ID: 925160520

View in Genome Browser
Species Human (GRCh38)
Location 2:1680630-1680652
Sequence GCTTGTGCACACCCAGGCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925160512_925160520 17 Left 925160512 2:1680590-1680612 CCCCTCAAGGCACTAACCGTAGA 0: 1
1: 0
2: 0
3: 6
4: 41
Right 925160520 2:1680630-1680652 GCTTGTGCACACCCAGGCATCGG 0: 1
1: 0
2: 1
3: 13
4: 138
925160516_925160520 1 Left 925160516 2:1680606-1680628 CCGTAGAGGCGTGAGTAGCATAG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 925160520 2:1680630-1680652 GCTTGTGCACACCCAGGCATCGG 0: 1
1: 0
2: 1
3: 13
4: 138
925160514_925160520 15 Left 925160514 2:1680592-1680614 CCTCAAGGCACTAACCGTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 45
Right 925160520 2:1680630-1680652 GCTTGTGCACACCCAGGCATCGG 0: 1
1: 0
2: 1
3: 13
4: 138
925160513_925160520 16 Left 925160513 2:1680591-1680613 CCCTCAAGGCACTAACCGTAGAG 0: 1
1: 0
2: 0
3: 7
4: 50
Right 925160520 2:1680630-1680652 GCTTGTGCACACCCAGGCATCGG 0: 1
1: 0
2: 1
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925160520 Original CRISPR GCTTGTGCACACCCAGGCAT CGG Intronic
900294968 1:1944180-1944202 GCGTGTGCACAGGCAGGCAGCGG + Intronic
900294986 1:1944256-1944278 GCGTGTGCACAGGCAGGCAGCGG + Intronic
901229243 1:7632843-7632865 GATTGCGCACGCCCAGGCGTGGG + Intronic
902290495 1:15431794-15431816 TCTTGTGCAGACCCAGGCTGGGG - Intergenic
903092089 1:20929894-20929916 GCCTGTGCCTACACAGGCATAGG - Intronic
903144379 1:21361312-21361334 GCTTCTCCACAGCCAGGCCTTGG - Intergenic
910046437 1:82923304-82923326 GCTTGTGGATATCCAGGCATGGG + Intergenic
910238481 1:85060915-85060937 GCTTGTCCACTCCCAGGAAGTGG - Intronic
914674859 1:149900431-149900453 TCTTGTTCCCACCCAGGCATGGG - Exonic
919982511 1:202651058-202651080 GCTTCTGCCCACACAGGCAACGG + Intronic
921398656 1:214695393-214695415 GGATGTCCACACCCAGGCAGTGG - Intergenic
923387170 1:233476696-233476718 CCTTGTTCAATCCCAGGCATAGG + Intergenic
1063639568 10:7816636-7816658 GCTTCTGCACACTATGGCATTGG + Intergenic
1065234194 10:23630946-23630968 GCTTGTGCACAGCCCTGCACAGG - Intergenic
1068971464 10:62962653-62962675 GATGGTTCACACCCATGCATTGG + Intergenic
1069291491 10:66785931-66785953 GCTTGTGCAAAGCAAGGGATAGG + Intronic
1075522747 10:123153921-123153943 GCGTGTGCACGCCCAGGGATAGG + Intergenic
1077266244 11:1652100-1652122 GCCTGGGCTCCCCCAGGCATGGG + Intergenic
1080554863 11:33406829-33406851 GCTTTCGCACACCCAGGTGTCGG + Intergenic
1080636675 11:34130602-34130624 GCTTGGGGCCACCCAGGCCTGGG - Intronic
1085388165 11:76168991-76169013 GCTTGGACACTCCCAGGGATCGG + Intergenic
1087273308 11:96134987-96135009 GCTAGTGCAATACCAGGCATTGG - Intronic
1089759326 11:120711474-120711496 GCTGAGGCACACCCTGGCATGGG + Intronic
1089848069 11:121474047-121474069 GCCTGTGCTCAGCCAGACATCGG - Intronic
1091218356 11:133917186-133917208 GCCTGGGCACACACAGGCATCGG - Intronic
1102551615 12:113695745-113695767 GGGTGTAAACACCCAGGCATCGG + Intergenic
