ID: 925162780

View in Genome Browser
Species Human (GRCh38)
Location 2:1697721-1697743
Sequence ACGTCTCCCCAGGGGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 143}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925162765_925162780 16 Left 925162765 2:1697682-1697704 CCCTGGGGCTCCGTGCTCCCACC 0: 1
1: 0
2: 0
3: 30
4: 248
Right 925162780 2:1697721-1697743 ACGTCTCCCCAGGGGGCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 143
925162771_925162780 -6 Left 925162771 2:1697704-1697726 CCCGTCCTCCTGCAGTGACGTCT 0: 1
1: 0
2: 2
3: 11
4: 173
Right 925162780 2:1697721-1697743 ACGTCTCCCCAGGGGGCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 143
925162772_925162780 -7 Left 925162772 2:1697705-1697727 CCGTCCTCCTGCAGTGACGTCTC 0: 1
1: 0
2: 1
3: 41
4: 444
Right 925162780 2:1697721-1697743 ACGTCTCCCCAGGGGGCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 143
925162768_925162780 -1 Left 925162768 2:1697699-1697721 CCCACCCCGTCCTCCTGCAGTGA 0: 1
1: 0
2: 2
3: 29
4: 582
Right 925162780 2:1697721-1697743 ACGTCTCCCCAGGGGGCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 143
925162770_925162780 -5 Left 925162770 2:1697703-1697725 CCCCGTCCTCCTGCAGTGACGTC 0: 1
1: 0
2: 1
3: 15
4: 137
Right 925162780 2:1697721-1697743 ACGTCTCCCCAGGGGGCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 143
925162767_925162780 6 Left 925162767 2:1697692-1697714 CCGTGCTCCCACCCCGTCCTCCT 0: 2
1: 0
2: 10
3: 162
4: 2381
Right 925162780 2:1697721-1697743 ACGTCTCCCCAGGGGGCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 143
925162766_925162780 15 Left 925162766 2:1697683-1697705 CCTGGGGCTCCGTGCTCCCACCC 0: 1
1: 0
2: 0
3: 49
4: 405
Right 925162780 2:1697721-1697743 ACGTCTCCCCAGGGGGCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 143
925162769_925162780 -2 Left 925162769 2:1697700-1697722 CCACCCCGTCCTCCTGCAGTGAC 0: 1
1: 0
2: 3
3: 27
4: 353
Right 925162780 2:1697721-1697743 ACGTCTCCCCAGGGGGCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 143
925162764_925162780 27 Left 925162764 2:1697671-1697693 CCTTGGCTCTTCCCTGGGGCTCC 0: 1
1: 0
2: 14
3: 51
4: 613
Right 925162780 2:1697721-1697743 ACGTCTCCCCAGGGGGCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925162780 Original CRISPR ACGTCTCCCCAGGGGGCTGA GGG Intronic
900195622 1:1374267-1374289 CCAGCTCTCCAGGGGGCTGACGG + Exonic
900543999 1:3218399-3218421 AGGTATCCCCAGGGGGCAGCCGG + Intronic
900576888 1:3387474-3387496 AGGTCTCACAAGGGGGTTGAGGG - Intronic
901297280 1:8170282-8170304 CTGTCTCCCCAGGAGGCTAATGG - Intergenic
902544858 1:17183879-17183901 ACTTCTCCCCAGGGAGTTCAGGG + Intergenic
905183586 1:36180655-36180677 AGATCTCCCCAGGGGGCTTTGGG - Exonic
915690166 1:157680955-157680977 AGGACTCCCTAGGGGGCAGAAGG - Intronic
918642566 1:186861107-186861129 TAGTGTCCCCAGGGGCCTGACGG - Intronic
919760545 1:201095342-201095364 ACGCCTCCGCAGTGTGCTGATGG - Intronic
921177230 1:212606189-212606211 ACGGTTCTCCTGGGGGCTGAGGG + Intronic
1062888626 10:1038751-1038773 ACGTGTCCCCAGGGAGCAGGTGG + Intergenic
1062888643 10:1038814-1038836 ACGTGTCCCCAGGGAGCAGGTGG + Intergenic
1062888660 10:1038877-1038899 ACGTGTCCCCAGGGAGCAGGTGG + Intergenic
