic
961872057 3:129995849-129995871 GGAGCAGGGAAGCCATGGGAAGG + Intergenic
962174509 3:133138907-133138929 GGGGGTGGGGAGCTAGGGGAGGG - Intronic
962180523 3:133201438-133201460 GGTGGTGGGGGGCTAGGGGAGGG - Intronic
962416196 3:135184159-135184181 GGTGATGGGGAGTCATAGCATGG + Intronic
963216831 3:142757644-142757666 GGGGATGGGGGGCAAGGGGAGGG + Intronic
963654732 3:148032129-148032151 GGTGATGGGAGGCAAGGGGAGGG - Intergenic
963931284 3:151006629-151006651 GGGGGTGGGGGGCTATGGGAGGG - Intergenic
964156846 3:153596089-153596111 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
964234030 3:154504173-154504195 GGGGGTGGGGTGCTATGGGAGGG + Intergenic
964685006 3:159385836-159385858 GGGGATGGGGGGCTAGGGGAGGG - Intronic
964763084 3:160152930-160152952 GGAGAGGGCGAGCCATTGGAGGG + Intergenic
964962698 3:162447816-162447838 TGGGATGGGGAGCTAGGGGAGGG - Intergenic
966058612 3:175728136-175728158 GGTCAAGGGGAGCAATGGAAAGG + Intronic
966060555 3:175749244-175749266 GATGATGGGGAGAGAAGGGAAGG + Intronic
966554669 3:181245376-181245398 GGGGATGGGGAGCGAGGGGAAGG + Intergenic
967686407 3:192421670-192421692 GGGGATGGAGGGCCAGGGGAAGG + Intronic
967770086 3:193325122-193325144 GAGCATAGGGAGCCATGGGAAGG - Intronic
967806390 3:193717762-193717784 GATGATGGGGAGCCACTGAAGGG + Intergenic
967977286 3:195042552-195042574 GGAGATGGGGAGCCACGGTGGGG - Intergenic
968559420 4:1270657-1270679 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
968702283 4:2062747-2062769 GGCAATGGGGAGGGATGGGAGGG + Intronic
968989033 4:3896296-3896318 AGGGAAGGGGGGCCATGGGAAGG - Intergenic
969175148 4:5393152-5393174 GGGGTTGGGGAGGAATGGGAGGG - Intronic
969480516 4:7444626-7444648 GGTAGTGGGGAGCCATAGCAGGG + Intronic
969488162 4:7483747-7483769 GGGGGTGGGGGGCCAGGGGAGGG + Intronic
969856682 4:10005431-10005453 GGCACTGGGGAGCCATTGGAGGG + Intronic
969857131 4:10009123-10009145 GGTGAGGGGGAGGCATAGCAGGG - Intronic
969933173 4:10653190-10653212 GGAGATGGGGGGCTAGGGGAGGG + Intronic
970401022 4:15717948-15717970 GGTGATAGGTGGGCATGGGAAGG + Intronic
970411568 4:15813587-15813609 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
970496880 4:16635141-16635163 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
971092314 4:23360385-23360407 GTCCATGGGCAGCCATGGGAGGG + Intergenic
971749179 4:30624324-30624346 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
971757635 4:30722297-30722319 GGTGATGAGGACCCGTAGGATGG - Exonic
972382448 4:38532002-38532024 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
972446533 4:39149554-39149576 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
972500146 4:39670306-39670328 GGGGATGGGGAGCAAGGGGAAGG - Intergenic
972769143 4:42179904-42179926 TGTGATGGGAAGCCATTGGAGGG + Intergenic
973016828 4:45150276-45150298 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
973081327 4:45997458-45997480 GGGGGTGGGGGGCTATGGGAGGG - Intergenic
973633107 4:52838056-52838078 GCTGCTGGGGAGCAATGGGGAGG - Intergenic
973651681 4:53003078-53003100 GGTGGTGGGGCCCAATGGGAGGG - Intronic
973714666 4:53663926-53663948 GGAGGTGGGGAGCTAGGGGAGGG - Intronic
973717418 4:53691020-53691042 AGTGATGGGAAGCCATTGAATGG - Intronic
973914340 4:55618360-55618382 GGTGTTGGGGGGCAAGGGGAGGG - Intronic
974094111 4:57343699-57343721 GGGGTTGGGGAGCTAGGGGAGGG + Intergenic
974432584 4:61817361-61817383 GTCCATGGGCAGCCATGGGAGGG - Intronic
974928314 4:68329230-68329252 GGTTGTGGGGAGCAGTGGGAGGG - Intronic
975254348 4:72216204-72216226 GTCCATGGGCAGCCATGGGAGGG + Intergenic
975329596 4:73099230-73099252 GGTGATGGTGAGCCTGGGAAAGG - Intronic
975389183 4:73796643-73796665 GGGGTTGGGGAGCTAGGGGAGGG + Intergenic
975424396 4:74209333-74209355 GGTGGTGGGGAGCAAGGGGAGGG - Intronic
975476616 4:74830789-74830811 GGGGGTGGGGGGCCAGGGGAGGG + Intergenic
975528015 4:75372669-75372691 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
975842827 4:78493656-78493678 GGTGGTGGGGGGCTAGGGGAGGG + Intronic
976160114 4:82190119-82190141 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
