ID: 925163183

View in Genome Browser
Species Human (GRCh38)
Location 2:1701129-1701151
Sequence TAATGGAAAACCACATGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925163183_925163188 20 Left 925163183 2:1701129-1701151 CCAGGCCATGTGGTTTTCCATTA 0: 1
1: 0
2: 1
3: 13
4: 212
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925163183 Original CRISPR TAATGGAAAACCACATGGCC TGG (reversed) Intronic
902118804 1:14144011-14144033 TAATAGAAAACTAGTTGGCCAGG - Intergenic
904092634 1:27955990-27956012 CCATGGAAAACCACATTACCTGG + Exonic
904118937 1:28182969-28182991 AAATTGAAAACCACCGGGCCTGG - Intronic
905425925 1:37884654-37884676 TACTGAAAAAACAAATGGCCGGG + Intronic
908274430 1:62455326-62455348 TATTGGAAAACAACATGGAATGG - Exonic
909202181 1:72704614-72704636 TAATTGAGAAAAACATGGCCAGG - Intergenic
909969270 1:81960093-81960115 TAATGAAAAAATACTTGGCCAGG - Intronic
912146659 1:106802639-106802661 TAAAGTGAAATCACATGGCCGGG + Intergenic
915546373 1:156600967-156600989 TAATTGAAAACTACATGCCCTGG + Intronic
916536069 1:165704420-165704442 TAAAGGAACAGCACAAGGCCGGG - Intergenic
920738188 1:208554623-208554645 TAAAACAAAACCACAGGGCCAGG + Intergenic
923402241 1:233626283-233626305 TAAAGAAGAACCACATTGCCAGG - Intronic
1064136194 10:12752948-12752970 TAATTGAAAAACAATTGGCCGGG + Intronic
1064220108 10:13433107-13433129 TAAAGGCAAATCACATGGGCTGG + Intergenic
1064554638 10:16536051-16536073 AGATGGAAAACCACATGACGGGG - Intergenic
1065623785 10:27610283-27610305 ACATGGAAAACTACATGGCAGGG + Intergenic
1071547379 10:86538784-86538806 GAAAGTAAAAGCACATGGCCGGG - Intergenic
1072754996 10:98013747-98013769 GAAAGGAAAACCACATGGGTTGG - Intronic
1075030778 10:119023420-119023442 TAAAAGAAAACCACATGGCAGGG + Intergenic
1075828992 10:125388132-125388154 TAATGGCAAAGCACTTGCCCTGG - Intergenic
1075878866 10:125832381-125832403 TAAAGGAAAACCACAACGCAAGG - Intronic
1076684616 10:132192410-132192432 GAGTGGAAAACCACAGGGCGTGG + Intronic
1077828899 11:5841684-5841706 CAATGGAATCCAACATGGCCAGG + Exonic
1077830046 11:5857477-5857499 CAATGGAATCCAACATGGCCAGG + Exonic
1078337902 11:10478213-10478235 AAATGGCAGACCACATGGCAGGG - Intronic
1081823452 11:46023044-46023066 TAATAGAAAATAACAAGGCCGGG - Intronic
1081881650 11:46457941-46457963 TAAAGGAAAACAGCATGGCTGGG - Intronic
1088373142 11:109113089-109113111 TCATGGAAATTCACATGGCAGGG - Intergenic
1088574799 11:111260296-111260318 TTATGGTAAACCACATGGTAGGG - Intronic
1088939042 11:114435270-114435292 TAATGGCATGTCACATGGCCAGG + Intronic
1090436992 11:126695332-126695354 CAATGGAAAAGCACTGGGCCAGG - Intronic
1090715328 11:129425443-129425465 ATATGGAAAACAGCATGGCCGGG + Intronic
1093152704 12:15642041-15642063 TAATGCAAAATCACAAGGCCAGG + Intronic
