ID: 925163184

View in Genome Browser
Species Human (GRCh38)
Location 2:1701134-1701156
Sequence AATGTTAATGGAAAACCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 346}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925163184_925163188 15 Left 925163184 2:1701134-1701156 CCATGTGGTTTTCCATTAACATT 0: 1
1: 0
2: 1
3: 23
4: 346
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925163184 Original CRISPR AATGTTAATGGAAAACCACA TGG (reversed) Intronic
907013857 1:50991928-50991950 AATATTAAGGGAAAAAAACAAGG - Intergenic
907312800 1:53548721-53548743 AAGGTTCATGGATGACCACAGGG - Intronic
907421788 1:54352581-54352603 AATGTTAATGGAACAAGGCAAGG + Intronic
908448282 1:64223387-64223409 AATGTAGTTGGAAGACCACAGGG + Intronic
908696725 1:66851298-66851320 AATGTTTATGCAAAAAAACAAGG + Intronic
908924902 1:69242300-69242322 AATTTTAACACAAAACCACAAGG + Intergenic
909679314 1:78274179-78274201 AATGGTAATTTAAAACCTCAGGG - Intergenic
909836031 1:80255957-80255979 AATGTTAGTGGGTAACTACATGG - Intergenic
909921227 1:81382863-81382885 AATGTTAGTTGAAATCCTCATGG - Intronic
910125294 1:83834719-83834741 AATATTTAGGGAAAACTACAGGG + Intergenic
910992548 1:93071433-93071455 AAAGTAAATTGAAAACCACCTGG + Intergenic
912902859 1:113671538-113671560 AACGTTAATCAAAAGCCACAGGG + Intronic
913013975 1:114714022-114714044 AATTTTTATTAAAAACCACAGGG + Intronic
913414911 1:118594413-118594435 AAATTTAGAGGAAAACCACATGG + Intergenic
914325426 1:146610542-146610564 AATTTAAATGGAAAATCAAAGGG - Intergenic
916150885 1:161788659-161788681 AATGTGAAAGGTAAACCATATGG - Intronic
916387886 1:164297469-164297491 AATAATAATGGAAAACGACTGGG + Intergenic
916472147 1:165134605-165134627 CATGTTAATGGAACGCCACATGG + Intergenic
916737739 1:167622983-167623005 AGTGTTGATGGAAAACCCAAGGG - Intergenic
916767035 1:167870915-167870937 AATGAAACTGCAAAACCACATGG - Intronic
917353163 1:174099421-174099443 AAAGTCAATGGAAAACCTTATGG - Intergenic
917950176 1:180024580-180024602 AATGTAAGTGGAATTCCACATGG + Exonic
918758428 1:188368564-188368586 CATGTTCATGTAAAACCAAAAGG - Intergenic
920034090 1:203054555-203054577 AATGTTAATGACAAACAGCAGGG + Intronic
920957487 1:210632863-210632885 GAAGATAATGTAAAACCACAGGG + Intronic
922065718 1:222139681-222139703 GATGTTATTGGAAAGCCTCATGG + Intergenic
923303893 1:232670611-232670633 ACTTTTAAAGGGAAACCACATGG - Intergenic
1063110342 10:3030262-3030284 AATTTAAATGGTAAACCAAATGG + Intergenic
1063323874 10:5077764-5077786 CATGTTAATGTAAAACTAAATGG - Intronic
1064019664 10:11799052-11799074 AATTTGAATGCAAAACTACAGGG + Intergenic
1064931495 10:20633336-20633358 AATGATAATGGGAAACATCAAGG - Intergenic
1065662897 10:28024367-28024389 AATGTTAATTGCAAACCCTAAGG - Intergenic
1065767967 10:29049587-29049609 ACTGTTACTGGAAACTCACAAGG + Intergenic