1102924302 12:116815166-116815188 GCCAGAGCACACCCAGGCCTGGG - Intronic
1104398472 12:128455720-128455742 GGTTGTGCACTCCCAGCCCTAGG + Intronic
1104974946 12:132548171-132548193 GCTTGTGGCCTCCCAGGTATGGG + Intronic
1105940094 13:25140364-25140386 CCCTTTGCACACCAAGGCATGGG + Intergenic
1110784890 13:79512255-79512277 GCTTGTGAAAACCAAAGCATTGG + Intronic
1113650187 13:112028887-112028909 GCTTCTGCACACAGAGGCAAAGG - Intergenic
1113742962 13:112724066-112724088 GCTGGTCCACACCCAGGCAGTGG - Intronic
1118905983 14:70023483-70023505 ACTTGCCCCCACCCAGGCATGGG + Intronic
1120543882 14:85785457-85785479 ACATGTGAACACCAAGGCATGGG - Intergenic
1121026476 14:90620143-90620165 GCTTCTGCAAGCCCAGGCATGGG - Intronic
1122842874 14:104475345-104475367 GCGTGTGCACATCGAGGCCTGGG + Intronic
1124441473 15:29689076-29689098 GCGCGTGCACACCCAAGCCTCGG - Intergenic
1126015701 15:44348334-44348356 TCTTGTGAACACTCAGGCCTGGG - Intronic
1126858194 15:52859191-52859213 CCCTGTGGTCACCCAGGCATGGG + Intergenic
1128385422 15:67144830-67144852 GGTTTTTCACAGCCAGGCATGGG + Intronic
1131365320 15:91834210-91834232 GGTTGTGGGAACCCAGGCATGGG + Intergenic
1132796598 16:1726863-1726885 GCTTGTGCTGACCCCGGCAACGG - Intronic
1133511080 16:6457971-6457993 GCGTGTGCACACACATACATAGG + Intronic
1133578443 16:7117895-7117917 GCTTCTGCACATCCAGAAATGGG + Intronic
1143344555 17:6240277-6240299 TCTTGTGCATGCCCAGGCTTGGG - Intergenic
1146904333 17:36608494-36608516 CCTGGTGCACACTCAGGCAGAGG - Exonic
1151038062 17:70823843-70823865 GCTTGTGCCCACCCAGGTTAAGG + Intergenic
1152101113 17:78302226-78302248 GCGTGTGCACACGCTAGCATAGG + Intergenic
1152597536 17:81245246-81245268 GCTGGTGCACTCCCAGGCTCAGG - Exonic
1153275523 18:3363696-3363718 GCTTGTGCATACACGGGCAATGG + Intergenic
1153631634 18:7075995-7076017 ACTTCTGCACACCCAGACATTGG - Intronic
1153998521 18:10463145-10463167 GCTTGAGCACACTCAAGCATGGG - Intronic
1156520364 18:37717187-37717209 GCTTCTGCTCACCCATGCAAAGG + Intergenic
1157800932 18:50620531-50620553 GCTTATACTCACCCAGGGATGGG + Intronic
1160749099 19:725664-725686 GCTTTTGCAAGCCCAGGCTTGGG + Intronic
1161003289 19:1921957-1921979 GCTTATGCACACACATGCACGGG - Intronic
1161793591 19:6374518-6374540 GCTGGTGCACACCCAGGAGCCGG + Exonic
1162214979 19:9126686-9126708 GCTGGTGAACATCCAGGCACAGG - Exonic
1163561382 19:18021462-18021484 GTTTGTGCATACCCTGGCGTGGG - Intergenic
1163822699 19:19505366-19505388 TCTTGTGCACCGCCAGGCTTGGG - Exonic
1165340981 19:35212027-35212049 CCGTGGGCACACCCAGGCAGAGG + Intergenic
1166817789 19:45557272-45557294 GCGTGTGTGCACGCAGGCATGGG + Intronic
1167035828 19:46994494-46994516 GCTTGACCACACCCAGGCCCAGG + Intronic
925067386 2:938988-939010 CCATGTGCACACGCATGCATGGG + Intergenic
925160520 2:1680630-1680652 GCTTGTGCACACCCAGGCATCGG + Intronic
925200246 2:1961514-1961536 TCTTATGCACAGCCAGGCAAAGG - Intronic
925576933 2:5369768-5369790 GCATCTGCACACCCATACATTGG - Intergenic
926161499 2:10493274-10493296 GATTGTTCACACACAGGCTTTGG + Intergenic
