ID: 925163181

View in Genome Browser
Species Human (GRCh38)
Location 2:1701122-1701144
Sequence AAACCACATGGCCTGGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925163181_925163188 27 Left 925163181 2:1701122-1701144 CCCAAAGCCAGGCCATGTGGTTT 0: 1
1: 0
2: 0
3: 20
4: 215
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925163181 Original CRISPR AAACCACATGGCCTGGCTTT GGG (reversed) Intronic
900587640 1:3440817-3440839 ATACCACATGCACTGGATTTGGG + Intergenic
901202695 1:7475695-7475717 AAACTTCAAGGCCTGGCTTTTGG + Intronic
901722292 1:11209204-11209226 AAAACACCTGGGCTGGTTTTCGG + Intronic
902805736 1:18860274-18860296 AAACCACATGGTCTGACTCCGGG + Intronic
902952268 1:19894814-19894836 AAACCACATGCTCAGTCTTTAGG - Intronic
903744322 1:25576591-25576613 AAAGCAGAGCGCCTGGCTTTGGG + Intergenic
904376193 1:30083934-30083956 AAGCCTCCAGGCCTGGCTTTGGG + Intergenic
904448310 1:30593743-30593765 AAACCTCATGGCATTGGTTTTGG + Intergenic
904655330 1:32041517-32041539 GAACCACATTGTCTGGCTTCTGG + Intronic
905571109 1:39006456-39006478 AAACCACCAGGGCTGGGTTTTGG + Intergenic
906260313 1:44382608-44382630 AAACCACCATGCCAGGCTTTAGG + Intergenic
906772323 1:48496039-48496061 AAACTACTTTGCCTGGCTTGTGG - Intergenic
907708204 1:56851179-56851201 AAAACACATTGCCTGTCTTAGGG - Intergenic
907923137 1:58931573-58931595 AAACCAAATGGACTGGACTTGGG - Intergenic
909151801 1:72015804-72015826 ACCCCTCATGGCCTGGTTTTGGG + Intronic
909207195 1:72773995-72774017 AAATCAGATGACATGGCTTTTGG + Intergenic
912971924 1:114291691-114291713 ACACCACATTGCCTGTCTCTGGG - Intergenic
916891905 1:169120284-169120306 AAAACAGATGGTCTGGGTTTAGG - Intronic
918371382 1:183864838-183864860 ACACCAGATGGACTGGCGTTGGG + Intronic
918405196 1:184205542-184205564 AAACCTCATGGTCTGGATGTGGG - Intergenic
918777256 1:188649579-188649601 AAAATACATGGCCTTTCTTTTGG + Intergenic
919990237 1:202704297-202704319 AAACAACATGCCCTGGCCTTGGG + Intronic
920709967 1:208285952-208285974 AGACTTCATGGCCTGGCTTAGGG - Intergenic
1063508754 10:6626102-6626124 GAATAACATGGCCTGGCTGTGGG + Intergenic
1064133968 10:12734681-12734703 CAACTTCATGGCCTGGCCTTGGG + Intronic
1065133803 10:22648899-22648921 CAAGCAAATGGCATGGCTTTGGG - Intronic
1065681637 10:28240036-28240058 AAACCAGATGGCCTCCCTCTAGG - Intronic
1066704168 10:38159663-38159685 AGACCCCATGGCCTGGTGTTGGG - Intergenic
1066792666 10:39083093-39083115 CACCCCCATGGCCTGGTTTTGGG - Intergenic
1069855710 10:71439855-71439877 CTGCCACGTGGCCTGGCTTTTGG + Intronic
1070634277 10:78111403-78111425 GAACCACATGGCCTGGAATAAGG - Intergenic
1073093595 10:100966465-100966487 AAACCAGAAGGCCCAGCTTTGGG + Intergenic
1075092728 10:119452595-119452617 AAACCCCAAGGCCTGGCTCGGGG + Intronic
1075243187 10:120797299-120797321 AAACCACATTCCATGACTTTAGG - Intergenic
1076946913 10:133657890-133657912 AGACTGCCTGGCCTGGCTTTGGG - Intergenic