1065999844 10:31094092-31094114 AATGTAAATGGAAAAGCAAATGG - Intergenic
1066215248 10:33280122-33280144 AATGTTAATGGAAAAATATTTGG + Intronic
1067533382 10:47090932-47090954 AGTGTTAAAAGAAAACCACAAGG - Intergenic
1067997368 10:51289208-51289230 AATGTTGATGAACAACCAGAAGG - Intronic
1068626326 10:59252543-59252565 AATATTAATGAAAATCCAAATGG + Intronic
1068830333 10:61486885-61486907 AAGGTCATTGAAAAACCACAAGG - Intergenic
1068981336 10:63065707-63065729 ACTGTTAATGGAATTCCATATGG - Intergenic
1070210100 10:74308529-74308551 AATGTTAATAGAATAACACAGGG - Intronic
1071009481 10:80920844-80920866 AATAATTATGTAAAACCACAAGG + Intergenic
1071088965 10:81897263-81897285 TGTTGTAATGGAAAACCACAGGG + Intronic
1071164554 10:82789870-82789892 AATGTTCATTGTAATCCACAGGG - Intronic
1074608512 10:114998940-114998962 ACTGTTAAGGGCAAACTACAGGG - Intergenic
1075288345 10:121206509-121206531 AATGTTATTAGAAAATCATAAGG + Intergenic
1075470337 10:122684065-122684087 TGTGATAATGGAAAACAACAAGG + Intergenic
1078275114 11:9836609-9836631 AATGTTAATGGAAACTGAAAAGG - Intronic
1078701668 11:13690713-13690735 AATGTTTATGGAAATACAAAGGG - Intronic
1079019657 11:16899081-16899103 AATCTAAATGGAAAAGCAAAAGG + Intronic
1079040432 11:17054314-17054336 AATGTTACTTGTAAATCACAGGG - Intergenic
1079334153 11:19556237-19556259 ATTGTAAATGGTAAACCACAGGG + Intronic
1080338937 11:31233947-31233969 AATTTTAATTTAAAAACACAAGG + Intronic
1080566509 11:33514423-33514445 AATGTTGATGGAAAACCCTGTGG - Intergenic
1080979880 11:37389232-37389254 AAGGTTAAATGAAAACAACATGG - Intergenic
1081030479 11:38074622-38074644 AATGTTAAGCTAAAACCATATGG - Intergenic
1081448048 11:43148959-43148981 AATATTAAAGAAAAATCACAAGG + Intergenic
1083380229 11:62261496-62261518 AATGTTAATGCACAAACACATGG - Intergenic
1084249814 11:67888781-67888803 AATTTTTATGGACACCCACACGG + Intergenic
1086186463 11:84022845-84022867 AATGTTAATGGAATTCCTCAAGG + Intronic
1086403892 11:86483882-86483904 AATGTGAATGGAAACCATCAGGG + Intronic
1087449079 11:98294634-98294656 AATGTAAATGGAAATTCAAAAGG - Intergenic
1087467031 11:98521592-98521614 AATGTTAATAGAAAATGACTTGG - Intergenic
1087515154 11:99150788-99150810 AAAGTTAATCCCAAACCACAAGG - Intronic
1088121149 11:106371480-106371502 GATTTAAATGGAAAACCAAATGG - Intergenic
1088462384 11:110094186-110094208 ATTGTTAACGGATAACCAAATGG - Intronic
1088616066 11:111629743-111629765 AATGCAAATTAAAAACCACAGGG + Intronic
1088618341 11:111656572-111656594 AAGGTTAATGGAAAGAAACAGGG + Intronic
1088775884 11:113082410-113082432 AGTCTTATTGTAAAACCACAGGG + Intronic
1089661153 11:119986360-119986382 AATGTTATTTGAAAATCATAAGG + Intergenic
1089911774 11:122108039-122108061 AATGCTAATGGAAAACAGAATGG - Intergenic
1092405275 12:8217432-8217454 AAAGTTCATGGATGACCACATGG - Intergenic