1094042985 12:26136728-26136750 TAATGGAAAATCACGTTGACAGG - Intronic
1094072023 12:26427211-26427233 TAATGAAATAACAAATGGCCAGG - Intronic
1094097464 12:26723356-26723378 CAATGGAAACCCTCATGGGCTGG + Intronic
1095370497 12:41461393-41461415 TAGAGGAAAACAACATGCCCTGG - Intronic
1096349005 12:50878617-50878639 TAATGGAACACAACATGGAGGGG + Intronic
1098084245 12:66824560-66824582 AAATGGACAACCACTTGTCCAGG - Intergenic
1098537202 12:71606356-71606378 TAATGGAAAACCATGTAGACTGG + Intergenic
1103110446 12:118272989-118273011 TAATGGAAAATCAGAAGTCCTGG - Intronic
1104274832 12:127317110-127317132 TAAATGAAAACCACATGACCTGG - Intergenic
1105843780 13:24277830-24277852 TCATAGAAAACCACCAGGCCTGG + Intronic
1108551991 13:51555643-51555665 CAATGGAATACCACACAGCCAGG + Intergenic
1108592788 13:51925703-51925725 TAGGGGAAAGCCACATGGTCAGG - Intergenic
1110451092 13:75637292-75637314 AAATGAAAAAGCACATGCCCCGG - Intronic
1110498472 13:76197545-76197567 TATTGGTACACTACATGGCCTGG - Intergenic
1110880624 13:80567862-80567884 TAATAGAAAACTAGATGCCCAGG - Intergenic
1111698913 13:91661386-91661408 CCATGGAAATCCACATGCCCAGG - Intronic
1111999965 13:95201010-95201032 TAAAGGAGAAACAAATGGCCAGG - Intronic
1114220688 14:20693678-20693700 TGATGCCAAACCACAGGGCCGGG + Exonic
1118157525 14:63256183-63256205 TAAGGGATAAACACGTGGCCAGG - Intronic
1119220562 14:72903325-72903347 ATATGGAAATCCACAGGGCCAGG + Intergenic
1120053980 14:79900444-79900466 CAATGGAACACCACTTAGCCAGG - Intergenic
1121399744 14:93663346-93663368 TAATGGAAAATCAGAAGGCAGGG + Intronic
1121619335 14:95335344-95335366 TGATGGAAAGACACATGGCATGG + Intergenic
1121665537 14:95669314-95669336 TAGTGGATAACCACAGGGCTGGG + Intergenic
1122712438 14:103669071-103669093 TTAAGAAAAACCACAGGGCCGGG - Intronic
1123192281 14:106582924-106582946 TAATGCAAAGACACATGCCCTGG + Intergenic
1202906394 14_GL000194v1_random:76011-76033 TCAAGGAAACCCAGATGGCCAGG + Intergenic
1126191379 15:45882492-45882514 TAAAGCAAAACAATATGGCCTGG - Intergenic
1126461137 15:48916196-48916218 TTATTGAAAACCACATGTACAGG + Intronic
1127662093 15:61109515-61109537 TAATTGAAAACAAGATGGGCTGG - Intronic
1128327255 15:66732234-66732256 TGATTTAAAACCACAAGGCCAGG - Intronic
1131369843 15:91871072-91871094 AAATGAAAAACCACAAGGCATGG - Intronic
1132885926 16:2181902-2181924 TCATGGACAGCCACACGGCCAGG + Exonic
1134355943 16:13482398-13482420 TTAAGGAAACCCACATGGCATGG - Intergenic
1138141117 16:54569313-54569335 AAATGAAAAACAACAAGGCCAGG + Intergenic
1141086908 16:81102292-81102314 TAATAAAGAACCACAAGGCCAGG - Intergenic
1141357587 16:83362953-83362975 TAAGGAAAAACCCCATGGACAGG - Intronic
1142066627 16:88066593-88066615 AAAAGTAAAACCACATTGCCTGG + Intronic