1077017986 11:405342-405364 CAACTAAATGGCCTGGCTCTGGG - Intergenic
1079468306 11:20754397-20754419 AAACCACATAGCATGGCCCTAGG - Intronic
1079853254 11:25566026-25566048 CAACTAAATTGCCTGGCTTTGGG + Intergenic
1080005152 11:27398777-27398799 TTACCAGATGGCCTGGCATTGGG + Intronic
1082766684 11:57174300-57174322 AAACTACATGTGCTGGCTTTGGG - Intergenic
1086543937 11:87946288-87946310 AAGCCACATGGGCTAGCTTTAGG + Intergenic
1088159920 11:106856342-106856364 AAACAAAATGCCCAGGCTTTGGG - Intronic
1089622674 11:119730501-119730523 AAAACACAGTGCCTGGCTTGGGG + Intergenic
1091445678 12:543170-543192 TCACCCCATGGCCTGGCCTTGGG - Intronic
1093117931 12:15234342-15234364 ATGCCTCTTGGCCTGGCTTTTGG - Intronic
1096519948 12:52179358-52179380 ATAGCACTTGGCCTGGCTGTGGG + Intronic
1096846265 12:54408786-54408808 AAACCACACGGCCAGTCTGTGGG + Exonic
1101403633 12:104409745-104409767 GAACCACATGGCCTGGGAGTTGG - Intergenic
1101490305 12:105203961-105203983 AAACCACAGTTGCTGGCTTTTGG + Intronic
1101545361 12:105707158-105707180 AAAGCTCAAGGCCTGGCTTTGGG - Intergenic
1103477210 12:121227553-121227575 AAATCAGTAGGCCTGGCTTTGGG - Intronic
1104020524 12:124989072-124989094 AACCCACGTGGGCTGGGTTTCGG - Exonic
1105797008 13:23865368-23865390 AAACCTCATGGTTTGGGTTTAGG - Intronic
1106512763 13:30425452-30425474 AAAGCCCAGGGCCTGGCATTGGG + Intergenic
1114975370 14:28090204-28090226 AACCCACATGCACTGGTTTTGGG + Intergenic
1116815208 14:49577301-49577323 AAACCAGAGACCCTGGCTTTTGG - Exonic
1116904261 14:50389879-50389901 AAACCACATGGCATGAACTTGGG + Intronic
1118399642 14:65367805-65367827 TAAACACATGGCCTGGGTATTGG - Intergenic
1118770600 14:68940240-68940262 AAACCAAATGACCTCACTTTTGG - Intronic
1120254892 14:82106167-82106189 ACACTACATGGCCTGGCATCTGG + Intergenic
1120998848 14:90436959-90436981 AAGCCAGATGGCCTGGCTGCAGG + Intergenic
1122598457 14:102909091-102909113 GACCCACGGGGCCTGGCTTTGGG + Exonic
1123017240 14:105381260-105381282 AAACCCCCTGGCCCGGCATTGGG + Intronic
1123878299 15:24648255-24648277 AAACCACATTGCATGTATTTTGG - Intergenic
1123944983 15:25234647-25234669 ACCCCACATGGCCTGGCTCATGG - Intergenic
1123947496 15:25245878-25245900 ACCCCACATGGCCTGGCTGATGG - Intergenic
1124789169 15:32710624-32710646 AACCCATATGGCCTGTCTTGAGG - Intergenic
1125260789 15:37822490-37822512 AAAGCATCTGGCCTGGCTTATGG + Intergenic
1125898971 15:43328106-43328128 AAATCACAAGGCCTGGGATTGGG + Exonic
1126705619 15:51402419-51402441 AAACCAGGTGTCCTGGCTTTCGG - Intronic
1127461583 15:59204130-59204152 AAGCCACAAGTCCTGGCTTGTGG - Intronic
1127465969 15:59245065-59245087 CATCCCCCTGGCCTGGCTTTGGG - Intronic
1127694852 15:61435140-61435162 TAAGCACATGACCTGGCTTCTGG + Intergenic
1127785513 15:62351600-62351622 GAACCACATGGCCTGTCCGTGGG + Intergenic
1128085179 15:64881299-64881321 AAACCACCATGCCTGGGTTTGGG - Intronic