1092594855 12:9990274-9990296 AAAGTAAATTGAAAACCACCTGG + Intronic
1092599896 12:10048903-10048925 AAAGTAAATTGAAAACCACCTGG - Intronic
1092881933 12:12893311-12893333 AATGGTAATCGAAGACAACAGGG + Intronic
1094081122 12:26536925-26536947 AATAACAATGGGAAACCACAGGG + Intronic
1094296051 12:28906670-28906692 AATGTTAATTGCAATCCCCAGGG + Intergenic
1094787750 12:33870424-33870446 GAGGCTAATTGAAAACCACAAGG + Intergenic
1095260062 12:40087467-40087489 AAGGTTATTTGAAAGCCACAGGG - Intronic
1095510412 12:42945585-42945607 AATGTTAAAGGAAATCCATTTGG - Intergenic
1095591889 12:43912737-43912759 TATATTAATTGAAAATCACATGG - Intronic
1095600898 12:44012196-44012218 AATCTTAAAAGAAAACCAGAGGG - Intronic
1096331352 12:50715900-50715922 AATTTTATTGGAAAATCAGAAGG + Intronic
1097379255 12:58875568-58875590 AATGAAGATGGAAAACTACATGG - Intronic
1097500474 12:60394165-60394187 ACTCTTAATTGAAAACCAGAGGG + Intergenic
1097550114 12:61057241-61057263 AAAGTAAATCAAAAACCACATGG + Intergenic
1097853267 12:64435238-64435260 AATGATTAGGGAAAACCACTAGG - Intronic
1098252384 12:68583917-68583939 TATGTTAATGGAAAAATAAAAGG - Intergenic
1098600335 12:72323939-72323961 AATATTTATTGAAAACCCCAAGG + Intronic
1099847431 12:88045758-88045780 AATATCAATGGAAACCCATATGG + Exonic
1100331855 12:93590357-93590379 AATGTTATTGGAAAATAAAAGGG - Intergenic
1100344485 12:93714369-93714391 AAGTTTAAAGGAAAAGCACAGGG - Intronic
1100874148 12:98944508-98944530 AATGCAAATGGAAGAACACAGGG + Intronic
1101072553 12:101091114-101091136 AAAATAAATGAAAAACCACAAGG - Intronic
1101254964 12:102967453-102967475 AATGTTCAAAGAAAACCAAAAGG - Intergenic
1101655138 12:106713426-106713448 AATGGAAATAGAAAATCACAAGG + Intronic
1102247613 12:111365155-111365177 AATGGCCATGGAAAACCCCAAGG - Intronic
1106122947 13:26876797-26876819 AAAGCTAATGGAAGACCACCAGG - Intergenic
1106212275 13:27660894-27660916 ATTGGTAATGGAATAGCACAAGG + Intronic
1106871141 13:34022408-34022430 GATGTTTATGCATAACCACAAGG + Intergenic
1107659058 13:42620536-42620558 GATCTGAATGTAAAACCACAGGG + Intergenic
1108058761 13:46511817-46511839 AATATTAATGGAGAATCACATGG + Intergenic
1108231046 13:48341260-48341282 AATGTTATTTGAAAATCAAAAGG - Intronic
1108744610 13:53378826-53378848 AATGTTAAAAGAAAAACAAAGGG - Intergenic
1109046070 13:57412260-57412282 GATGTTATTGGCAAGCCACATGG + Intergenic
1109374223 13:61468823-61468845 AAAGATAATGGAAAACAGCAGGG + Intergenic
1110267267 13:73552549-73552571 AAAGTTAATAGAAAACAAAAGGG - Intergenic
1110463382 13:75772846-75772868 AATGTGCATGGAAAACAACCAGG + Intronic
1111106611 13:83653336-83653358 AATGTAAATGGAAAACAGGAAGG + Intergenic
1111186801 13:84747918-84747940 ACTGTTAATTGAAAACAAAATGG + Intergenic
1111329431 13:86745125-86745147 GATATTAATGGAAAACAAGATGG - Intergenic