976426205 4:84905953-84905975 GGTGATAGAGGGTCATGGGAAGG - Intronic
976664424 4:87574737-87574759 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
976903026 4:90203338-90203360 GGTGGTGGGGAGCTAGGAGAGGG - Intronic
977204030 4:94149681-94149703 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
977711280 4:100128915-100128937 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
978099102 4:104814947-104814969 GGGGGTGGAGAGCAATGGGAGGG + Intergenic
978456027 4:108892904-108892926 GGTGATGAGGAGTCAGGGGGCGG + Intronic
978578158 4:110206579-110206601 GCTGCTGGGGAGCCATGGTCAGG - Intergenic
978663419 4:111154561-111154583 GTTCATGGGGGGCCATGGGCAGG + Intergenic
978694540 4:111561013-111561035 GGGGTTGGGGGGCTATGGGAGGG + Intergenic
978784196 4:112591478-112591500 AGAGATTGGGAGCCATTGGAGGG - Intronic
979044221 4:115840231-115840253 GGGGATGGGGGGCTAGGGGATGG + Intergenic
979220713 4:118220450-118220472 GGGGATGGGGGGCTAGGGGAGGG + Intronic
979532902 4:121787961-121787983 AGCAATGGGAAGCCATGGGAGGG + Intergenic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
980633383 4:135468123-135468145 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
980804102 4:137789641-137789663 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
980894470 4:138848882-138848904 GGGGATGGAGGGCTATGGGAGGG - Intergenic
981104930 4:140869777-140869799 GGTGATAGGGAGCTGTGGGCAGG + Intronic
981122151 4:141064714-141064736 GGTGATGGGCAGAAAAGGGAGGG + Intronic
981243735 4:142509368-142509390 GGGGATGGGGGGCAAGGGGAGGG - Intronic
981432582 4:144678532-144678554 GGGGATGGGGGGCTAGGGGAGGG - Intronic
981456260 4:144956750-144956772 GGGGATGGGGAGCTAGGGTAGGG - Intergenic
982324432 4:154114801-154114823 GGGGATGGGGAGCTAGGGGAGGG + Intergenic
982545210 4:156724696-156724718 GTTCATGGGGAGCCATGGGCAGG - Intergenic
982685963 4:158489241-158489263 GGGGTTGGGGAGCAAGGGGAGGG - Intronic
983082154 4:163399807-163399829 AGGGATGGGGGGCAATGGGAGGG + Intergenic
983127502 4:163972198-163972220 GGGGGTGGGGAGCTAGGGGAGGG + Intronic
983543940 4:168942233-168942255 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
984325804 4:178249010-178249032 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
984525611 4:180856010-180856032 GGGGTTGGGGGGCAATGGGAAGG - Intergenic
984578028 4:181474165-181474187 GGGGATGGGGAGTTAGGGGAGGG + Intergenic
985445457 4:190019004-190019026 GGAGCTGGAGAGCCAGGGGAAGG + Intergenic
985478545 5:92716-92738 CCTGAAGGGGAGCCAGGGGAGGG + Intergenic
985505647 5:278795-278817 GGTGCTGGGGATGCAGGGGAGGG + Intronic
985585573 5:731935-731957 GGCAATGGGGAGACATGGAAGGG - Intronic
985599242 5:817748-817770 GGCAATGGGGAGACATGGAAGGG - Intronic
985600014 5:823362-823384 GGCAATGGGGAGACATGGAAGGG - Intronic
985779629 5:1863427-1863449 AGTAATGGGTTGCCATGGGAGGG + Intergenic
986513466 5:8534377-8534399 GGAGGTGGGGAGCAAGGGGAGGG - Intergenic
986696292 5:10358333-10358355 TGAGATAGGGAGCTATGGGAGGG + Intronic
986880138 5:12159494-12159516 GGGGTTGGGGGGCCAGGGGAGGG + Intergenic
987893300 5:23911828-23911850 GGAGGTGGGGGGCTATGGGAGGG + Intergenic
987942007 5:24551017-24551039 TGTGATGGGAAGCCATTGGTGGG - Intronic
988012663 5:25510757-25510779 GGAGGTGGGGGGCTATGGGAGGG - Intergenic
988061982 5:26183185-26183207 GGGGATGGGGGGCAACGGGAGGG - Intergenic
988062104 5:26184881-26184903 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
988135500 5:27165574-27165596 GGTGGTGGGGGGACAAGGGAAGG - Intergenic
988141362 5:27245113-27245135 GGGGGTGGGGGGCCAGGGGAGGG - Intergenic
988394002 5:30673799-30673821 GGGGGTGGGGGGCCAGGGGAGGG + Intergenic
988618773 5:32801088-32801110 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
989246515 5:39261176-39261198 GGGGATGGGGAGCGAGGGGAGGG + Intronic
989364474 5:40640263-40640285 GGGGGTGAGGAGCCAGGGGAGGG + Intergenic
989397215 5:40970749-40970771 GGGGATGGGGGGCAAGGGGAGGG - Intronic
990718966 5:58671616-58671638 GCTGATATGGAGACATGGGAAGG - Intronic
990726094 5:58756520-58756542 GGGGGTGGGGGGCCAGGGGAGGG - Intronic
990911260 5:60854747-60854769 GCTGATAGGAAGCCATTGGAAGG - Intergenic