1128879236 15:71227820-71227842 AATACACATGGCCTGCCTGTTGG + Intronic
1130075015 15:80681133-80681155 AAACCACATCACCAGGGTTTTGG + Intronic
1134763366 16:16733923-16733945 AATCCACATGGCCAGGATATTGG - Intergenic
1134884146 16:17775055-17775077 AATCCCCATGACATGGCTTTGGG - Intergenic
1134982686 16:18625234-18625256 AATCCACATGGCCAGGATATTGG + Intergenic
1135541856 16:23336108-23336130 AAACCAGATTGCCTGGCTTCCGG - Intronic
1137605917 16:49786671-49786693 AAACCACAGGCTCTGGCTTCTGG + Intronic
1139748354 16:69092714-69092736 AAACCACCGTGCCTGGCTTGAGG - Intergenic
1140838880 16:78820617-78820639 AGACCACAGGGCCTGTCTTCAGG + Intronic
1142052603 16:87968688-87968710 AAACCACATAGCCTGACTGAGGG - Intronic
1143076841 17:4351332-4351354 AAGCCATATGGCATGGCTATTGG - Intronic
1144499316 17:15771387-15771409 AAACCACAGTGGCTGGCCTTGGG + Intergenic
1145162709 17:20586420-20586442 AAACCACAGTGGCTGGCCTTGGG + Intergenic
1147349148 17:39826524-39826546 TTACCACATGGCCAGGCTGTTGG - Intronic
1147540504 17:41353382-41353404 AAACCAGATGGCTTTGCATTTGG + Intergenic
1148625303 17:49064754-49064776 GAACCACTAGGCCTGGTTTTGGG - Intergenic
1148721341 17:49755475-49755497 AAGCCAGACTGCCTGGCTTTAGG - Intronic
1149852476 17:60046934-60046956 AAAGCACATGTCTGGGCTTTAGG - Intronic
1151888984 17:76940998-76941020 AATCCACATGCCCTGGCTCAGGG - Intronic
1153116599 18:1664489-1664511 AAGCAACATGGCCTGGGCTTAGG - Intergenic
1155976944 18:32141137-32141159 ATTCCTCATGGCCTGGTTTTAGG + Intronic
1156500406 18:37554047-37554069 CAGCCACAAGGCCTGGCTCTAGG - Intronic
1156889970 18:42179457-42179479 AACACACTTGGCCTGGCATTTGG - Intergenic
1157027872 18:43868324-43868346 GCACAACATGGCCTGGATTTGGG - Intergenic
1157075030 18:44456158-44456180 AACCTACATAGCCTGGCTTTGGG - Intergenic
1161461017 19:4397674-4397696 AAATCAGATGGCCTGGCCCTGGG - Intronic
1161636775 19:5394043-5394065 GAACCACGTGGCCTGGGTTCAGG + Intergenic
1161645815 19:5452748-5452770 AAGCCACATGGCCTGGAGTCTGG + Intergenic
1161872080 19:6878045-6878067 AACCCACATGCCCTGGCTCATGG - Intergenic
1163094785 19:15049225-15049247 TAACCAGATGGGCTGGCTATGGG + Intergenic
1163182282 19:15613099-15613121 AAATCACACAGCCTGGCTTATGG - Intergenic
1163924030 19:20321747-20321769 AGCCCACATGGCCTGGTGTTGGG - Intergenic
1164088132 19:21922629-21922651 AAGTCACATGACCTGGGTTTGGG - Intergenic
1165500418 19:36184832-36184854 AAGCCACCTCGCCTGGCCTTTGG - Intronic
1166133277 19:40759657-40759679 CAGCCACATGGACTGGCTTTGGG + Intronic
1167520335 19:49951049-49951071 AAACTATGTGGCCTGGCTTGTGG - Intronic
1168038356 19:53738261-53738283 AAACCAAATGTCTTGGCTCTGGG - Intergenic
1168656309 19:58131254-58131276 AAACCATATGGCCAAGCATTGGG + Intronic
1168719990 19:58549561-58549583 TAACCAGATCGCCTGGCTTCTGG - Exonic
925163181 2:1701122-1701144 AAACCACATGGCCTGGCTTTGGG - Intronic