1145747969 17:27333938-27333960 TAAAGGAAAACATCAAGGCCGGG - Intergenic
1145899911 17:28483882-28483904 TAGTGGGAAAGCACATGTCCAGG - Intronic
1146231494 17:31114911-31114933 TAATGGAAAACCACAGCCACAGG - Intronic
1148477543 17:47939120-47939142 TGAAGAAAAACCCCATGGCCAGG + Intergenic
1150652650 17:67019983-67020005 TAAGGGAAACCCACAAGGGCTGG + Intronic
1150748577 17:67837704-67837726 TAATTTAAAACCACATAGGCTGG - Intronic
1150999225 17:70354241-70354263 AAAAGGAAAATAACATGGCCAGG + Intergenic
1151744908 17:76006828-76006850 GAATGGGACACCACATGGCACGG + Exonic
1155186177 18:23388613-23388635 TACTGGAGAAGCAAATGGCCAGG - Intronic
1155252896 18:23968437-23968459 TGATGAAAAACCAAATTGCCTGG + Intergenic
1155351786 18:24914246-24914268 TGATTGTAAACCCCATGGCCCGG - Intergenic
1157107134 18:44784521-44784543 TGATAGAAAAAGACATGGCCTGG - Intronic
1157279599 18:46337247-46337269 TAATGGAAAACCATTTTGCTGGG - Intronic
1157598452 18:48878132-48878154 TCAGGGAAAGCCACATTGCCGGG - Intergenic
1158224420 18:55185648-55185670 TTATTGAAAGCCACATGGCTGGG - Intergenic
1160463454 18:79056623-79056645 TAAAAGAAACCCACATAGCCAGG - Intergenic
1160568661 18:79801916-79801938 TAATGGGAAGCCACTTAGCCAGG + Intergenic
925163183 2:1701129-1701151 TAATGGAAAACCACATGGCCTGG - Intronic
925747203 2:7053594-7053616 TTAAGGAAACCCACATGGCATGG - Intronic
926997331 2:18750635-18750657 TAAGGGACCACCACATGGTCTGG - Intergenic
927194615 2:20538908-20538930 AAATGGAAACCCAGATGACCGGG - Intergenic
928397308 2:30952888-30952910 TAGTGGAAAACCCCTTGGCAGGG - Intronic
929950213 2:46404340-46404362 GAATGGAAAAACACATTACCTGG + Intergenic
930387128 2:50711218-50711240 TATTGAAAAACCACATTCCCAGG + Intronic
930665050 2:54093643-54093665 TAAATAAAAACCACTTGGCCGGG + Intronic
934273610 2:91562456-91562478 CCATGGAAAAAAACATGGCCAGG + Intergenic
936440665 2:112549363-112549385 AAATGGAAAACCAGAGGGCCTGG + Exonic
937202303 2:120211816-120211838 TAAAGTGAAATCACATGGCCAGG - Intergenic
937228297 2:120382354-120382376 TCATGGAGAACCTCATGGGCAGG - Intergenic
939271261 2:139943105-139943127 TATAGGCAACCCACATGGCCAGG - Intergenic
940515031 2:154673055-154673077 TAAAGCAGCACCACATGGCCAGG - Intergenic
941216082 2:162711115-162711137 TATGTGAAAACCACAAGGCCAGG + Intronic
941296997 2:163751389-163751411 TTATGAAAAACTACATGACCAGG - Intergenic
941930101 2:170929917-170929939 AGACGGAAAACCAAATGGCCTGG + Intronic
943654146 2:190489601-190489623 TAATGGAAAAACACAGGGCTGGG - Intronic
944468358 2:200026404-200026426 TAATGGAAGAGATCATGGCCTGG - Intergenic
945002533 2:205366803-205366825 TAGTGGGAAGGCACATGGCCTGG - Intronic
945814603 2:214589038-214589060 TAAGGGAATGCCACTTGGCCAGG - Intergenic
947586071 2:231357729-231357751 AAATAGAAAACCACTTTGCCTGG - Intronic
