ID: 925163182

View in Genome Browser
Species Human (GRCh38)
Location 2:1701123-1701145
Sequence AAAACCACATGGCCTGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925163182_925163188 26 Left 925163182 2:1701123-1701145 CCAAAGCCAGGCCATGTGGTTTT 0: 1
1: 0
2: 0
3: 15
4: 225
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925163182 Original CRISPR AAAACCACATGGCCTGGCTT TGG (reversed) Intronic
900587639 1:3440816-3440838 AATACCACATGCACTGGATTTGG + Intergenic
902043476 1:13509115-13509137 AGAACCACATGTCATGCCTTGGG - Intronic
902727814 1:18348918-18348940 AAACCCAGATTGCTTGGCTTGGG - Intronic
902805735 1:18860273-18860295 CAAACCACATGGTCTGACTCCGG + Intronic
903793142 1:25907867-25907889 AAAACCACTTCGATTGGCTTGGG - Intergenic
906273040 1:44496569-44496591 AAAGCCACATGCCCCGGCGTAGG + Intronic
906775267 1:48523541-48523563 CAAACCACATGGCCTCCCTAAGG + Intergenic
907708205 1:56851180-56851202 GAAAACACATTGCCTGTCTTAGG - Intergenic
909151800 1:72015803-72015825 AACCCCTCATGGCCTGGTTTTGG + Intronic
910199148 1:84680293-84680315 GGAACCAGATGGTCTGGCTTTGG - Intronic
911471489 1:98324204-98324226 AAAACCACATTTATTGGCTTTGG - Intergenic
918405197 1:184205543-184205565 AAAACCTCATGGTCTGGATGTGG - Intergenic
919070382 1:192748087-192748109 AAAAGCACATTGCATTGCTTTGG - Intergenic
919990236 1:202704296-202704318 GAAACAACATGCCCTGGCCTTGG + Intronic
920256960 1:204661956-204661978 CAAACCTCATGGAGTGGCTTTGG + Intronic
920709968 1:208285953-208285975 GAGACTTCATGGCCTGGCTTAGG - Intergenic
920816860 1:209342693-209342715 AAAGCCTCATTTCCTGGCTTTGG - Intergenic
922795121 1:228335974-228335996 CAAACCACATGGCCTGCATGGGG - Intronic
1063508753 10:6626101-6626123 AGAATAACATGGCCTGGCTGTGG + Intergenic
1064133967 10:12734680-12734702 ACAACTTCATGGCCTGGCCTTGG + Intronic
1064703289 10:18044595-18044617 AAAAGCACATGACTTGACTTGGG - Intergenic
1067524714 10:47031332-47031354 AGAACCACGTGACCTGGCTCAGG - Intergenic
1068088023 10:52398881-52398903 AAAACAACAGGTCCTGGCCTGGG - Intergenic
1069531884 10:69225731-69225753 TCACCCCCATGGCCTGGCTTTGG - Intronic
1070345459 10:75537314-75537336 TCAGCCACATGGCCTGCCTTAGG - Intronic
1070497398 10:77037217-77037239 ACAACCACAGGGCCAGGCCTGGG + Intronic
1071725907 10:88198123-88198145 AAAAGCACAGGGCCTGGGGTGGG - Intergenic
1071932532 10:90488574-90488596 AAAACAGCATGCCCTGGATTTGG + Intergenic
1072711515 10:97718610-97718632 AAAAAAACAGGGCCTGGCTACGG - Intergenic
1072818410 10:98532095-98532117 CATTGCACATGGCCTGGCTTAGG - Intronic
1075092727 10:119452594-119452616 AAAACCCCAAGGCCTGGCTCGGG + Intronic
1076590862 10:131581198-131581220 ACAGCCATATGGCCTGGCCTAGG + Intergenic
1077017987 11:405343-405365 ACAACTAAATGGCCTGGCTCTGG - Intergenic
1079853253 11:25566025-25566047 ACAACTAAATTGCCTGGCTTTGG + Intergenic
1080280171 11:30548049-30548071 GAATCCACAAGACCTGGCTTTGG + Intronic