992390171 5:76323888-76323910 GGGGATGGGGAGTGAGGGGAGGG + Intronic
992638038 5:78744308-78744330 GGAGAAGGGGAAACATGGGAAGG - Intronic
993960376 5:94290275-94290297 GGTGGTGGGGGGCTAGGGGAGGG - Intronic
994348760 5:98719782-98719804 GGGGTTGGGGGGCTATGGGAGGG + Intergenic
994990785 5:106994449-106994471 GGTGGTGGAGGGCAATGGGAGGG - Intergenic
995127242 5:108590498-108590520 TGTGTTTGGGAGCCGTGGGAAGG + Intergenic
995337244 5:111013950-111013972 GGGGATGGGGGGCTAGGGGAGGG - Intergenic
995643760 5:114287598-114287620 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
995666691 5:114550436-114550458 GGGGTTGGGGAGCAAGGGGAGGG + Intergenic
995880277 5:116837163-116837185 GGTAATGGTGAGCCAGGGAAGGG + Intergenic
995951904 5:117725362-117725384 GGGGATGGGGAGCTAGGGGAGGG - Intergenic
996060872 5:119032018-119032040 TGAGATGGGAAGCCATTGGATGG - Intergenic
996660709 5:125998948-125998970 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
996798463 5:127376523-127376545 GGTGCTGGTGGGCAATGGGATGG + Intronic
997100883 5:130968287-130968309 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
997186492 5:131886973-131886995 GGGGATGGGGAGCTGGGGGATGG - Intronic
997197980 5:131992289-131992311 GGTAATGGGGAGCCAGGAAAGGG + Intronic
997807049 5:136928399-136928421 GGAGATGGGGGGCTAGGGGAGGG - Intergenic
997843052 5:137259489-137259511 GGGGATGGGGAACTAGGGGAGGG + Intronic
998372425 5:141670490-141670512 GGTGAGGGGGAGCCAAGGGATGG - Exonic
998551338 5:143080735-143080757 TGTAATGGGGAGCCACTGGAGGG + Intronic
998599897 5:143574919-143574941 GGTGATAGGAAGCCATTGCAGGG - Intergenic
998714459 5:144867298-144867320 GGTGAATGGGAACCATGTGAGGG - Intergenic
998899865 5:146841782-146841804 GGGGTTGGGGAGCTAGGGGAGGG + Intronic
998972161 5:147604966-147604988 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
999197422 5:149791988-149792010 AATGATGCTGAGCCATGGGAGGG + Intronic
999368535 5:151038720-151038742 AGTGATGACGAGCCATGAGAAGG + Intronic
999443359 5:151620058-151620080 GCTGCTGGGGAGGCATGGAAGGG - Intergenic
999470425 5:151850122-151850144 GGTCCTGGGAAGCCATTGGAAGG - Intronic
999506808 5:152206990-152207012 TGTGATGGGGAGCCACAGGCAGG + Intergenic
1000040734 5:157483060-157483082 GGTGGTGGGGGGCTAGGGGAGGG + Intronic
1000230587 5:159311868-159311890 GGAGATGAGAAACCATGGGAAGG + Intergenic
1000243869 5:159432940-159432962 GGGGCTGGGGAGTCATGGGGTGG - Intergenic
1000584439 5:163079162-163079184 GGTGATGGGGGCCAAGGGGAGGG + Intergenic
1000849094 5:166317992-166318014 GGAGAGGGGGAGACATAGGATGG - Intergenic
1001024589 5:168213491-168213513 GGTGATGGGAAGACAGGGGCTGG - Intronic
1001372078 5:171215045-171215067 GGGGATGGGGGGCAAGGGGATGG - Intronic
1001521255 5:172395139-172395161 GGTGGTGGGGATGCATGGGGAGG - Intronic
1001722984 5:173871755-173871777 GGTGGTGGAAAGCCAAGGGATGG - Intergenic
1001949458 5:175806111-175806133 GGTGATGGGGAGCCATTGCAGGG - Intronic
1001959992 5:175874092-175874114 GGCCATGGGGAGCCATTGCAGGG + Intronic
1002461985 5:179378461-179378483 GGATGTGGGGAGCCATGGGCAGG - Intergenic
1002757933 6:179360-179382 GGTGCTGGAGGGGCATGGGAGGG + Intergenic
1003032366 6:2612989-2613011 GGAGATGGGGGGCTAGGGGAAGG + Intergenic
1003033740 6:2624664-2624686 GGTCATGGGGAGCCGTGGGGTGG - Intronic
1003794191 6:9581659-9581681 GGGGAAGGGGATCCTTGGGATGG - Intergenic
1003957154 6:11174541-11174563 GATGATGAGGAGCCCGGGGAAGG - Intergenic
1004408973 6:15362660-15362682 GATTCTGGGGAGCCATGGAAAGG + Intronic
1005267947 6:24132835-24132857 GGGGGTGGGGAGCAAGGGGATGG - Intronic
1005295735 6:24424957-24424979 GGTCATGGGAAGCCATTAGAGGG + Exonic
1005785293 6:29239121-29239143 GGGGGTGGGGGGCCAGGGGAGGG - Intergenic
1006087202 6:31604589-31604611 GTAGATGGGGAGAGATGGGAAGG - Intergenic
1006114810 6:31769922-31769944 GGTGGTGGGGAGCCCCAGGAGGG + Intronic
1006222977 6:32510123-32510145 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
1006282241 6:33063600-33063622 GGGCATGGGGAGCAAGGGGAGGG - Intergenic
1006449701 6:34098975-34098997 TGTGAGGGGGAGCCCTGGGGAGG - Intronic