926616022 2:14997431-14997453 CAAGCACAGGGCCTGGCGTTGGG - Intergenic
928169532 2:28994537-28994559 AAACCACACGGCCTCGCACTTGG + Intronic
929773809 2:44915269-44915291 AACACACAGGGCCTGGCTTGTGG + Intergenic
931757712 2:65388790-65388812 AAACCACATGCTCAGGGTTTGGG - Intronic
934112150 2:88754039-88754061 GAACATCATGGCCTGGCTGTCGG + Intergenic
934573803 2:95388202-95388224 CCATCTCATGGCCTGGCTTTTGG + Intergenic
934682366 2:96293936-96293958 TAACAACATCCCCTGGCTTTGGG - Intronic
935722301 2:105990217-105990239 CATCCCCATGGCCTGGTTTTGGG + Intergenic
937643391 2:124238362-124238384 GAACCAGATTGCCTGACTTTTGG + Intronic
940090002 2:149904383-149904405 AATCCACGCGGCCTGGATTTTGG - Intergenic
940649160 2:156423956-156423978 TAGCCACCTGGCGTGGCTTTTGG - Intergenic
941850169 2:170172497-170172519 AAGCCACCATGCCTGGCTTTTGG + Intergenic
941930102 2:170929924-170929946 AAACCAAATGGCCTGGAAGTAGG + Intronic
943215792 2:185031807-185031829 AAACCACATGACATTGGTTTAGG - Intergenic
944376825 2:199055079-199055101 AAACCCAATGGCCTGTTTTTAGG + Intergenic
945370344 2:209008540-209008562 AAAACACATGGTCTGGCTCTAGG + Intergenic
947204501 2:227647997-227648019 AAGCCACATTGCTTGGCTTTGGG + Intergenic
947690694 2:232133219-232133241 AGACCAGGTGGCCTGGCTTGGGG + Intronic
947915907 2:233831359-233831381 GAACCACGTGGCCTGGCTGATGG + Intronic
948873675 2:240816628-240816650 AGACCACAAGGCCTGGGATTAGG + Intronic
1170066218 20:12313365-12313387 AAACCATATAGACTGACTTTGGG + Intergenic
1171110858 20:22480848-22480870 AGACCACCTGGCCTACCTTTAGG - Intergenic
1173398487 20:42702953-42702975 AAACCATATGGGCTGGCTATGGG - Intronic
1174476977 20:50802482-50802504 ACAGGACATGGCCTTGCTTTAGG + Intronic
1176085035 20:63292056-63292078 AAACCACTTGGCCTGGCCCCAGG - Intergenic
1176648020 21:9367955-9367977 AAACCCCAGGGCCTGACTTCTGG - Intergenic
1177678963 21:24339108-24339130 AGCACAAATGGCCTGGCTTTGGG + Intergenic
1179485074 21:41704912-41704934 GACCCACATGGCCGGGCTTTGGG - Intergenic
1180833035 22:18915790-18915812 AAGCCACAGGGCCAGGCTTGGGG - Intronic
1181066785 22:20310464-20310486 AAGCCACAGGGCCAGGCTTGGGG + Intergenic
1181711340 22:24693542-24693564 AAACCTAATGGCCTGGCCATGGG - Intergenic
1182425095 22:30267470-30267492 CAAAGACAAGGCCTGGCTTTGGG - Intergenic
1184445831 22:44546276-44546298 AAAAGACATGGCCTGCCCTTGGG - Intergenic
1184448999 22:44571724-44571746 AACCCACATCGCCTGCCTTCTGG + Intergenic
1203283119 22_KI270734v1_random:141094-141116 AAGCCACAGGGCCAGGCTTGGGG - Intergenic
949253431 3:2016088-2016110 CAACCTTATGGTCTGGCTTTTGG + Intergenic
950103951 3:10376745-10376767 AAAGCAGATGGCTGGGCTTTGGG - Intronic
954116620 3:48470175-48470197 AAATCACAGTGCCTGGCTTGTGG - Intronic
954882239 3:53844191-53844213 AAGCCACTTGGCCTGGGTCTTGG + Intronic
955006610 3:54974546-54974568 AATTCCCATGGCCTGGGTTTGGG + Intronic