1080799918 11:35600809-35600831 AAAAACACATGTTATGGCTTTGG - Intergenic
1080952691 11:37054248-37054270 ATAACCAAATGGTCTGGCTGTGG + Intergenic
1081560682 11:44212872-44212894 AAAACTACATTGCCAGGCCTGGG + Intronic
1082063557 11:47880846-47880868 AGAACCACACTGCCTGGCTAAGG - Intergenic
1082699212 11:56407260-56407282 AAAAAGACATGGTTTGGCTTAGG + Intergenic
1082766685 11:57174301-57174323 AAAACTACATGTGCTGGCTTTGG - Intergenic
1083602480 11:63957593-63957615 AATGTCACAAGGCCTGGCTTGGG - Intergenic
1086508070 11:87527024-87527046 AAACCCAAAGGGCCTGGGTTTGG + Intergenic
1087182781 11:95156285-95156307 CAAACCACTTGGCCTGGAATTGG + Intergenic
1087934136 11:104012855-104012877 AAAACCACATGGCCATGTTATGG + Intronic
1088502475 11:110496629-110496651 CAACCCCCATGGCCTTGCTTTGG + Intergenic
1089622673 11:119730500-119730522 CAAAACACAGTGCCTGGCTTGGG + Intergenic
1092092022 12:5811435-5811457 CACACAACATGGTCTGGCTTTGG + Intronic
1094253965 12:28400211-28400233 AATACCACATGCCAAGGCTTGGG + Intronic
1094272072 12:28628047-28628069 AAGGACACAAGGCCTGGCTTGGG + Intergenic
1096846264 12:54408785-54408807 AAAACCACACGGCCAGTCTGTGG + Exonic
1097033206 12:56104436-56104458 AAGGCCCCAGGGCCTGGCTTAGG + Exonic
1100008897 12:89928889-89928911 AAAAATATATTGCCTGGCTTCGG - Intergenic
1100122847 12:91388823-91388845 AAAACCTCATGACCTAGTTTGGG - Intergenic
1101233633 12:102766740-102766762 AAGACTACATGGTCTGGCTCAGG + Intergenic
1101545362 12:105707159-105707181 CAAAGCTCAAGGCCTGGCTTTGG - Intergenic
1101597503 12:106180063-106180085 AAATCCAATTGGCCTAGCTTGGG - Intergenic
1102497056 12:113327068-113327090 AAAGCCACAGGCCCAGGCTTAGG - Intronic
1102801478 12:115738541-115738563 AAACCCACAATGCCTGGCTCTGG - Intergenic
1104861013 12:131923548-131923570 AAAACCACACGGCAAGGCCTTGG - Intergenic
1107309818 13:39064485-39064507 AAAACCTCACTGCCTGGCATGGG - Intergenic
1108993617 13:56695883-56695905 AAAATCACATGGCCTTATTTTGG - Intergenic
1110114803 13:71799684-71799706 AAAACCACATGGCCAGATTTGGG - Intronic
1111625521 13:90779725-90779747 AAAAACACCTGGCCTGGCTCTGG + Intergenic
1111785965 13:92787001-92787023 AAAACCACTTGGACTGACCTTGG + Intronic
1114626410 14:24132832-24132854 AAAACCATCGGGCCTGGCTGTGG + Exonic
1115749758 14:36477491-36477513 AAAACCACAGGCCCTGACTGTGG - Intronic
1116639792 14:47446748-47446770 ACATCCACATACCCTGGCTTAGG - Intronic
1116701590 14:48251125-48251147 AACTCCACAAGGCCTGGCTGTGG + Intergenic
1119879931 14:78092003-78092025 AAGACCACATGCCCAGGCTCAGG + Intergenic
1125599096 15:40906069-40906091 AGGACCAGATGGGCTGGCTTAGG - Intergenic
1127844455 15:62857092-62857114 GAAACCACCTGGCCTGGACTTGG + Intergenic
1128551073 15:68598267-68598289 AAACCCACATGGCCTGGGCCAGG - Intronic
1128661127 15:69501781-69501803 AAACCCACAAGACCTGGGTTTGG + Intergenic
1129361833 15:75029259-75029281 AAAACCACAGGGGCTGGGCTGGG - Intronic
1130391939 15:83464335-83464357 AATACCCCAGGCCCTGGCTTGGG + Intronic