1006474311 6:34244969-34244991 GGTGATGGTGGGCCTGGGGAAGG - Exonic
1006510499 6:34518716-34518738 GGTGGTGGAGAGCCACTGGAAGG - Intronic
1007046958 6:38785623-38785645 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
1007847432 6:44771427-44771449 AGGGGTGGGGAGCCAGGGGAGGG + Intergenic
1008069795 6:47087702-47087724 GAGGATGGGGAGCAAGGGGAGGG + Intergenic
1008286852 6:49663813-49663835 GGTGCTGGGGAGCTAGGGGAGGG - Intergenic
1008407078 6:51130503-51130525 GGTGTTGGGGGGCTAGGGGAGGG - Intergenic
1008552607 6:52647233-52647255 GGTGCTGTGGGTCCATGGGAAGG + Intergenic
1008628963 6:53346052-53346074 GGTGGTGGGGGGCAAGGGGAGGG - Intronic
1009167558 6:60358952-60358974 GGGGGTGGGGAGCCGGGGGAGGG - Intergenic
1009280606 6:61746299-61746321 GGGGATGGGGGGCAAGGGGAGGG - Intronic
1009487145 6:64238893-64238915 GGGGATGGGGAGCTAGTGGAGGG - Intronic
1009667061 6:66696210-66696232 GGGGGTGGGGAGCTAAGGGAAGG + Intergenic
1009710170 6:67308106-67308128 GGGGGTGGGGAGCTAAGGGAGGG + Intergenic
1009805675 6:68599021-68599043 GGTGATGGGGAGTGAATGGAAGG + Intergenic
1010101408 6:72112410-72112432 TGAGATGGGAAGCCATTGGAGGG - Intronic
1010322559 6:74529431-74529453 GGTGGTGGGAAGCTATGGGTAGG - Intergenic
1010593727 6:77739571-77739593 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
1010858587 6:80876138-80876160 GGTAGTGGGGAGCAAGGGGAGGG - Intergenic
1010933703 6:81835163-81835185 GGGGCTGGGGGGCTATGGGAGGG - Intergenic
1010942277 6:81932810-81932832 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
1011080515 6:83485753-83485775 GGGGCTGGGGGGCAATGGGAGGG + Intergenic
1011201121 6:84837473-84837495 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1011675719 6:89731609-89731631 GGGGATGGGGGGCAAGGGGAGGG + Intronic
1011766859 6:90629560-90629582 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
1011992056 6:93534127-93534149 GGTGATGGGGAGCAAAGGGAGGG - Intergenic
1012697624 6:102408466-102408488 GGGGAAGGGGAGCAAAGGGAAGG - Intergenic
1012850768 6:104444165-104444187 GGGGATGGGGAGCTAGGGGAGGG + Intergenic
1012953031 6:105539137-105539159 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1012970610 6:105726062-105726084 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
1013390925 6:109685578-109685600 GGGGGTGGGGGGCTATGGGAGGG + Intronic
1014234435 6:118938899-118938921 GGGGATGTGGAGCTAGGGGAGGG - Intergenic
1014275754 6:119386412-119386434 GGGGATGGGGAGCAAGGGGAGGG + Intergenic
1014421577 6:121252569-121252591 GGGGGTGGAGAGCCAGGGGAGGG + Intronic
1014443671 6:121501911-121501933 TGTGGTGGGGGGGCATGGGAAGG + Intergenic
1014466574 6:121762825-121762847 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
1015084020 6:129265567-129265589 TGTAATGGGGAGAAATGGGAAGG + Intronic
1015156496 6:130102173-130102195 GGAGATGGGAAGCAATGGAAAGG - Intronic
1015200332 6:130572419-130572441 GGGCATGGGGGGCCAGGGGAGGG + Intergenic
1015282201 6:131445737-131445759 GGTGGTGGGGGGCTAGGGGAGGG + Intergenic
1015686561 6:135869903-135869925 GGAGATGAGCAGGCATGGGAAGG + Intronic
1015922254 6:138278099-138278121 TGTGATAGGGAGCCACCGGAGGG + Intronic
1016120738 6:140339058-140339080 GGGGATGGGGAGCTAGGGGAGGG - Intergenic
1016593697 6:145774950-145774972 GGGGATAGGGAGCAAGGGGAGGG - Intergenic
1016753605 6:147659782-147659804 GGTGATGGGGAGGGGTGGAATGG - Intronic
1017788180 6:157773507-157773529 GGCGATGAGAAGCCATGGAACGG + Intronic
1017818261 6:158030509-158030531 GGGGGTGGGGAGCGTTGGGATGG - Intronic
1018133619 6:160756489-160756511 GGAGATGGGTAGCGAAGGGAGGG - Intergenic
1018224648 6:161616552-161616574 GGTGGTGGGGGGCTAGGGGAGGG - Intronic
1018597421 6:165497266-165497288 GGTGATGGGATGGGATGGGATGG - Intronic
1018764459 6:166922377-166922399 TTTGATGGGGAGCCGGGGGATGG - Intronic
1018803207 6:167239076-167239098 GGGGGTGGGTACCCATGGGAGGG - Intergenic
1018806913 6:167268877-167268899 GGGGGTGGGTACCCATGGGAGGG + Intergenic
1019357630 7:589138-589160 GGGCATGGGGAGTCATGGGTAGG - Intronic
1019709210 7:2510686-2510708 GGCAGTGGGGAGCCAAGGGAGGG + Intergenic