1062888745 10:1039192-1039214 ACGTGTCCCCAGGGAGCAGGTGG + Intergenic
1063103281 10:2970215-2970237 AAGGCTCCCAAGGGGGCCGATGG + Intergenic
1064261264 10:13788264-13788286 ACGTGTCCCTAGGGTGGTGAGGG - Intronic
1066956685 10:42179454-42179476 ACTTCTCCCCGGATGGCTGAGGG + Intergenic
1067034335 10:42901487-42901509 CCATCTCCCCAGGGGGCATAAGG - Intergenic
1075847378 10:125555684-125555706 ACGGTCCCCCAGGGTGCTGATGG + Intergenic
1076672706 10:132131848-132131870 ACTTCTTCCCATGGGGCTGTGGG - Intronic
1076886172 10:133263616-133263638 CGGCCTCCCCACGGGGCTGACGG - Intronic
1077410112 11:2399974-2399996 ACGTCCCCCTAGGGCGCTGCAGG - Intergenic
1078432934 11:11301668-11301690 ACTTCTCCCCAAAGAGCTGAGGG - Intronic
1080137060 11:28867332-28867354 ACAACTACTCAGGGGGCTGAGGG + Intergenic
1082928249 11:58574124-58574146 ACGTCTCCACAGGCTGTTGATGG - Intronic
1084216655 11:67650585-67650607 ACGTGGCCCCAGAGGGTTGAGGG + Exonic
1088834961 11:113569804-113569826 ACCTCTTCCCAGGGGGTTGGGGG - Intergenic
1089979932 11:122763854-122763876 CCTTCTCCCCATGAGGCTGAGGG - Intronic
1091216742 11:133906911-133906933 GCGTCTCTCCTGGGGGATGACGG - Intergenic
1091339167 11:134796886-134796908 AAGTCTCTCCACGGGGCTGTGGG + Intergenic
1091646241 12:2274396-2274418 ACGTCTCTCCATGGGGCAAAAGG - Intronic
1093573365 12:20695337-20695359 ACAACTCCGCAGGGGGCAGAGGG - Intronic
1094216575 12:27948845-27948867 TCGTCTCCCCAGCTGGTTGAAGG - Intergenic
1096824031 12:54260376-54260398 CCAGCTCCTCAGGGGGCTGAGGG + Intronic
1104108982 12:125688335-125688357 ACCTCTCCCCAGGGGGTTCTGGG + Intergenic
1104140793 12:125984179-125984201 ACTGATCCCAAGGGGGCTGAGGG - Intergenic
1104935381 12:132361501-132361523 AGGTCTCCCCGTGGGGCGGAGGG - Intergenic
1110519842 13:76462573-76462595 ATGTGTCCCCTGGGAGCTGAGGG - Intergenic
1115854192 14:37611624-37611646 ACGACGCCCCACGGGGCTGTGGG + Intronic
1118843639 14:69529862-69529884 ACCACCCTCCAGGGGGCTGAAGG + Exonic
1121527392 14:94628536-94628558 CCGCCTCCCCTGGGGGCTGAGGG + Intergenic
1121628369 14:95404068-95404090 ACTTATCACCAGGGGGATGATGG - Intergenic
1121704837 14:95983772-95983794 TCCTCTCTTCAGGGGGCTGATGG + Intergenic
1122337694 14:101004712-101004734 ACCTATACCCAGGGAGCTGAAGG - Intergenic
1122602237 14:102927696-102927718 ACTTCTCCCTCAGGGGCTGAGGG - Intronic
1122901935 14:104785604-104785626 CCGTTTTCCCAGGGAGCTGATGG - Intronic
1123906301 15:24924811-24924833 ACATTTCCCAAGAGGGCTGAAGG - Intronic
1124120263 15:26882916-26882938 ACTGCTCCCCAGGGAGCAGAAGG + Intronic
1125482223 15:40088742-40088764 CCTACTCCCCTGGGGGCTGAGGG + Exonic
1125608832 15:40957520-40957542 ACTTGTACCCAGGGGGCTGAAGG - Intergenic
1132810191 16:1793563-1793585 GCCTCTCCCCAGCGGGCTCAGGG + Intronic
1133322575 16:4923424-4923446 ACGTCTCTCCTGGGGGCAGGAGG - Intronic
1138380885 16:56601549-56601571 CCTTCTCCCCAGGAGGCTGTGGG - Intergenic
1138597047 16:58034692-58034714 TCTTCACCCCAGGTGGCTGAGGG + Intronic
1138823479 16:60289779-60289801 AGGTCTTCCCAGAGGGCTGCAGG - Intergenic
1139530317 16:67539467-67539489 AGCTCTCCCCAGGCGGCTGCAGG + Intronic
1141665605 16:85463673-85463695 AGTTCTCCCCAGAGAGCTGATGG - Intergenic
1141762029 16:86034869-86034891 CTGTCTCCCCATGGAGCTGAAGG + Intergenic
1143659361 17:8315246-8315268 GCGCCTCTCCTGGGGGCTGAGGG - Exonic