1131515587 15:93074194-93074216 AGAACCAGATGGGCAGGCTTGGG - Intronic
1132392957 15:101452234-101452256 CAAACCAAATGGTCCGGCTTCGG + Intronic
1133898547 16:9951856-9951878 AAGAACACATGGGCTGACTTGGG - Intronic
1134259652 16:12640709-12640731 AAACCCAGATTGGCTGGCTTAGG - Intergenic
1134516196 16:14889239-14889261 AAAAACCCATGGGCTGGGTTTGG + Intronic
1134650490 16:15904649-15904671 GACACCAGATGGCCTGGATTAGG + Intergenic
1135267118 16:21036790-21036812 AAAACTTCATAGTCTGGCTTTGG + Exonic
1135592025 16:23711869-23711891 AAAACCAGCTGGGCTGGTTTGGG - Intronic
1136276334 16:29181295-29181317 AAAACAACATGGACCGACTTTGG - Intergenic
1137452419 16:48589422-48589444 AAACCCAAATGGACTGGCTTTGG + Intronic
1139935808 16:70570315-70570337 AAAACCAAATGGCCTTCCCTGGG - Intronic
1142052604 16:87968689-87968711 GAAACCACATAGCCTGACTGAGG - Intronic
1142080717 16:88147355-88147377 AAAACAACATGGACTGACTTTGG - Intergenic
1144101056 17:11942636-11942658 ACAACCTCATGGCCAGGCTGTGG - Intronic
1148221569 17:45866077-45866099 AAGCCCACATGGCCTGGTCTTGG + Intergenic
1148238735 17:45986208-45986230 AAACCCACCAGGCCTGGCTCAGG + Intronic
1149403014 17:56318190-56318212 AAAACCAGATGGCCTTGCCAAGG + Intronic
1149720387 17:58837786-58837808 AAAACCTCATGGGCTGGTTGTGG - Intronic
1151888985 17:76940999-76941021 CAATCCACATGCCCTGGCTCAGG - Intronic
1152803341 17:82342352-82342374 GAAACCAGATGGGCAGGCTTGGG - Intergenic
1155869834 18:31012618-31012640 ACAACCACATGGGCTTGTTTTGG + Intronic
1156126007 18:33905828-33905850 AAAACCATTTGACCTGGCTAAGG - Intronic
1156988974 18:43383153-43383175 AAGCCCAGATGGCTTGGCTTGGG - Intergenic
1157075031 18:44456159-44456181 GAACCTACATAGCCTGGCTTTGG - Intergenic
1157295517 18:46439287-46439309 GATCCCACATGGCCTGGGTTTGG - Intronic
1157644610 18:49255260-49255282 AAAACCACATGCCCAGACTGAGG + Intronic
1158597819 18:58831920-58831942 AATACCACATGACCTAGCTCTGG + Intergenic
1159369709 18:67515629-67515651 AAAATCACTTGCCCTAGCTTAGG - Intronic
1161273507 19:3403549-3403571 AATACCAAACGCCCTGGCTTTGG - Intronic
1161825102 19:6558234-6558256 ACAGCCACAGCGCCTGGCTTAGG - Intergenic
1162222960 19:9194312-9194334 AAAACTACATGGGCTGGGTACGG - Intergenic
1163094784 19:15049224-15049246 ATAACCAGATGGGCTGGCTATGG + Intergenic
1163265423 19:16217811-16217833 CAAACCCCCTGGCCTGGCTTAGG + Intronic
1164061115 19:21675063-21675085 AAAACTCCATGGCTTCGCTTCGG - Intergenic
1165384780 19:35503904-35503926 AAACCCAGATATCCTGGCTTGGG + Intronic
1166133276 19:40759656-40759678 TCAGCCACATGGACTGGCTTTGG + Intronic
1167161549 19:47770806-47770828 AAAACCACAAGGCGAGGCTGAGG - Intergenic
1168656308 19:58131253-58131275 AAAACCATATGGCCAAGCATTGG + Intronic
925163182 2:1701123-1701145 AAAACCACATGGCCTGGCTTTGG - Intronic
925900067 2:8502897-8502919 ACATCCACATGGCCTGGCAGTGG + Intergenic
926616023 2:14997432-14997454 ACAAGCACAGGGCCTGGCGTTGG - Intergenic