1111795113 13:92909585-92909607 ACTGTTAAAGGAAAACCAAATGG - Intergenic
1111854826 13:93624538-93624560 ACTTTTAGAGGAAAACCACAAGG - Intronic
1113032066 13:106004734-106004756 AATATTTATGGAAAACCTCTTGG - Intergenic
1114722014 14:24892605-24892627 AATGCTCATGGAAGACAACATGG - Intronic
1114753911 14:25236891-25236913 AATTTTGATGGAAAATCATAAGG + Intergenic
1115482232 14:33872092-33872114 AATTTTAATGTTTAACCACAAGG - Intergenic
1116338382 14:43689582-43689604 CAAGTTACTGGAAAAGCACAAGG - Intergenic
1116629590 14:47312852-47312874 AATAATAATGGAAAATCAAATGG + Intronic
1117040155 14:51761979-51762001 CATGTTAATCGTAAATCACAGGG + Intergenic
1118048288 14:61996521-61996543 ACTGTTAATGGAAAAAAGCAAGG + Exonic
1118703273 14:68456020-68456042 AATGTTAATGGCAATCCTCAGGG + Intronic
1119799491 14:77430411-77430433 AATGTTAAAGAAAAACAAAATGG + Intronic
1120024464 14:79567379-79567401 TATGTTAATGGGAAACAAAATGG + Intronic
1120049082 14:79844255-79844277 AAGTTTAATGCAAAACCTCATGG - Intronic
1120705628 14:87742680-87742702 AATGTTAAGGACAAACCAGAAGG + Intergenic
1124891347 15:33736649-33736671 CAATTTAATGAAAAACCACAGGG - Intronic
1124913149 15:33942894-33942916 AATGTTAAAGGTAAAACAGAAGG - Intronic
1125227025 15:37407283-37407305 AATGTTAAAGGAAAACCACTGGG - Intergenic
1125285742 15:38090632-38090654 CATGTTAGTGGAAAACAACTAGG - Intergenic
1125909605 15:43424319-43424341 AATGTTAGTGGATAACAACTAGG - Intronic
1127540479 15:59933625-59933647 AATGTTAATGGAAGTTAACAGGG - Intergenic
1128854578 15:70998003-70998025 AATGTTAATTGTAATCCCCAGGG - Intronic
1129817029 15:78564682-78564704 AATGTTAATTGATGACAACACGG + Intergenic
1133498518 16:6343294-6343316 AATGATAATGAAATACCACCAGG - Intronic
1138035702 16:53603650-53603672 AAAGTTCAAGGAAAACCATAAGG - Intronic
1138742745 16:59329837-59329859 AGTTTTAATGAATAACCACAGGG + Intergenic
1140008135 16:71100405-71100427 AATTTAAATGGAAAATCAAAGGG + Intronic
1150652648 17:67019978-67020000 GAGGTTAAGGGAAACCCACAAGG + Intronic
1151103085 17:71578141-71578163 AAAGCTAATGAAAAGCCACAAGG + Intergenic
1153275863 18:3367200-3367222 AATGTTTATGGAAAAGAAGATGG + Intergenic
1153624164 18:7007412-7007434 AATGCAAATGAAAAAACACAAGG + Intronic
1153696597 18:7649447-7649469 AAAGTAAATGGAAAACCTCCTGG + Intronic
1154372834 18:13780249-13780271 GAAGTCAATGGAAAGCCACAAGG + Intergenic
1155384482 18:25262297-25262319 CATGTGAATGTAAAACCCCAGGG - Intronic
1155516470 18:26628270-26628292 AATGTCATTGGTCAACCACATGG - Intronic
1158738911 18:60116632-60116654 AACCTCAATGGAAAACCATATGG + Intergenic
1159467147 18:68798199-68798221 AAATTAAATAGAAAACCACAAGG - Intronic
1160108556 18:76003383-76003405 AATGTAAATGGCAAACCCAAAGG + Intergenic
925163184 2:1701134-1701156 AATGTTAATGGAAAACCACATGG - Intronic
925427421 2:3762288-3762310 TGTGTAAGTGGAAAACCACAAGG + Intronic