1020022131 7:4875506-4875528 GGCGAGGAGGAGCCCTGGGAAGG - Intronic
1020752862 7:12165023-12165045 GGAGATGGGGGGCTAGGGGAGGG - Intergenic
1021508374 7:21409788-21409810 GGAGGTGGGAAGTCATGGGACGG - Intergenic
1021897909 7:25255032-25255054 GGTGATGGGGAGAAATGAGATGG - Intergenic
1022542382 7:31149703-31149725 GTTGGTGGGGAGCAAGGGGAGGG + Intergenic
1022544731 7:31175450-31175472 GGAGATGGGGAGGCCTGGGGAGG - Intergenic
1023035972 7:36131592-36131614 AGTGAATGGGAGCCATTGGAAGG + Intergenic
1023119017 7:36890806-36890828 CTTGTTGGGGAGCCATTGGAGGG - Intronic
1023200463 7:37692137-37692159 GGGGATGGGGAGCTAGGGGAGGG - Intronic
1023638913 7:42238356-42238378 GGAGATGGGGAGCCAAGGATGGG - Intergenic
1023752703 7:43387153-43387175 GGTGGTGGGGAGAGATGGAAAGG - Intronic
1023990583 7:45126122-45126144 GGTGGTGGGGAGTCCAGGGATGG - Intergenic
1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG + Intronic
1024723718 7:52168673-52168695 GTTGGTGGAGACCCATGGGAAGG + Intergenic
1024742296 7:52367563-52367585 GGGCATGGGGAGCAAGGGGAGGG - Intergenic
1024817621 7:53289196-53289218 AGTGAAGGGGAGTCATTGGAAGG - Intergenic
1024866581 7:53910444-53910466 GGGGACGGGCAGCCATGGGGTGG - Intergenic
1024949905 7:54849838-54849860 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1025246170 7:57319262-57319284 GGTGGTGTGGATCCATTGGAAGG + Intergenic
1026037092 7:66837624-66837646 GGTGCTGGAGAGAGATGGGATGG + Intergenic
1026098938 7:67368884-67368906 GGTGGGTGGGAGCCTTGGGAAGG + Intergenic
1026152622 7:67801070-67801092 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
1026187768 7:68095690-68095712 GGTGGTGGGGAGCAAGGGGAGGG + Intergenic
1026299543 7:69085078-69085100 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1026582735 7:71631734-71631756 GTAGAATGGGAGCCATGGGAGGG + Intronic
1026650220 7:72210058-72210080 GGTGATGGGAAGCCTGGGAAGGG - Intronic
1026873870 7:73869032-73869054 GGAGATGGGGAGCCAGGGAGTGG - Intergenic
1027661854 7:80996944-80996966 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
1027779849 7:82507686-82507708 GTTCATGGGGTGCCATGGGTGGG + Intergenic
1027803614 7:82786731-82786753 GGGGGTGGGGAGCTAGGGGAGGG - Intronic
1027948220 7:84778472-84778494 GGGGATGGGGAGCTAGGGGAGGG + Intergenic
1028041314 7:86058284-86058306 TGTGATGGGGAGGGGTGGGATGG + Intergenic
1028282406 7:88947515-88947537 GGTGGTGGGGGGCTAGGGGAAGG + Intronic
1028386231 7:90256378-90256400 GGGGATGGGGGACTATGGGAAGG + Intronic
1028823875 7:95246164-95246186 GTTCATGGGGACACATGGGAAGG - Intronic
1028827873 7:95294476-95294498 GGGGATGGGGAGCTGGGGGAGGG + Intronic
1028916013 7:96260054-96260076 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
1029615963 7:101657340-101657362 GGAGATGAAGAGCAATGGGAGGG + Intergenic
1029707860 7:102285177-102285199 TGAGATGGGAAGCCATGGGCAGG - Exonic
1030455068 7:109762072-109762094 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1031104027 7:117517198-117517220 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
1031599358 7:123687286-123687308 TATGATGGGAAGCCATTGGAGGG - Intronic
1031605113 7:123759888-123759910 GGTGGTGGGGGGCAAGGGGAGGG - Intergenic
1032382942 7:131503239-131503261 GCTGATGGGGGGCCCCGGGAAGG + Intronic
1032717315 7:134520622-134520644 GGGGCTGGGGAGCTAGGGGAGGG + Intergenic
1032914749 7:136477422-136477444 GGGGATGGGGAGCTGGGGGAGGG - Intergenic
1033430605 7:141285942-141285964 GAGGATGGGGAGCTAGGGGAGGG + Intronic
1033963936 7:146950436-146950458 GGTGGTGGGGGGCAAGGGGAGGG - Intronic
1035105847 7:156441030-156441052 GGTCACGGAGAGCCATGGGAGGG - Intergenic
1035383792 7:158457319-158457341 GATGCTGAGGAGCCCTGGGAGGG - Intronic
1035410601 7:158637599-158637621 GGGGATGTGGAGCCATCGCAGGG - Intronic
1035695957 8:1596013-1596035 GGGGGTGGGGAGCTAGGGGAGGG - Intronic
1037060499 8:14503296-14503318 GGGGATGGGGGGCAAGGGGAGGG + Intronic
1037238680 8:16752157-16752179 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1037617629 8:20533903-20533925 AGTGAAGAAGAGCCATGGGATGG + Intergenic
1037706018 8:21315875-21315897 GGTGATGGTCAGCCCTGGCAAGG - Intergenic