1147137467 17:38442508-38442530 ACATCTCCCCACAGGGCTGTAGG - Intronic
1147759407 17:42787839-42787861 GCACCCCCCCAGGGGGCTGAAGG - Exonic
1147811297 17:43171544-43171566 ACGACTCCCCAGTGGAATGAGGG + Intronic
1160711999 19:556405-556427 CCATCTCCTCAGGAGGCTGAGGG - Intergenic
1161562559 19:4981571-4981593 ACGTCCCCCCAGGAGGTTAAAGG + Intronic
1161775634 19:6260627-6260649 ACCAGTCCCCAGGTGGCTGAAGG + Intronic
1162454745 19:10776570-10776592 ACTGCTCCCACGGGGGCTGAGGG - Intronic
1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG + Exonic
1166965811 19:46528855-46528877 GGGTCTCCCTAGGGGGTTGATGG - Intronic
1167149919 19:47702479-47702501 TCGAGTCCCCAGGAGGCTGAGGG - Exonic
1167661129 19:50796709-50796731 ATTTCTTCCCAGGGTGCTGAGGG + Intergenic
1168137509 19:54361148-54361170 ATGGCTCCCCAGGGGGATCACGG + Exonic
925162780 2:1697721-1697743 ACGTCTCCCCAGGGGGCTGAGGG + Intronic
927847491 2:26479157-26479179 TGGTCTGCCCAGGGGGCTGCAGG - Intronic
930182673 2:48379679-48379701 CCATCTACCCAGGAGGCTGAGGG + Intergenic
931187611 2:59968687-59968709 AGGTCTCCCCAGAGGGTTGTAGG + Intergenic
932883061 2:75522354-75522376 ACCTCTCCCCAGGTAGCTAAAGG - Exonic
935181116 2:100691991-100692013 TTGTCTCCCCAAGGGGCTGTGGG - Intergenic
935264348 2:101381876-101381898 AAGTCTTCCCAAGGGACTGAAGG + Intronic
935940102 2:108229110-108229132 GCTTCTTCCCAGGAGGCTGATGG + Intergenic
938953997 2:136281992-136282014 GCTGCTGCCCAGGGGGCTGAGGG + Intergenic
941002666 2:160218343-160218365 ACATCTAGCCAGGGGTCTGATGG - Intronic
945791559 2:214311252-214311274 ACAGCTCCCCAGGGACCTGATGG + Intronic
948274049 2:236694808-236694830 ATGTCCCCACAGAGGGCTGAGGG - Intergenic
1169237127 20:3939240-3939262 CCAGCTCCTCAGGGGGCTGAGGG - Intronic
1170459611 20:16564922-16564944 ACGCCTGACCAGGGGGCTCAAGG - Intronic
1171446364 20:25207281-25207303 AGCTGTCCCCAGGGGGCTGTGGG - Exonic
1175203686 20:57294873-57294895 AGGTGTCCTGAGGGGGCTGATGG - Intergenic
1175781613 20:61685794-61685816 AGGTTTCTGCAGGGGGCTGAGGG - Intronic
1175922760 20:62457841-62457863 ACATCTTTCCAGGGCGCTGATGG + Intergenic
1178690354 21:34745086-34745108 CCTCCTCCCCAGGGGGCTGTTGG - Intergenic
1180748608 22:18109916-18109938 ACTTCCCCCCAGGTGGGTGAGGG - Intronic
1180847529 22:18992112-18992134 ACTGCCCCACAGGGGGCTGAAGG - Intergenic
1181558814 22:23687893-23687915 AGGTCTTCCCAAGGTGCTGAAGG + Intergenic
1182395941 22:30036016-30036038 CAGTCTCCCCAGGTGCCTGAAGG - Intergenic
1182559781 22:31150522-31150544 ATGTCAGCCCAGGGGGCTGACGG + Intergenic
949763628 3:7500673-7500695 ACATCTGCCCAAGGGGCTGAGGG - Intronic
953241328 3:41151813-41151835 ATGCCTCCCCAGGGGCCTGTTGG - Intergenic
953978680 3:47402029-47402051 TCCTCTCTGCAGGGGGCTGAGGG + Intronic
956906140 3:73767232-73767254 ACGTGTCCACGGGGGGCTGGAGG + Intergenic
961222830 3:125213156-125213178 ACATCTGCCCAGGGGGCTGCGGG - Intergenic
969329368 4:6464338-6464360 AGGACTCCCCAGGGTGCTGAGGG + Intronic
980070955 4:128242618-128242640 ACCTCACCCCAGAGGGCTCATGG + Intergenic
981659182 4:147146207-147146229 CCGTCTCCAAAGGGAGCTGAGGG - Intergenic
982214049 4:153065005-153065027 ACGGCTCCACGGGAGGCTGAAGG - Intergenic
985355651 4:189116495-189116517 ACGGCTTCCCTGGGGACTGAGGG - Intergenic