926975185 2:18508373-18508395 AATGTATATGGAAAAGCAAAAGG - Intergenic
927834876 2:26387240-26387262 AAAGTGAAAGAAAAACCACATGG - Intronic
929752942 2:44736163-44736185 AATGTTAAAGGAAATCCTTAAGG - Intronic
930819196 2:55628298-55628320 AATATTAAGAGAAAACCATATGG - Intergenic
931910194 2:66890707-66890729 AATTCTGATGGAAAAGCACATGG - Intergenic
934507433 2:94905220-94905242 AATATTACTGGCAAATCACAGGG + Intergenic
936910168 2:117582530-117582552 AATGATAATGGGAAACATCAAGG - Intergenic
937098799 2:119252843-119252865 AATGTTAGAGGAAAAAAACAAGG + Intronic
937174488 2:119915495-119915517 GATGTTCATTGAAAACCTCAGGG + Intronic
937228299 2:120382359-120382381 AATGTTCATGGAGAACCTCATGG - Intergenic
937774695 2:125762462-125762484 CATGTGAATGAAAAACCTCAGGG + Intergenic
938134775 2:128747210-128747232 ATTTTTAATGGAAATCCAAATGG + Intergenic
938218100 2:129539773-129539795 GATGTTAATTGCAATCCACAGGG + Intergenic
938940266 2:136163626-136163648 AATGTAAGTGGAAGACAACAGGG + Intergenic
939077070 2:137616336-137616358 AATGTTCAGGGAGAACGACAAGG - Intronic
939342962 2:140924602-140924624 AATTGTAATAGAAAACCACTAGG + Intronic
940101749 2:150048140-150048162 AATGTTTATGGAAATCCCGAAGG - Intergenic
941630014 2:167874109-167874131 AAGGTTAATGGTAAACGGCAGGG - Intergenic
942323965 2:174759793-174759815 ACTGTAATTGGAAAAACACAAGG - Intronic
943193539 2:184713085-184713107 GACGCTAATGGAAAGCCACAAGG - Intronic
943838556 2:192548266-192548288 AAATTTTATGGAGAACCACATGG - Intergenic
944943943 2:204661272-204661294 AATGTTAGTGTGAATCCACAAGG + Intronic
946820387 2:223622653-223622675 GATGTTAATGGATACACACAGGG - Intergenic
947098158 2:226590489-226590511 AATGTTAAGGGAAGCCCAAAAGG - Intergenic
948047506 2:234955003-234955025 AAAGCTAAGGGAAATCCACATGG - Intronic
948111778 2:235462069-235462091 GATGTAAATGCAAAACCAAAAGG + Intergenic
949061992 2:241966301-241966323 AATGGGATTAGAAAACCACAAGG - Intergenic
949067388 2:242001354-242001376 TGTGTTTATAGAAAACCACAAGG - Intergenic
1170253055 20:14307222-14307244 AATATTAATTCAAAACCAAAAGG + Intronic
1170921120 20:20680491-20680513 GATGTTAATTGAACAACACATGG - Intronic
1171088055 20:22257116-22257138 AATATTCATGGAAAACTACAAGG + Intergenic
1171269000 20:23798916-23798938 ATTCATAATGGAAAACCACGTGG - Intergenic
1171428895 20:25066464-25066486 AATATGAAAAGAAAACCACAAGG - Intergenic
1172201281 20:33127814-33127836 AAAGCTAATTGAAAACCACCTGG - Intergenic
1173015819 20:39224647-39224669 AATTTTACTGGAAAACAAAAGGG - Intergenic
1173399464 20:42711406-42711428 CATGTGAATGGATTACCACAGGG - Intronic
1173775231 20:45700216-45700238 ATTGTTAAATGAAAACAACAAGG + Intronic
1174756716 20:53166261-53166283 AATGTTCATTGAAAACCAACTGG + Intronic
1174950566 20:55037247-55037269 AATGGTTATAGAAAACCTCAAGG + Intergenic