928045797 2:27930360-27930382 AAAAACTCTTGGCATGGCTTAGG + Intronic
932926631 2:75983151-75983173 AGAACCACACGGGCTGGCTCAGG - Intergenic
934738942 2:96705268-96705290 AAAACCACCTGACCTGGCATAGG - Intergenic
934985566 2:98882350-98882372 AGAACTACATTGACTGGCTTAGG - Intronic
935448056 2:103177497-103177519 AAAACCTCATGGTCTGACTCTGG + Intergenic
936283377 2:111161833-111161855 AAAACCAAAGGCCCTGGTTTAGG + Intronic
938472542 2:131578425-131578447 AATACCACATGTTCTCGCTTAGG - Intergenic
938565403 2:132514209-132514231 AAAACCAAGTGGCCTGGGCTAGG - Intronic
944658976 2:201904640-201904662 AGAACCACATAGCCTGGCACTGG - Intergenic
946973786 2:225124779-225124801 AAAAACACTTGACCTGGCCTGGG + Intergenic
947204500 2:227647996-227648018 AAAGCCACATTGCTTGGCTTTGG + Intergenic
947690693 2:232133218-232133240 TAGACCAGGTGGCCTGGCTTGGG + Intronic
947795948 2:232894095-232894117 AAAACTCCATGGCCTGCCCTGGG + Intronic
948013961 2:234672710-234672732 AAACTCACGTGGCCAGGCTTGGG + Intergenic
948289541 2:236815082-236815104 CAACCCACATAGCATGGCTTAGG - Intergenic
948583806 2:239005784-239005806 AAGACCACCTGCCCTGGCTTGGG + Intergenic
948735086 2:239998373-239998395 AAAACCACATCTCCTAGGTTCGG + Intronic
948972627 2:241441217-241441239 AAAGCCACCTGGCCTAACTTAGG - Intronic
1168847250 20:953794-953816 GAAACCACAGGGCCTGGGCTGGG - Intergenic
1169538581 20:6575369-6575391 AAAGCCACAGGGCATGCCTTAGG + Intergenic
1171237241 20:23536862-23536884 AAAACAGCCTGGCCTGGCTGGGG - Intergenic
1173398488 20:42702954-42702976 CAAACCATATGGGCTGGCTATGG - Intronic
1173789493 20:45818549-45818571 ATGGCCACATGGCCTGCCTTGGG + Intergenic
1174444018 20:50578453-50578475 TATACCACATGGCCTGACTTTGG + Exonic
1177569968 21:22874560-22874582 TAACTCACATGTCCTGGCTTGGG - Intergenic
1179485075 21:41704913-41704935 GGACCCACATGGCCGGGCTTTGG - Intergenic
1180134157 21:45850323-45850345 AGAACCACCTGGCCTGGCACTGG - Intronic
1180833036 22:18915791-18915813 GAAGCCACAGGGCCAGGCTTGGG - Intronic
1181066784 22:20310463-20310485 GAAGCCACAGGGCCAGGCTTGGG + Intergenic
1181432126 22:22888060-22888082 CAACCCACTTGGCCTGTCTTGGG - Exonic
1181711341 22:24693543-24693565 AAAACCTAATGGCCTGGCCATGG - Intergenic
1182425096 22:30267471-30267493 ACAAAGACAAGGCCTGGCTTTGG - Intergenic
1183362734 22:37391108-37391130 CCAACCAGAAGGCCTGGCTTTGG - Intronic
1184445832 22:44546277-44546299 AAAAAGACATGGCCTGCCCTTGG - Intergenic
1184677360 22:46051028-46051050 AGAAACACAGGGCCTGGCCTGGG - Exonic
1184964999 22:47965238-47965260 AAAGCCACATGGCGTGGCAGAGG - Intergenic
1185353155 22:50348775-50348797 AAAAGCACATGGGCTGGGTGCGG + Intronic
1203283120 22_KI270734v1_random:141095-141117 GAAGCCACAGGGCCAGGCTTGGG - Intergenic
949347591 3:3090907-3090929 AATACCACATGTCCTGGGTGTGG + Intronic
949597603 3:5564350-5564372 AAAACCACCTGGGCTAGCTTTGG + Intergenic
950829678 3:15860481-15860503 AAAACCACACAGCTTAGCTTCGG - Intergenic