986348931 5:6859096-6859118 ACCTGTCCACAGGGGACTGAAGG - Intergenic
987383337 5:17306591-17306613 CCAGCTCTCCAGGGGGCTGATGG - Intergenic
988307814 5:29516110-29516132 CCAGCTCTCCAGGGGGCTGACGG - Intergenic
992672683 5:79075735-79075757 ACATCTCCCCAGGTGCCTGCAGG - Intronic
997689946 5:135821620-135821642 ACATCTCCCCAGGAGACTCAGGG - Intergenic
999776742 5:154817991-154818013 ACTTTTCCACAGGGGGGTGAAGG + Intergenic
1000281878 5:159789221-159789243 AGGTCTCCCCAGGGGTGTAAGGG + Intergenic
1001879090 5:175227529-175227551 ACTTCTTCCCAGGGAACTGAGGG - Intergenic
1002100764 5:176856478-176856500 AGGTCTCACCAGGATGCTGATGG - Intronic
1002322439 5:178383727-178383749 ACCTCACCCCAGGGGGCTCCCGG - Intronic
1006419577 6:33924807-33924829 AGTCCTCCCCAGAGGGCTGAGGG + Intergenic
1007273659 6:40657765-40657787 AGGGCTCTCCAGGGGGCTGTGGG - Intergenic
1013491003 6:110646381-110646403 ACTTCTGCCCATGGGGCTGCTGG + Intronic
1015880432 6:137866360-137866382 AGTTCACCCCAGGGTGCTGATGG - Intergenic
1017484192 6:154888004-154888026 CCGTCTGTCCAGGGTGCTGATGG + Intronic
1019426600 7:980407-980429 ACGTCTCTGCAGGGCGCTGGAGG + Intergenic
1019546631 7:1580652-1580674 CCGTCTCCCCAGAGGACTGCGGG - Intergenic
1019599398 7:1873775-1873797 ACGTCTCCCCACTGGGCTTCAGG - Intronic
1022527672 7:31049014-31049036 ATGGCTGCCCAGGAGGCTGAGGG + Intergenic
1023349775 7:39308900-39308922 ACGTCAGCCCAGGGTTCTGATGG + Intronic
1024056705 7:45664085-45664107 AGGCCTCCCCTGGGGGCTGGTGG + Intronic
1026036012 7:66831138-66831160 CCGTCTCCCCAGGGAGCAAAGGG - Intergenic
1029012135 7:97273188-97273210 TCTTCTCCCCAGGGGGCCAAGGG + Intergenic
1032973837 7:137198370-137198392 ACCTCTCCCCAGATGTCTGACGG - Intergenic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035097148 7:156364990-156365012 ACGTGGCCCCAGGGGACGGATGG - Intergenic
1036504748 8:9345097-9345119 AGGTCTCCCCAGTGGGCAGAAGG + Intergenic
1036930935 8:12954939-12954961 ACACCTCCCCAGGTGGCTGTGGG + Intronic
1038421088 8:27434411-27434433 ACTTCTCCACAGGGGGCAGGAGG + Intronic
1040643588 8:49370857-49370879 ACGTCTCCACAGGCTGCTGTGGG - Intergenic
1047785859 8:128153376-128153398 CTGTCTCCCCAGCCGGCTGACGG + Intergenic
1048904477 8:139074693-139074715 TTGTCACCACAGGGGGCTGAAGG + Intergenic
1049070062 8:140349286-140349308 AGGGCACACCAGGGGGCTGAAGG + Intronic
1055612579 9:78038226-78038248 CCAACTCCCCAGGAGGCTGAGGG + Intergenic
1057036859 9:91817543-91817565 ACGTCTCCTCCGGGGAGTGAAGG + Intronic
1057850031 9:98558329-98558351 CCGTATCACCAGTGGGCTGATGG + Intronic
1058835537 9:108855964-108855986 ATTTCTCCCCAGGGGGCTCTAGG - Exonic
1060037231 9:120265947-120265969 CCGTTTCCCCAGGCAGCTGAGGG - Intergenic
1060374300 9:123105007-123105029 ACGTCTCAACAGGTGGGTGAGGG - Intergenic
1060511641 9:124239027-124239049 ACGTCTGCTCAGGTGGCTGCTGG + Intergenic
1062274974 9:135726265-135726287 GAGTCTCCCCCGGGGGCTGCTGG - Intronic
1062533044 9:137010114-137010136 CCGTGTCCCCAGCGTGCTGAAGG - Exonic
1185527237 X:789417-789439 ACGGCTTCCCGGGGGACTGAGGG + Intergenic
1187757902 X:22546676-22546698 AAGTTTCCCCAGGTGGCTGGGGG - Intergenic
1189529354 X:41863404-41863426 ACCCCTCCCCAAGGGGCTGCTGG + Intronic
1197774584 X:130110905-130110927 ACGTCCCCGCAGGCGGCGGATGG + Intergenic