1177687257 21:24453051-24453073 TATGTAAATGGAAAACCAGTGGG + Intergenic
1178934187 21:36846826-36846848 AATGTTGCTGAAGAACCACATGG - Intronic
1179666637 21:42917319-42917341 AGTTTTAATGGGATACCACAGGG + Intergenic
1180128341 21:45806965-45806987 AAAATTAATGAAAAGCCACAAGG - Intronic
1180697922 22:17765206-17765228 AAAGTTAATAGAATACCGCAGGG - Intronic
1183325042 22:37186784-37186806 AATGTTAAAGGAGAACAAAAAGG - Intronic
1183337280 22:37257041-37257063 ATAGTTAATGGAAACCAACAAGG - Intergenic
949612693 3:5719107-5719129 AATGCTAATGGAACATTACATGG + Intergenic
951865430 3:27301563-27301585 AATGTAAAGTGAAATCCACATGG - Intronic
952559217 3:34570209-34570231 AATGTATATGGAAAAGCAAAAGG - Intergenic
952830360 3:37559717-37559739 AACCTTTAAGGAAAACCACACGG + Intronic
956152223 3:66255780-66255802 AGAGTTAATAGAAAACCAAATGG + Intronic
957308069 3:78484242-78484264 AATGTTAAAGGAAATCCTAAAGG + Intergenic
957374791 3:79341742-79341764 AATATTAATGGAAAAATATATGG - Intronic
958587731 3:96112508-96112530 AATGTTAATTGTAATCCCCAGGG - Intergenic
958834232 3:99125409-99125431 AACTTTAATGGAATACCAAAAGG + Intergenic
959712287 3:109397198-109397220 AATATCAATGGAAACCCATATGG + Intergenic
961399326 3:126624755-126624777 AATGGTACTGGATATCCACACGG + Intronic
961856719 3:129878805-129878827 AATTTTAATAGAAACCCCCAAGG + Intronic
962438582 3:135390352-135390374 AATTATAATAGAAAACTACATGG - Intergenic
962453179 3:135538987-135539009 AATGTTAATGGAAAGCATCCTGG + Intergenic
963179752 3:142341735-142341757 AATGTCAATGGAAACCAAAATGG + Intronic
964175421 3:153821921-153821943 CATGTGAATGGCCAACCACAAGG + Intergenic
964352280 3:155815055-155815077 AGTTTTAATGGAAAACAATATGG + Intergenic
964354163 3:155834214-155834236 AATATTATTAGAAAACCATAAGG - Intronic
965313069 3:167155989-167156011 AATGTTATTGGAAGGCCAAAAGG + Intergenic
965394433 3:168144427-168144449 AATGTCTATGGAAAACAGCATGG - Intergenic
965875313 3:173310612-173310634 AATGTTAAAGAAAAGCCAAAAGG + Intergenic
965949149 3:174282640-174282662 ACTGTTACTGGTAAACAACAGGG - Exonic
966566368 3:181386259-181386281 AATGTTAAGGGACAAAGACAAGG + Intergenic
966783455 3:183604481-183604503 ATTGTTAATGTAAAACAATATGG - Intergenic
967585443 3:191208719-191208741 ATAGTTAAAGGAAATCCACATGG + Intronic
968298120 3:197592904-197592926 AACGTCTATGGAAAAACACAAGG + Intergenic
968339441 3:197942460-197942482 AATTTTAATGGAAAATTAAAGGG + Intronic
969760839 4:9180539-9180561 AAAGTTCATGGATGACCACATGG + Intergenic
970705154 4:18792588-18792610 TATGCAAATGGAAAAACACATGG + Intergenic
970976669 4:22049713-22049735 AATGTTAATTGGGAACCACCAGG - Intergenic
971117720 4:23667492-23667514 AATGTCTCTGGAAGACCACAGGG - Intergenic
971579378 4:28315289-28315311 AATCCTAATGGAAAGGCACAAGG - Intergenic
972426509 4:38938095-38938117 AATTTGAATGGAAAGACACAGGG - Intronic