1037777882 8:21847729-21847751 GTTCATGGGCAGCCATGGGCGGG + Intergenic
1037805951 8:22057930-22057952 GGGAATGGGGAGCCCAGGGAAGG + Intronic
1037929408 8:22868931-22868953 AGAAATGGGGAGCCATGGGAAGG - Intronic
1038111429 8:24503876-24503898 GGGGATGGGGAACAAGGGGAGGG + Intronic
1038360575 8:26871814-26871836 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
1038465292 8:27756920-27756942 GGTGATGGGGAGCCCTTTGGAGG - Intronic
1038858927 8:31364555-31364577 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
1039199293 8:35070546-35070568 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1039267689 8:35843636-35843658 GGGGATGGGGGGCAAGGGGAAGG - Intergenic
1039285357 8:36034066-36034088 GGGGATGGGGGGCTAGGGGAGGG + Intergenic
1039623762 8:39026245-39026267 GGAGGTGGGGAGCAAGGGGAGGG - Intronic
1039807941 8:41018440-41018462 GGGGGTGGGGTGCTATGGGAGGG - Intergenic
1039830935 8:41213735-41213757 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1040865831 8:52048141-52048163 GGGGGTGGGGAGCAAGGGGAAGG + Intergenic
1040886073 8:52265359-52265381 TGTGATGGGAAGTTATGGGAGGG + Intronic
1041155524 8:54981676-54981698 GGGGGTGGGGAGCAAAGGGAAGG + Intergenic
1041780605 8:61574886-61574908 CGTGCTGAGAAGCCATGGGAGGG - Intronic
1042253567 8:66780777-66780799 AGTGATGGGAAGCCGTGGAAAGG + Intronic
1042883702 8:73523857-73523879 TGTGATGGGAAGCCACTGGAAGG + Intronic
1043552637 8:81392087-81392109 GGTGATGGGGGGCAAGGGGAGGG + Intergenic
1044327607 8:90877376-90877398 GGCAATGGGAAGCCATGGAAAGG - Intronic
1044801624 8:95963044-95963066 GGAGATGGGGTGAGATGGGATGG + Intergenic
1045156481 8:99479597-99479619 TGTGATGGGGAGGAATGGGAGGG - Intronic
1045234601 8:100339959-100339981 GGGGGTGGGGAGCTAGGGGAGGG - Intronic
1045432575 8:102127187-102127209 GGGGTTGGGGAGCAAGGGGATGG - Intergenic
1045650796 8:104340137-104340159 GGTTATGGGGAGCCCTAGGCTGG + Intronic
1045760799 8:105604465-105604487 TGTGATGGGAAGCCATTGCATGG - Intronic
1045882676 8:107059835-107059857 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1047146300 8:122203053-122203075 GGAGATGGGGGGCTAGGGGAGGG + Intergenic
1047324327 8:123821655-123821677 GGTGGTGGGGGGCTAAGGGAGGG + Intergenic
1047428018 8:124764421-124764443 GCTGATGTGAAGCCTTGGGAAGG + Intergenic
1047616330 8:126565397-126565419 GAAGATGGGGAGCCATGGTAGGG - Intergenic
1047744642 8:127835446-127835468 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1047817737 8:128483304-128483326 GGTGATGGGAAGCCATAGGTAGG + Intergenic
1048049312 8:130802516-130802538 GGCAATGGTGAGCCATTGGAGGG - Intronic
1048161613 8:132026789-132026811 GGGGATGAGGAGCCAGGGGAGGG - Intronic
1048232140 8:132652791-132652813 GGGGTTGGGGAGCTAGGGGAGGG + Intronic
1048304678 8:133275601-133275623 GGTGATATGGAGCCAGGTGATGG - Intronic
1048353623 8:133635568-133635590 AATGATAGGGAGCCATTGGAGGG + Intergenic
1048541086 8:135342773-135342795 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1048674389 8:136761772-136761794 GGAGATGGGGAGCAAGGGGAGGG - Intergenic
1048678285 8:136809775-136809797 GGTGATGAGGCTCCATGAGAGGG + Intergenic
1048729925 8:137427114-137427136 GGGGGTGGGGAGCTAGGGGAAGG - Intergenic
1048926611 8:139277628-139277650 GGTGCTGGGGTGCCCTGGGCAGG + Intergenic
1049320832 8:141995315-141995337 GGTGAGGTGGAGCCATGTGCTGG + Intergenic
1049333403 8:142068130-142068152 GGGGGTGGGGAGCAAAGGGAGGG + Intergenic
1049614724 8:143571115-143571137 GGGGATGGGGGGAGATGGGAGGG - Intronic
1049824003 8:144655250-144655272 GCTGATGGGTGGCCATGGGTGGG - Intergenic
1049982713 9:919619-919641 TGAGATGGGGAGCCATAGCAGGG + Intronic
1050089612 9:2004262-2004284 GGGGAAGGGGAGACATGGGAGGG + Intergenic
1050868064 9:10529568-10529590 GGGGATGGGGGGCAAGGGGAAGG + Intronic
1051529851 9:18089465-18089487 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
1052219451 9:26001793-26001815 GGGGATGGGGAGCAAGGGGAGGG - Intergenic
1052352977 9:27475989-27476011 TGTGATGGGAAGCCATTGTAGGG - Intronic
1052578852 9:30327524-30327546 GATGATGGGGGGAGATGGGATGG - Intergenic
1052657590 9:31382846-31382868 GGGGATGGGGGGCTAGGGGAGGG - Intergenic