953421368 3:42755967-42755989 AAAAACACAAAGCCTGGCTAAGG - Intronic
953828852 3:46278042-46278064 AAATCCAATTGGCCTAGCTTAGG - Intergenic
953857977 3:46516315-46516337 AAAACCACATGGTAGTGCTTTGG - Exonic
954383693 3:50233239-50233261 ATAACCACAGGACCTGGCCTGGG + Intronic
956458423 3:69446618-69446640 AATAACACATGGCCTGGCGCGGG - Intronic
956667125 3:71652528-71652550 AACCCCACAGGGCCTGGCTGTGG - Intergenic
957949514 3:87107088-87107110 TAAACCTCAAGGCATGGCTTCGG + Intergenic
959687766 3:109166174-109166196 ACAAGCATAGGGCCTGGCTTAGG + Intergenic
960431846 3:117579097-117579119 AACAACACATAACCTGGCTTAGG + Intergenic
961173197 3:124813748-124813770 AAACCCAGAAGGCCTGGATTTGG - Intronic
961181200 3:124879171-124879193 TAGACCAGAGGGCCTGGCTTGGG - Intronic
962009671 3:131381406-131381428 CAAAGCACAAGGCCTGGGTTGGG - Intergenic
962354040 3:134678339-134678361 AAGAGCACATGACCTGGCCTGGG - Intronic
964559584 3:157979251-157979273 GAAAGCACATGGCCTGGGTGTGG - Intergenic
967277774 3:187793593-187793615 AAAAGCACATGTCTTGGCTAAGG - Intergenic
967875936 3:194268450-194268472 CATCCCACATGGCCTGGGTTTGG - Intergenic
967903791 3:194485119-194485141 AGAACAACAATGCCTGGCTTTGG - Intronic
969721785 4:8896125-8896147 CACACCCCATGCCCTGGCTTGGG + Intergenic
969815911 4:9687329-9687351 ATAACCACAAGGCCGGGCGTGGG + Intergenic
970452237 4:16180976-16180998 AAATCCACATGGCCTTGCTCCGG - Intronic
970460507 4:16270253-16270275 AAACCCGCAAGGCCTGGCTCCGG + Intergenic
975052239 4:69880295-69880317 AGAACCCCAGGGACTGGCTTTGG + Intergenic
975369366 4:73567461-73567483 AACACAACATTGCCGGGCTTAGG - Intergenic
977857629 4:101913085-101913107 CAAACCAGATGGGCTGGGTTGGG - Intronic
978450147 4:108823527-108823549 AAAACCATATTGCCTGACATGGG + Intronic
978914291 4:114104952-114104974 AAAGCCAGCTGGCCTGGCATGGG + Intergenic
979181192 4:117729611-117729633 AAATTCACATTGCCTGCCTTAGG + Intergenic
981307939 4:143266610-143266632 CAAACCATATCACCTGGCTTAGG - Intergenic
985838655 5:2289428-2289450 AAAACCACACTGCCTGGGCTGGG + Intergenic
986269480 5:6218434-6218456 AAAACCCCATGGGCTGGGTGGGG - Intergenic
989309559 5:39998832-39998854 AAAAACAGATGTTCTGGCTTAGG - Intergenic
990393615 5:55354399-55354421 GAATTCACATAGCCTGGCTTTGG + Intronic
992464701 5:76992152-76992174 AAAACCACATGGAGAGGCCTTGG - Intergenic
993165721 5:84352554-84352576 AAAACCACATGTTCTCACTTGGG + Intronic
997381438 5:133440983-133441005 CACAGCACAGGGCCTGGCTTGGG + Intronic
999540767 5:152570013-152570035 AAAACAACATGGGCTGGGTGTGG - Intergenic
1001705674 5:173739571-173739593 AGAACCACAAGGGCTGACTTAGG - Intergenic
1002527964 5:179825560-179825582 CAAATCCCAAGGCCTGGCTTAGG - Intronic
1003967836 6:11270328-11270350 GAAACCACATAGCCTGCATTTGG - Intronic
1008605583 6:53136574-53136596 ACAACCACATTGACTGGCTGAGG - Intronic
1009195975 6:60684866-60684888 AAAACAACACAGACTGGCTTAGG - Intergenic
1013398315 6:109766469-109766491 GAAACAACCTGGTCTGGCTTTGG + Intronic