948629627 2:239293715-239293737 AACAGGAAAACCACGTGGCCAGG - Intronic
1168832017 20:851178-851200 TCTTGGAAACCCACATGGGCAGG - Intronic
1169414103 20:5401154-5401176 CAATGCAAAGCCACATGGCAAGG - Intergenic
1169913454 20:10666003-10666025 TCATGGAAAATCACAGAGCCAGG - Intronic
1170964407 20:21053150-21053172 AAATGCAAAAACCCATGGCCTGG + Intergenic
1172601956 20:36190256-36190278 TACTGGAAAACCAAAAGGGCAGG - Exonic
1172646114 20:36470826-36470848 CAATGGAAAGCCACATGCTCAGG - Intronic
1172936242 20:38622610-38622632 TAGGGGTAAACCACATAGCCTGG + Intronic
1173783611 20:45776186-45776208 TAATGGAGATCCACAGTGCCTGG + Intronic
1174826725 20:53775339-53775361 GAATGGAAAAGCAGAAGGCCAGG + Intergenic
1175526462 20:59638000-59638022 GAATAGAAAACTACATGGCCAGG + Intronic
1175605638 20:60310277-60310299 ACATGAAAGACCACATGGCCGGG + Intergenic
1178347104 21:31839445-31839467 TCATGGAAAACGCCATGGCGTGG + Intergenic
1181151400 22:20885929-20885951 TAATGTAAAACCACCAGGCCAGG - Intronic
1181717344 22:24741217-24741239 TGATTAAAAACCTCATGGCCAGG + Intronic
1182216800 22:28725563-28725585 TTATCTATAACCACATGGCCAGG + Intronic
1182583928 22:31332190-31332212 TATAGCAAAACCACATGGCGGGG + Intronic
1183228331 22:36565102-36565124 TAATGGAAACAGACATGGGCAGG + Intronic
1184844769 22:47074926-47074948 TAATAGAGAACCAAAGGGCCAGG + Intronic
1185100453 22:48838033-48838055 AAATGGAAATTCACATGGTCAGG - Intronic
949643049 3:6061465-6061487 TAACGGAAAACCATATGGAGAGG + Intergenic
952411704 3:33055206-33055228 GAATAGACAACCACAAGGCCAGG - Intronic
953117330 3:40006140-40006162 TAATAGGAACTCACATGGCCTGG - Intronic
954215588 3:49122663-49122685 AAGGGGACAACCACATGGCCTGG + Intronic
955018187 3:55091826-55091848 TGATGGAAAACCATCTGGCGTGG + Intergenic
956318212 3:67964164-67964186 TAATGGAAGATCAAATGACCAGG + Intergenic
957517173 3:81270388-81270410 CAATAGAAAACCACATGGCCAGG + Intergenic
958142928 3:89586851-89586873 TAAAGTGAAATCACATGGCCAGG + Intergenic
960232748 3:115247343-115247365 AAATGGAAAACCATATCCCCAGG - Intergenic
961733996 3:128989200-128989222 TAAAGTGAAATCACATGGCCAGG + Intronic
962438579 3:135390347-135390369 TAATAGAAAACTACATGGAGGGG - Intergenic
963288864 3:143465941-143465963 TAATGCATAACCAGTTGGCCTGG + Intronic
964352281 3:155815060-155815082 TAATGGAAAACAATATGGAAAGG + Intergenic
965238645 3:166161855-166161877 TAAAGTGAAATCACATGGCCAGG + Intergenic
965643221 3:170853757-170853779 TAAGGGACAACCACATGCTCAGG - Intronic
967387004 3:188921653-188921675 TAGTGGAAAAGCACAGGGCTTGG + Intergenic
967585444 3:191208724-191208746 TAAAGGAAATCCACATGGAAAGG + Intronic
967610591 3:191501143-191501165 TAATAGAAAGCCACATGGTGTGG - Intergenic
969617966 4:8264852-8264874 AAATGGAGGCCCACATGGCCAGG + Intergenic