972591363 4:40491062-40491084 AATCTTAGGGGAAAACCATAAGG + Intronic
973011834 4:45085346-45085368 GATGTTACAGGAAAACCATATGG - Intergenic
973127663 4:46607904-46607926 AATGTTAATGAAATACCTCTCGG - Intergenic
974176073 4:58326861-58326883 ATTGTGATTGGAAAACCACTAGG - Intergenic
974510046 4:62827601-62827623 TATATTAATGGCTAACCACAGGG + Intergenic
974516931 4:62927878-62927900 TATGTTTCTGGAAAAACACATGG - Intergenic
975038687 4:69716417-69716439 AATGTATATGGAAAAACAAAAGG + Intergenic
975216125 4:71757359-71757381 ATTTTTAATGGAAAAAGACAAGG + Intronic
975668417 4:76755809-76755831 AATGTTTAGGGAAAACCTCTTGG + Intronic
975719569 4:77236650-77236672 AAGGTTTATGTAAAAGCACATGG + Intronic
975998057 4:80339269-80339291 AAAATTAATGGAAACCAACATGG - Intronic
976187313 4:82454909-82454931 AATCTTAATGGAAAACTAATTGG + Intronic
977046784 4:92078293-92078315 AATGTTATTAGAAAAACAAAAGG - Intergenic
977280802 4:95037457-95037479 AATGGAAAAGGAAAAGCACATGG + Intronic
977512837 4:97983230-97983252 AATGTTATTAAAAAATCACAAGG - Intronic
977598258 4:98907819-98907841 ATTGTTGATGAAAACCCACACGG - Intronic
977674075 4:99728837-99728859 AATTTTAATGTTTAACCACAAGG + Intergenic
977767388 4:100815613-100815635 AAGGTAAATGGAAAACATCAAGG - Intronic
978104063 4:104880337-104880359 AATGTGAATGAAAAAACAAATGG + Intergenic
978730047 4:112015050-112015072 AATGTAAATGGAAAAAGAGAGGG - Intergenic
978934920 4:114362667-114362689 AATGTGAAATGAAAACCAGAAGG - Intergenic
978935619 4:114371516-114371538 AATGTTATAAGAAAACCACAAGG - Intergenic
979019630 4:115479784-115479806 AATATTAATTAAAAAACACAAGG - Intergenic
979375289 4:119939215-119939237 AGTGGTGATGGAAAACCAAATGG - Intergenic
979836052 4:125369106-125369128 TATTTTAATGGAAAAGCAAAAGG - Intronic
981334617 4:143556348-143556370 AATTTTTCTGAAAAACCACAGGG - Exonic
981643835 4:146975337-146975359 CATGTTAATGGAAAAAAAAAAGG - Intergenic
981893322 4:149765590-149765612 AAAATTAATGAAAGACCACAGGG + Intergenic
982185813 4:152797399-152797421 ATTGAAAAAGGAAAACCACAAGG - Intronic
982302685 4:153896127-153896149 AATCCTAATTGAAACCCACAAGG - Intergenic
983724371 4:170901887-170901909 AATTTTGATTTAAAACCACAAGG + Intergenic
986413764 5:7507786-7507808 AAGGTTAATGGAACACCATGAGG - Intronic
986945317 5:13011201-13011223 AATGGCAATGGAGAAACACAAGG - Intergenic
987398966 5:17455003-17455025 AATTATAAAGGAAAACCAGAGGG + Intergenic
987481348 5:18462548-18462570 AATGTATATGGAAAAGCAAAGGG + Intergenic
988287996 5:29246563-29246585 AATGAAAATTAAAAACCACAAGG + Intergenic
988449201 5:31323089-31323111 AAGGTTAAAGGAAAATGACACGG + Exonic
988642687 5:33058838-33058860 AATGTTAAAGGAAGATGACAAGG + Intergenic
988816626 5:34840581-34840603 AATGTTAATAGCAAACCAGAGGG + Intronic
989257983 5:39386649-39386671 AAAGGAAATGGAAAACAACATGG - Intronic