1013665394 6:112342444-112342466 GAAACCACCTGTCCTGGATTAGG + Intergenic
1015864441 6:137713420-137713442 AAAATCTCATGTCCTGGCTCTGG + Intergenic
1018831942 6:167449989-167450011 AAAACCAAAAGGTCTGACTTAGG + Intergenic
1022248508 7:28584219-28584241 AAAACCACAGGGCCTCGCCTGGG - Intronic
1023279750 7:38557279-38557301 CAAACCACATCACCTGGGTTAGG - Intronic
1023632956 7:42181646-42181668 AAAACTATATGAACTGGCTTTGG - Intronic
1026098487 7:67365548-67365570 AAAACCACCTGCCAGGGCTTTGG - Intergenic
1026448125 7:70503415-70503437 CAAACCACTGGGCCTAGCTTGGG - Intronic
1029928641 7:104346944-104346966 AAACCCAGATGTTCTGGCTTTGG - Intronic
1030416945 7:109257321-109257343 AAAACCTCAAGGCATGTCTTTGG - Intergenic
1030945173 7:115710165-115710187 AAAAGCAAAAAGCCTGGCTTTGG + Intergenic
1035007958 7:155683493-155683515 AAAGCCACATGGAGGGGCTTTGG + Intronic
1039841863 8:41299419-41299441 AAAACTACATGCCCTGTTTTGGG - Intronic
1039845679 8:41323953-41323975 AGAACCACAGGGCCTGGGATGGG - Intergenic
1040828927 8:51655695-51655717 AACTCCAGCTGGCCTGGCTTGGG - Intronic
1041264965 8:56055551-56055573 AAATCCACATAGTCTGGCTCAGG + Intergenic
1041477123 8:58278891-58278913 ACCACCACATGGCCTGTCTGAGG + Intergenic
1041600349 8:59710600-59710622 TAAACCACATGGCCTTACATAGG - Intergenic
1041642502 8:60218179-60218201 AACACCTCTTGACCTGGCTTGGG + Intronic
1042776893 8:72441950-72441972 TAAACCACTTGTCCTGGCTCAGG + Intergenic
1044398252 8:91739532-91739554 AATATCACATGGCAAGGCTTTGG + Intergenic
1047694670 8:127391647-127391669 AAAACCATATGGGCTGAATTAGG + Intergenic
1048609775 8:136009686-136009708 CAGGCCACATGGCCGGGCTTAGG - Intergenic
1049287590 8:141784461-141784483 GAAAGCACATGGCCTGCCTAGGG + Intergenic
1049440998 8:142609805-142609827 AAAAAGAGATGGCCTGGGTTAGG - Intergenic
1049732699 8:144186644-144186666 AAATCCATATTGCCTGGCATAGG + Intronic
1050116672 9:2270651-2270673 CAAACCACTTGGGCTGGATTTGG + Intergenic
1050542200 9:6680404-6680426 AAAACCACATAACTTGGCTATGG + Intergenic
1051111746 9:13646591-13646613 AAAACTCTATGGCCTGGCTGAGG + Intergenic
1055007109 9:71520613-71520635 AAATCCGCTTGGCCTGGATTGGG - Intergenic
1055576732 9:77667599-77667621 AAACCTTCATGGCCTGGATTAGG + Intergenic
1061892081 9:133627626-133627648 AAAAGCAGATGGCAAGGCTTAGG + Intergenic
1185868999 X:3648125-3648147 CAAAGCAAATGGCCTGGCTCAGG + Intronic
1189599122 X:42602774-42602796 AAGATCACATGGCTTGGCCTAGG - Intergenic
1190025564 X:46919154-46919176 AAAACCACACTGTCTGCCTTTGG - Intronic
1190519074 X:51258524-51258546 AAATCCAAATGGTATGGCTTAGG + Intergenic
1191866432 X:65707488-65707510 AGATCCTCAGGGCCTGGCTTAGG + Intronic
1192169986 X:68848198-68848220 ACACCAACTTGGCCTGGCTTGGG - Intergenic
1192396663 X:70788736-70788758 AAAACTACATGGCCTGGTCTGGG + Intronic
1196388577 X:115186726-115186748 AAATCTCCTTGGCCTGGCTTAGG - Intronic
1197871827 X:131068636-131068658 AGAAGCACATGTCCTGGCTGAGG - Intronic