926488749 2:13497501-13497523 GCATGTGCACACGCAAGTATCGG + Intergenic
933240719 2:79917726-79917748 GCTGGTGCTGACCCAGGCACAGG + Intronic
936342482 2:111646812-111646834 CCATGTGGAAACCCAGGCATTGG + Intergenic
937205983 2:120237491-120237513 GCGTGTGCACACGCACACATGGG + Intergenic
937644158 2:124247350-124247372 GGTTCTGCACACCCAGAAATGGG - Intronic
937781431 2:125843171-125843193 CCTGGTGCTCACACAGGCATGGG - Intergenic
939417496 2:141918795-141918817 GCTTGTGGTCACTGAGGCATGGG - Intronic
941926148 2:170897107-170897129 GTTTGTGCACACGTAGGCAATGG - Intergenic
948260866 2:236603702-236603724 GCTTGTGTAAACCCAGGGCTGGG - Intergenic
1172355744 20:34278401-34278423 GCATGCGCACACACAGGCAGCGG + Intergenic
1174181886 20:48680109-48680131 GCTTGTCCCCACCCATCCATTGG - Intronic
1174321757 20:49747629-49747651 GCTAGTGTCCACACAGGCATGGG + Intergenic
1174670581 20:52304130-52304152 CATTTTGCACCCCCAGGCATTGG - Intergenic
1178297456 21:31422389-31422411 GCTTATGCACACCAATGCTTCGG - Intronic
1182735986 22:32532622-32532644 GGGTGTTCACACCCAGGCCTTGG - Intronic
1183508276 22:38221134-38221156 GCTGGTCCACACACAAGCATTGG + Exonic
1183933605 22:41249585-41249607 GCTGGGGCAGACCCAGGCCTCGG + Intronic
1184127035 22:42494780-42494802 GCGTGCGCACACACATGCATAGG + Intergenic
1184241815 22:43214994-43215016 ACACGTGCACACACAGGCATGGG - Intronic
1184414094 22:44342143-44342165 GCTGGTGCCCACACAGGCTTGGG - Intergenic
1184483364 22:44761112-44761134 GTTTGAGCAAATCCAGGCATGGG + Intronic
1185063213 22:48617836-48617858 GCTTGTGCACCTCCAGGCAGGGG - Intronic
1185273053 22:49937388-49937410 TGCTGTGCACACCCAGGCAGCGG - Intergenic
952189037 3:31002578-31002600 TATGGTGTACACCCAGGCATTGG - Intergenic
952740375 3:36728683-36728705 GCTTGTGGACAGCCAGTCATGGG + Intronic
952741953 3:36742508-36742530 GCTTGTGAATGCCCAGGCAGTGG - Intergenic
953185908 3:40638246-40638268 CCCTGTGCACACCCAGCCAGTGG + Intergenic
954191036 3:48961177-48961199 GTTTATGCAAACCCAGGCCTGGG + Intronic
954264161 3:49460316-49460338 GCTTGTGCACACCCAGCCCTTGG + Intergenic
954378307 3:50206156-50206178 GTTTGTTTACACCCAGGCAGGGG + Intronic
954727341 3:52624469-52624491 GCATGTGGACACCTATGCATTGG - Intronic
962887417 3:139640249-139640271 GCTTTTGCCCACTCAGGCACAGG - Intronic
967773349 3:193358780-193358802 CCTTGAGCATTCCCAGGCATAGG + Intronic
967845675 3:194040836-194040858 GCTTCTCCACATCCAGGCACAGG - Intergenic
978407468 4:108395347-108395369 GATTGTGCACCCCCAAGGATGGG - Intergenic
979116368 4:116829537-116829559 GCTTGGGCACTCCAATGCATGGG - Intergenic
981050364 4:140303726-140303748 GCCTGTGCAAATCCAGGTATAGG + Intronic
981484966 4:145276314-145276336 GCTTGTGAACACCGAGGCAGTGG + Intergenic
985053071 4:186012238-186012260 GTGTGTGCACACACACGCATAGG + Intergenic
985680859 5:1254910-1254932 CCTTGTGCAAACCCAGGCCAAGG - Intronic
997372676 5:133371888-133371910 GCTTGTCCACTCCCAGGGACGGG + Intronic
1001491876 5:172161829-172161851 GAGTGTGCACACCTGGGCATGGG - Intronic