1052659653 9:31411730-31411752 GGTGGTGGGGTGCAAAGGGAGGG + Intergenic
1053021787 9:34700216-34700238 TGAGATGGGGAGCTATTGGAAGG + Intergenic
1053028236 9:34749764-34749786 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
1053128187 9:35599570-35599592 GGTCCTGGGCAGCCATGGGTGGG - Intergenic
1053131369 9:35617571-35617593 GGAAACGGGGAGCCATGGGAGGG - Intronic
1053160277 9:35809247-35809269 GGTGATGGCAGGCCATGGGGAGG + Exonic
1053463814 9:38290485-38290507 GGGGATGGGAAACCATGGAAGGG - Intergenic
1054793482 9:69277333-69277355 GGGGTTGGGGAGCAAGGGGAGGG - Intergenic
1055125157 9:72710925-72710947 GGGGATGCGGAGCTAAGGGAGGG - Intronic
1055895472 9:81169722-81169744 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1057226237 9:93294746-93294768 AGTGATTGGGAGCCAGGGGCAGG + Intronic
1057473744 9:95381186-95381208 GCTGAGAGGCAGCCATGGGAAGG - Intergenic
1057703866 9:97384342-97384364 AGTGAGTGGGAGGCATGGGAGGG - Intergenic
1057921358 9:99100599-99100621 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
1057988438 9:99741903-99741925 GATGATGAAGAGCCATGGAAAGG + Intergenic
1058077172 9:100662936-100662958 GGGGATGGGGGGGCAAGGGAAGG - Intergenic
1058179490 9:101779430-101779452 GGAGATGGGATGCCATAGGAGGG + Intergenic
1058183104 9:101821823-101821845 GGGGATGGGCAGCAAGGGGAGGG + Intergenic
1058591625 9:106571442-106571464 GGGGATGGGGAACAAGGGGAGGG + Intergenic
1059059070 9:111015885-111015907 GGCAATGGGGAACCATGGGAAGG - Intronic
1059562950 9:115352923-115352945 GGGGGTGGGGAGCTAGGGGAGGG - Intronic
1060003730 9:119981372-119981394 GCTGATGGGGAGACAGGGCAGGG - Intergenic
1060007541 9:120013923-120013945 GGTAATAGGGAGTCACGGGAAGG + Intergenic
1060032674 9:120228972-120228994 GGCAATAGGGAGCCATGGAAGGG - Intergenic
1060171811 9:121468160-121468182 GGGGATGGGGGGCTAGGGGAGGG - Intergenic
1060316228 9:122513683-122513705 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1060661136 9:125405826-125405848 GACAATGGGGAGCCATGGAAGGG - Intergenic
1060807250 9:126585629-126585651 GGAGATGGGGACCCATGAGGAGG + Intergenic
1061004920 9:127923349-127923371 GATGATGGGGAGATGTGGGATGG + Intronic
1061221574 9:129255111-129255133 GGCAATGGGGAGCCATGGGAGGG - Intergenic
1061225067 9:129276671-129276693 TGTGAAGGGAAGCCAGGGGAAGG - Intergenic
1061228474 9:129296240-129296262 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1061282544 9:129605800-129605822 GGTCCTGGGGAGCCACGGCAGGG + Intergenic
1061301822 9:129709881-129709903 AGTGAAGGGGAGGCATGGGAAGG - Intronic
1061777818 9:132977678-132977700 GAAGGTGGGGAGCCAGGGGATGG + Intronic
1061993811 9:134174001-134174023 GGGGCTGGGGAGCCCTGGGGAGG + Intergenic
1062065305 9:134523585-134523607 GGGGATGGGAGGCGATGGGAGGG - Intergenic
1062065328 9:134523665-134523687 GGTGATGGGAGGGGATGGGAGGG - Intergenic
1062065380 9:134523865-134523887 GGTGATGGGAGGGGATGGGAGGG - Intergenic
1062065608 9:134524705-134524727 GGGGATGGGAGGGCATGGGAGGG - Intergenic
1062478339 9:136740513-136740535 GGGGATGAGGAGGCGTGGGAGGG - Intronic
1062497169 9:136837413-136837435 GGTGACTGGGAGCCCGGGGATGG - Exonic
1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG + Exonic
1185803361 X:3033367-3033389 GGTCTCAGGGAGCCATGGGAAGG - Exonic
1186530500 X:10290505-10290527 GGGGTTGGGGAGGCAGGGGAAGG + Intergenic
1186755936 X:12671585-12671607 GGTGGTGGGGGGCTAGGGGAGGG + Intronic
1186858253 X:13646438-13646460 GTTGATGGGGAGAATTGGGAGGG - Intergenic
1187352717 X:18535822-18535844 GTTGATATGGAGCCATTGGAGGG - Intronic
1187504188 X:19865432-19865454 GGAGGAGGGGAGCCATGTGAAGG + Intronic
1187814316 X:23214576-23214598 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1188156424 X:26748440-26748462 GGTGATGGTGGGCCTGGGGAAGG - Intergenic
1188267276 X:28093118-28093140 TGTGAAGGGAAGCCATGGAATGG + Intergenic
1189301885 X:39958153-39958175 GGAAATGGGGAGCCACGGGAGGG + Intergenic
1189581528 X:42412551-42412573 GGGGATGGGGAGCTAGGGGAGGG - Intergenic
1189584437 X:42443695-42443717 GGAGATAGGGAGCAATGGGATGG - Intergenic
1189958749 X:46305305-46305327 GGGGATGGGGGGCTAGGGGAAGG + Intergenic