969677576 4:8622658-8622680 TAAAGGGAAAACACAAGGCCAGG + Intergenic
969678531 4:8628299-8628321 TAAAGGGAAAACACAAGGCCAGG + Intergenic
969679487 4:8633933-8633955 TAAAGGGAAAACACAAGGCCAGG + Intergenic
970225197 4:13850339-13850361 TAAATGAAAACCACATGGGAGGG + Intergenic
971496658 4:27273942-27273964 TAATGGAAACCAACAAGACCAGG - Intergenic
972257948 4:37379120-37379142 CAGTGGAAAACCACATGACAGGG + Intronic
974667583 4:64985093-64985115 TCATTGAAAACCAAATGGCTTGG - Intergenic
974825737 4:67127349-67127371 TGATGGAAAAACTGATGGCCTGG + Intergenic
975614103 4:76229849-76229871 TCATGGCTAACCAGATGGCCTGG - Intronic
978616834 4:110606004-110606026 TAGTGGAAAACCACTAGTCCTGG - Intergenic
982442927 4:155457849-155457871 TAAAGTGAAATCACATGGCCAGG + Intergenic
987873866 5:23654702-23654724 TAATGGAAATCCCCTTGGTCTGG + Intergenic
989675882 5:43971770-43971792 GATTGGAAAGCCACATGGTCAGG - Intergenic
992276752 5:75128807-75128829 TAAAGTGAAACCACTTGGCCAGG - Intronic
992426849 5:76666691-76666713 TTATAGAAAAGCAAATGGCCTGG + Intronic
993910362 5:93675269-93675291 TAAAGAAAAACTACATGTCCTGG + Intronic
995794044 5:115923524-115923546 TAATGGAAAACCCAATGTACTGG + Intergenic
997371693 5:133365575-133365597 TCATGGGAAACCAGAGGGCCAGG - Intronic
998506897 5:142679413-142679435 TCCTGAAAAACCACATGGCAGGG - Intronic
1003155107 6:3587072-3587094 TTATTGAAAATAACATGGCCAGG + Intergenic
1003970243 6:11292220-11292242 CACTGAAAAACCACATGACCCGG + Intronic
1005333230 6:24768880-24768902 AAATCAAAAAACACATGGCCGGG - Intergenic
1007039187 6:38705726-38705748 TAATTGAAAACCCCTGGGCCAGG - Intergenic
1011036780 6:82985655-82985677 AAAAAGAAAACCACATGGCCGGG - Intronic
1011233569 6:85190479-85190501 GAATGAAAAACCAAATGGGCTGG - Intergenic
1011856755 6:91702514-91702536 TTTTGGAAAGCCACAAGGCCAGG - Intergenic
1011995618 6:93583679-93583701 TAAGGAAAATCCAAATGGCCAGG - Intergenic
1012956693 6:105578610-105578632 TAATGGAATTCCACATAGCAAGG + Intergenic
1014863837 6:126504469-126504491 TAAAAGAAAACCCCAGGGCCGGG - Intergenic
1015915984 6:138217079-138217101 TAAAGGAAAATCACATCTCCAGG - Exonic
1016146017 6:140674966-140674988 TAAGAGTAAACCACTTGGCCGGG + Intergenic
1016546675 6:145231957-145231979 TAATGGAAGACCACAGAGGCTGG + Intergenic
1016779733 6:147944293-147944315 TAATGGCCTCCCACATGGCCGGG + Intergenic
1017883980 6:158583504-158583526 GAAAGGAAAACCTCATGGCCGGG + Intronic
1019853790 7:3584557-3584579 GAATGGGAAAGCACCTGGCCAGG - Intronic
1021254140 7:18369013-18369035 TAATGTGAAAGCACTTGGCCAGG - Intronic
1022394055 7:29969908-29969930 TAATGGAGAAGCAAATGGCAAGG - Intronic
1024426074 7:49227904-49227926 TAACAGAAAACCATCTGGCCAGG - Intergenic
1026238192 7:68547625-68547647 AAATGGAAAAGCTCATAGCCTGG - Intergenic