1002901539 6:1414144-1414166 GCTTGTGCAGACAGATGCATAGG - Intergenic
1006796020 6:36732846-36732868 GCTTGGGGACACCATGGCATTGG - Exonic
1011884616 6:92078610-92078632 GATTCTGCCCAGCCAGGCATGGG - Intergenic
1013300418 6:108799932-108799954 TGTTGAGCACAGCCAGGCATAGG + Intergenic
1013981459 6:116134583-116134605 GCTTGTGGATGCCCAGGGATAGG + Intronic
1014788135 6:125641203-125641225 GCTGGTGCACACCCGGCCAAAGG - Intergenic
1017970265 6:159306287-159306309 GAATGTGGACACCCAGGGATGGG + Intergenic
1018768724 6:166954511-166954533 GCTAGTTCACACCCAGGTGTGGG - Intronic
1018987714 6:168650159-168650181 ACTTGTCCACACCACGGCATTGG - Intronic
1019228331 6:170534119-170534141 GCTTGCAGACAGCCAGGCATGGG + Intergenic
1019778607 7:2926840-2926862 GTGTGTGCACACGCAGGCAAGGG + Intronic
1021903333 7:25309628-25309650 GCTTGTACACAGTCAGTCATGGG - Intergenic
1024761942 7:52609366-52609388 CAGTGTGCACACCGAGGCATTGG - Intergenic
1032119073 7:129143598-129143620 GCTTTTGCACCTCCAGGCTTTGG + Intergenic
1034491048 7:151393285-151393307 CTGTGTGCACACACAGGCATAGG - Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035577197 8:715472-715494 GCTTGTGCCCACTCAGGGACAGG - Intronic
1038156438 8:24995699-24995721 GCATGCGCACACACAGGCAGGGG - Intergenic
1046827873 8:118711697-118711719 GTTTTTGCACAATCAGGCATGGG + Intergenic
1048910461 8:139129987-139130009 GCTTGTAGACAGCCTGGCATGGG - Intergenic
1049063084 8:140291570-140291592 GGTTGTGCACACCAAGGCTGGGG - Intronic
1049476471 8:142799323-142799345 GCAGGCGCACATCCAGGCATGGG - Intergenic
1049534281 8:143170953-143170975 GCTTGTGCATAACCTGGGATGGG + Intergenic
1050451574 9:5787162-5787184 GTAGGTGCACACCCAGGCAGAGG + Exonic
1051269758 9:15344065-15344087 GCTTGCTCATTCCCAGGCATAGG + Intergenic
1053172857 9:35903305-35903327 GCGTGTGCACACACAGTTATTGG + Intergenic
1055981821 9:82011327-82011349 GTATGTGCAGACCCAGGCAAGGG + Intergenic
1057339011 9:94182700-94182722 CCCTGTGCACACTCCGGCATGGG + Intergenic
1059735616 9:117096872-117096894 GCTTGAGCACCCTCAGGAATGGG + Intronic
1060421605 9:123473135-123473157 GCTTGCTCTGACCCAGGCATGGG - Intronic
1061894749 9:133641402-133641424 GGCTGAGCACACACAGGCATTGG - Intronic
1062031214 9:134362866-134362888 GCTGGTGCAGACCCGGGCATGGG - Intronic
1062130571 9:134890711-134890733 GCTTGTTCATTCCTAGGCATAGG + Intergenic
1062232041 9:135487170-135487192 GCGTGTGCACACGCAGCCAGAGG + Exonic
1062313395 9:135952252-135952274 GCTTATGCACTACCAGGCATGGG + Intronic
1186453034 X:9689069-9689091 ACTTGTGCACACACACGCACAGG - Intronic
1190478763 X:50853587-50853609 TCTTGTGCAAACACAGGCAGTGG + Intergenic
1199087342 X:143642889-143642911 GCTTGAATACACCCAGTCATGGG + Intergenic
1199414192 X:147560677-147560699 GATTGTGCCCACCCAGACTTAGG + Intergenic
1200973741 Y:9184320-9184342 GCATGTTCACACTCATGCATGGG + Intergenic
1201632525 Y:16084817-16084839 CCTTGTTCATTCCCAGGCATAGG - Intergenic
1202137376 Y:21680474-21680496 GCATGTTCACACTCATGCATGGG - Intergenic