1190325321 X:49203826-49203848 AGCAGTGGGGAGCCATGGGAGGG - Intergenic
1190640286 X:52477716-52477738 GGCGATGGGGGTCTATGGGAGGG + Intergenic
1190647386 X:52535149-52535171 GGCGATGGGGGTCTATGGGAGGG - Intergenic
1190876435 X:54463553-54463575 TATGGTGGGTAGCCATGGGAAGG - Intronic
1190920808 X:54850677-54850699 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1191005641 X:55708426-55708448 AGGCATGGGGAGCCAGGGGAGGG + Intergenic
1191103057 X:56753774-56753796 GGTGATGGGGACAGAAGGGAAGG + Intergenic
1191201468 X:57786988-57787010 GGGGATGGTGGGCTATGGGAGGG + Intergenic
1192013683 X:67303677-67303699 GGGGATGGGGGGCCAGGGAAGGG + Intergenic
1192198753 X:69050148-69050170 AGAGATGAGGAGCCATTGGAGGG + Intergenic
1192252925 X:69428308-69428330 CGTGATGGGAAGCCACTGGAAGG - Intergenic
1192456415 X:71280110-71280132 AGTGATGGGGAGCCATTGAAGGG - Intergenic
1192602624 X:72480903-72480925 GGGGGTGGGGAGCCAGGGGAGGG + Intronic
1192723386 X:73723811-73723833 GGGGGTGGGGGGCAATGGGAGGG + Intergenic
1192883033 X:75307989-75308011 GGGCATGGGGAGCAAGGGGAAGG - Intergenic
1193159211 X:78208812-78208834 GGGGGTGGGGGGCTATGGGAGGG + Intergenic
1193417464 X:81241464-81241486 GTCCATGGGGAGCCATGGGTGGG - Intronic
1193712805 X:84899028-84899050 GGTGGTGGGGGGCAAAGGGAGGG - Intergenic
1193963599 X:87955200-87955222 GGGGCTGGGGAGCTAGGGGAGGG + Intergenic
1194330457 X:92578210-92578232 GGGGATGGGGGGCTAGGGGAGGG + Intronic
1194514784 X:94839341-94839363 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1194832483 X:98641006-98641028 GGTGGTGTGGGGCCAGGGGAGGG + Intergenic
1194870112 X:99119518-99119540 GGGGATGGGGGGCTAGGGGAGGG - Intergenic
1195102708 X:101570930-101570952 GGGGTTGGGGAGCTAGGGGAGGG + Intergenic
1195140669 X:101956160-101956182 GGGGATGGGGGGCAACGGGAGGG + Intergenic
1195338858 X:103885065-103885087 GGTGATGGGGAGCTGGGGGAGGG - Intergenic
1195425492 X:104725026-104725048 GGGGTTGGGGAGCTAGGGGAGGG - Intronic
1195740515 X:108060548-108060570 GGATATGGGGAGTCAGGGGAAGG - Intronic
1196039280 X:111184541-111184563 GGGGATGGGGGGCTAGGGGAGGG - Intronic
1196098838 X:111827820-111827842 CATGATAGGGAGCCATGGGAGGG - Intronic
1196232211 X:113237491-113237513 GGAGGTGGGGGGCAATGGGAGGG - Intergenic
1196244087 X:113378276-113378298 GGTGGTGGGGGGCAAGGGGAGGG + Intergenic
1196484537 X:116189991-116190013 GGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1197197999 X:123722568-123722590 GGGGTTGGGGAGCAAGGGGAGGG + Intronic
1198018503 X:132635437-132635459 GTTGATAGGGAGCCATTGGGAGG - Intronic
1198259361 X:134952029-134952051 GGGGGTGGGGAGCTAGGGGAGGG + Intergenic
1198603757 X:138314005-138314027 CCAAATGGGGAGCCATGGGAGGG - Intergenic
1198986365 X:142458835-142458857 GGTGTTGGGGAGGGTTGGGATGG - Intergenic
1199003725 X:142672024-142672046 GGGGCTGGGGAGCAAGGGGAGGG - Intergenic
1199261988 X:145785357-145785379 GTGGGTGGGGAGCTATGGGAGGG + Intergenic
1199330800 X:146555923-146555945 GGGGGTGGGGAGCAAGGGGAAGG + Intergenic
1199482451 X:148312239-148312261 TGAGTTGGGGGGCCATGGGAAGG - Intergenic
1199595078 X:149500630-149500652 GGAGATGCTGAGACATGGGAGGG - Intronic
1199869307 X:151882881-151882903 GGGAATGGGGAGCTATGGGAGGG + Intergenic
1200181246 X:154151855-154151877 GTAGAAGGGGAGCCAAGGGAAGG + Intronic
1200186891 X:154188969-154188991 GTAGAAGGGGAGCCAAGGGAAGG + Intergenic
1200192542 X:154226107-154226129 GTAGAAGGGGAGCCAAGGGAAGG + Intronic
1200198297 X:154263911-154263933 GTAGAAGGGGAGCCAAGGGAAGG + Intronic
1200398205 X:156003536-156003558 GGTGAAGAGGAGCCAGGGGCTGG - Exonic
1200639163 Y:5697280-5697302 GGGGATGGGGGGCTAGGGGAGGG + Intronic
1201405595 Y:13646603-13646625 GGTGGTGGGGGGCTAGGGGAGGG - Intergenic
1201447704 Y:14076437-14076459 GGAGATGGAGACCTATGGGAAGG + Intergenic
1201580670 Y:15508762-15508784 GGAGGTGGGGGGCTATGGGAGGG + Intergenic
1201672412 Y:16538819-16538841 GGGGATGGGGGGCCAAGGGAGGG - Intergenic
1201705551 Y:16932792-16932814 GGGGATGGGGAGCTAGAGGAGGG + Intergenic
1201868173 Y:18677237-18677259 GGTGATGGAGAGCTACAGGAGGG - Intergenic