955602221 3:60657814-60657836 TAATCACATGGCCTGCCTTTAGG + Intronic
958043168 3:88250022-88250044 CAGCCAGTTGGCCTGGCTTTGGG + Intergenic
958144267 3:89603684-89603706 AAACCACATGGACTGCTTTATGG - Intergenic
962009670 3:131381405-131381427 AAAGCACAAGGCCTGGGTTGGGG - Intergenic
962727491 3:138245942-138245964 AAACCACATGTTCTGTCTTGAGG + Intronic
963161905 3:142159745-142159767 GAACCAGAAGACCTGGCTTTGGG + Intergenic
964559583 3:157979250-157979272 AAAGCACATGGCCTGGGTGTGGG - Intergenic
965754837 3:172015176-172015198 AACCCAAATGGACTGGGTTTAGG + Intergenic
967201434 3:187075766-187075788 AAGCCACACTGCCTGGCTTCCGG + Exonic
967875935 3:194268449-194268471 ATCCCACATGGCCTGGGTTTGGG - Intergenic
969677853 4:8624612-8624634 AAACCAGAAAACCTGGCTTTGGG + Intergenic
969678808 4:8630248-8630270 AAACCAGAAAACCTGGCTTTGGG + Intergenic
969679764 4:8635898-8635920 AAACCAGAAAACCTGGCTTTGGG + Intergenic
971840332 4:31842950-31842972 AAAACAAATGTTCTGGCTTTAGG - Intergenic
973709608 4:53615339-53615361 AATCTACCTGGGCTGGCTTTGGG + Intronic
975801039 4:78059006-78059028 AATCCACAGCGCCTGGCTCTCGG + Intronic
979755543 4:124335927-124335949 AGAACACATGGCCTGAATTTAGG - Intergenic
981756800 4:148148523-148148545 AACCCACAGGACCTGGCCTTAGG + Intronic
983762262 4:171425495-171425517 AAGCCATAGGGCCTGGGTTTAGG - Intergenic
984067902 4:175072490-175072512 AAACCAAATTGCTTGGATTTTGG + Intergenic
984632193 4:182072999-182073021 AATACACATGGCCTGACCTTTGG - Intergenic
987840696 5:23219428-23219450 GAGCCACCAGGCCTGGCTTTGGG - Intergenic
989453271 5:41612021-41612043 AAACCACATGACCTGGGGTGAGG + Intergenic
990074611 5:51828573-51828595 AATCCTTATTGCCTGGCTTTTGG - Intergenic
990393616 5:55354400-55354422 AATTCACATAGCCTGGCTTTGGG + Intronic
992464700 5:76992151-76992173 AAACCACATGGAGAGGCCTTGGG - Intergenic
995394743 5:111675613-111675635 CAACCCCATGCCCTGGTTTTTGG - Intronic
997381439 5:133440984-133441006 ACAGCACAGGGCCTGGCTTGGGG + Intronic
999471367 5:151857976-151857998 AAACCATGTGTCCTGGCCTTTGG + Intronic
1001437914 5:171714970-171714992 AAACCACATGGGCTGGGGGTGGG - Intergenic
1001554040 5:172624270-172624292 AGACCACACGGCCTCGCTTCAGG + Intergenic
1002066335 5:176653841-176653863 AATCCTCAGGGCCTGGCTCTGGG - Intronic
1002527963 5:179825559-179825581 AAATCCCAAGGCCTGGCTTAGGG - Intronic
1005553245 6:26945400-26945422 AAACCACATGTCCTGATTTCTGG - Intergenic
1006631077 6:35430290-35430312 CAACCACTTTGCCTGGCTTCTGG + Intergenic
1007835764 6:44672457-44672479 AAACTACATGGACTGGCTTATGG + Intergenic
1007925754 6:45648264-45648286 AAACCTCATGGCATAGCTGTGGG + Intronic
1009677051 6:66839044-66839066 AAACCACATTGTTTTGCTTTGGG - Intergenic
1011325556 6:86147300-86147322 AGACCCCATGGCCTGGTGTTGGG + Intergenic
1011899095 6:92270147-92270169 AAAACATATGGCCTTGGTTTTGG - Intergenic
1014618108 6:123629580-123629602 AAACCACATGCCCTAGCTTCTGG + Intronic