1026322908 7:69283116-69283138 AACTGAAAAACCAGATGGCCTGG - Intergenic
1026675950 7:72428108-72428130 TGATGGAAAACAGCATGGCAGGG - Intronic
1029932484 7:104387205-104387227 GAATTGAAAAGTACATGGCCAGG + Intronic
1030606241 7:111641919-111641941 AAATGCAAATACACATGGCCGGG - Intergenic
1030638657 7:111978872-111978894 TACAGGAAAAACACATGGCTAGG + Intronic
1032347314 7:131128233-131128255 AAATGGAAAAACATGTGGCCAGG + Intronic
1032998834 7:137480491-137480513 TAATGGAATACAACATAGGCTGG + Intronic
1033592961 7:142829448-142829470 TATTGAAACTCCACATGGCCGGG + Intergenic
1033825255 7:145181794-145181816 TCATTTAAAACCACCTGGCCAGG + Intergenic
1033947204 7:146735225-146735247 TAATGTAAAACCATATTGACTGG - Intronic
1034495035 7:151415363-151415385 AAATGGAAAATCACAAGGGCTGG + Intergenic
1035126583 7:156612157-156612179 TAAGGGAAATCCAGTTGGCCTGG - Intergenic
1036928552 8:12930974-12930996 AAAGGGAAAACCACATGCCCTGG - Intergenic
1038487769 8:27948944-27948966 TTATAAAAACCCACATGGCCAGG + Intronic
1041412824 8:57575376-57575398 TAATGCGAAAGCACAAGGCCTGG + Intergenic
1042331731 8:67587623-67587645 TAAAGTGAAATCACATGGCCAGG + Intronic
1043136257 8:76529742-76529764 AAATTTAAATCCACATGGCCTGG - Intergenic
1044446036 8:92277242-92277264 TGAGGGAAAATCACATGGCCAGG + Intergenic
1045473164 8:102530924-102530946 TAATGGAAGACCACAAGGTCAGG - Intronic
1048455372 8:134573490-134573512 TAACTGAAAACTACAGGGCCAGG - Intronic
1050386876 9:5100325-5100347 TAAAGTGAAATCACATGGCCAGG - Intronic
1056569800 9:87805324-87805346 TAATTGTAAAAAACATGGCCAGG - Intergenic
1058802788 9:108561106-108561128 TATTTGAAAACCTCAAGGCCAGG - Intergenic
1058835062 9:108853391-108853413 TAATGGACAACCACATTGGTAGG - Intergenic
1059148481 9:111924082-111924104 AAATGTAAACACACATGGCCAGG - Intronic
1059348346 9:113647409-113647431 CCAAAGAAAACCACATGGCCAGG + Intergenic
1185555936 X:1021145-1021167 CAATGGAATACTATATGGCCAGG - Intergenic
1185596242 X:1308661-1308683 TAATGGAATGACAGATGGCCAGG - Intronic
1186110241 X:6247680-6247702 TAAAACAAAACCACATGTCCTGG + Intergenic
1192187934 X:68966501-68966523 AAACAGAAAACCACAAGGCCAGG - Intergenic
1194100299 X:89694891-89694913 TAATTTAAAAACACCTGGCCTGG + Intergenic
1195303418 X:103554925-103554947 TAATGGAGACCGACTTGGCCTGG - Intergenic
1195306437 X:103587343-103587365 TAACGTTAAAGCACATGGCCTGG - Exonic
1196465430 X:115967819-115967841 GAATGTAAAACCACATGTTCTGG + Intergenic
1197656229 X:129119098-129119120 AAATAGAAAACCACATATCCAGG - Intergenic
1198223095 X:134621065-134621087 TAATGGAAAACAAACTGGTCTGG - Intronic
1199735019 X:150677937-150677959 TAATGGAATACTACACGCCCAGG + Intergenic
1200453302 Y:3356250-3356272 TAATTTAAAAACACCTGGCCTGG + Intergenic
1201734060 Y:17238290-17238312 TAATGGAAAGCCACAAGGTTAGG + Intergenic