1015356768 6:132286421-132286443 AAATCACCTGGCATTGCTTTTGG + Intergenic
1015864442 6:137713421-137713443 AAATCTCATGTCCTGGCTCTGGG + Intergenic
1017847589 6:158272947-158272969 AGATCTCATGACCTGGCTTTGGG + Intronic
1017899438 6:158706351-158706373 AAATCAGATGGGCTGGCCTTTGG - Intronic
1018368097 6:163142749-163142771 AAACCACATAGCAAGGCTCTGGG - Intronic
1018788512 6:167127987-167128009 CAACCACATGGCTCGGCTTGTGG + Intronic
1020804353 7:12770134-12770156 AAAGCAAATTGCCTTGCTTTTGG + Intergenic
1023287262 7:38632145-38632167 AAAACACATCGCCTGTCTTCCGG - Intergenic
1023560396 7:41467744-41467766 CAGCCACATGGCCTGGGATTGGG + Intergenic
1024116406 7:46197783-46197805 TCACCACATGGCCTTGATTTTGG - Intergenic
1026953940 7:74365144-74365166 CAACCACATGGCCTGCCCCTTGG - Intronic
1030416944 7:109257320-109257342 AAACCTCAAGGCATGTCTTTGGG - Intergenic
1031930582 7:127681556-127681578 AATCTACATGGCCTTGCATTAGG - Intronic
1036941703 8:13058354-13058376 GAACGACCTGGCCTGGCTTGTGG + Intergenic
1037354375 8:18001045-18001067 AAATCAAATGCCCTGGCTTTAGG - Intronic
1037649210 8:20821603-20821625 TAAGCAAATGGCCTGTCTTTGGG + Intergenic
1037700070 8:21265593-21265615 AAACCACAGGGCCATTCTTTAGG - Intergenic
1040076138 8:43233345-43233367 AAACCACAGGGCATGGCTGGTGG - Intergenic
1041562096 8:59229731-59229753 AAACCAAAGGTCCTGGATTTAGG + Intergenic
1044063193 8:87664742-87664764 AAACCACATTGCATGGCTCATGG - Intergenic
1044904896 8:96990341-96990363 AAAGCACTTGGCCTGGCAGTAGG - Intronic
1046296496 8:112226482-112226504 AAAACACATGGCCTTGAATTTGG + Intronic
1046507063 8:115150000-115150022 AAACCACAAGGAATGGCCTTTGG + Intergenic
1047023768 8:120805496-120805518 CACCCACATGCCTTGGCTTTTGG - Intronic
1048547340 8:135399309-135399331 CAAGCACAATGCCTGGCTTTGGG - Intergenic
1049697083 8:143989675-143989697 AAACCACGAGGCCTCGATTTGGG + Intronic
1050562930 9:6853071-6853093 AACACACAGGGCCTGGCTATAGG + Intronic
1050565204 9:6875051-6875073 AAACCTCATTTCCTGACTTTAGG - Intronic
1051851737 9:21517309-21517331 AAACCACATGCTTTGGATTTAGG + Intergenic
1052772365 9:32701531-32701553 AAAGCACATGGCTTTGCATTTGG + Intergenic
1053095953 9:35328563-35328585 AAACCAGAGTGCCTGGCTTCTGG + Intronic
1057217413 9:93236725-93236747 AAGCCGCATGGCCTGGCCCTTGG + Intronic
1058125104 9:101183470-101183492 AAAGCAGATTACCTGGCTTTGGG + Intronic
1059618225 9:115974407-115974429 GAACCACCAGGCCTGGCCTTGGG - Intergenic
1185869000 X:3648126-3648148 AAAGCAAATGGCCTGGCTCAGGG + Intronic
1187443769 X:19343508-19343530 AAACCAGATGTTCTGTCTTTTGG + Intergenic
1187860901 X:23681371-23681393 AACCCACTTCCCCTGGCTTTAGG + Intronic
1194053753 X:89104829-89104851 AATCAACATGGCCTGGATGTGGG - Intergenic
1197037831 X:121898143-121898165 AAACCACCGTGCCTGGCCTTAGG + Intergenic
1198686452 X:139232729-139232751 CAACCACAGGGCCTGGTTTATGG - Intergenic