989526745 5:42461882-42461904 AAGGAGAATGGAAAAACACAGGG + Intronic
990190810 5:53258318-53258340 AATTTCTATGGAAAACAACATGG + Intergenic
992168970 5:74083560-74083582 AATGTTAATGTAGATACACAAGG - Intergenic
994896786 5:105716078-105716100 AATGTGTATGGAAAAGCACAGGG + Intergenic
997191759 5:131944337-131944359 GTTGTTAATGGAAAATCAAATGG + Intronic
997777103 5:136619932-136619954 AATGACAATAGAAAACCAGAAGG - Intergenic
998104458 5:139459626-139459648 AATGTGAAAGGAAAACAACGTGG + Intronic
999039544 5:148392206-148392228 AATGTTAATGGAGTCCCAAAAGG + Intronic
999804666 5:155070564-155070586 TGTGTTGATGGAAAAGCACAAGG - Intergenic
1000820643 5:165978983-165979005 AATATAACTGGAAAACCACAAGG - Intergenic
1001002988 5:168025142-168025164 CATGCAAATGGAAAACTACATGG + Intronic
1004206474 6:13596064-13596086 AGTGTTAAGTGAAAACCACAGGG + Intronic
1005855060 6:29854176-29854198 AATGGTAAGGGAAAACAGCAAGG - Intergenic
1008288672 6:49685478-49685500 AATTTCAATAGAACACCACAGGG + Intergenic
1008732269 6:54496424-54496446 AATTTTAATGGAAATCTTCAAGG + Intergenic
1011293311 6:85800213-85800235 AATGTCTATGGAAAACAGCATGG - Intergenic
1011563914 6:88654183-88654205 AAGGTTAAAGGAAAACCTTATGG - Intronic
1011631386 6:89328743-89328765 TATTTTAATAGAAAACCTCAGGG - Exonic
1013485217 6:110590207-110590229 ACTGTGAAAGGAAGACCACAGGG - Intergenic
1014628143 6:123754887-123754909 AATTTTAATGAAAATGCACAAGG - Intergenic
1017878076 6:158540286-158540308 AATCATTATGGAAAACCACTTGG + Intronic
1018303401 6:162428051-162428073 ATTGTTATTGCAAAACCCCAGGG - Intronic
1018824381 6:167398196-167398218 AATGCTCATGGAAAACCTCAAGG + Intergenic
1020360887 7:7325391-7325413 ATTGAGAATAGAAAACCACATGG + Intergenic
1020667491 7:11066641-11066663 AATGATACTGGGAATCCACATGG - Intronic
1021509400 7:21419076-21419098 AATGTTAATTTAAAACCCAAGGG - Intergenic
1022823532 7:33985292-33985314 AATGTTAAATGAAAATAACAAGG - Intronic
1023530404 7:41147753-41147775 AAGATTAATGGAAACCCAGATGG + Intergenic
1023957836 7:44901991-44902013 AATGATATGGGAAAACCACTGGG - Intergenic
1024706608 7:51968007-51968029 ATTGTCAACAGAAAACCACATGG - Intergenic
1027867732 7:83669181-83669203 AATGTTATTGAGAAATCACAAGG + Intergenic
1028029812 7:85896246-85896268 AATGTTACTGAAAAAAAACATGG + Intergenic
1029055841 7:97741794-97741816 AATTTTAGTGGATAAGCACATGG + Intergenic
1029079938 7:97965005-97965027 AATGTTACTCGTAAATCACAGGG + Intergenic
1029235560 7:99114163-99114185 GATGTTAATTGTAAACCACGGGG + Intronic
1030238262 7:107291166-107291188 TATGTTATAGGAATACCACAAGG - Intronic
1030459273 7:109810350-109810372 AATGTAAATTGCAAACTACAGGG - Intergenic
1030669627 7:112321269-112321291 AATGTTAATTGCAATCCCCAGGG - Intronic
1031633096 7:124067728-124067750 GATGTAAATTGAAAACTACATGG - Intergenic
1032010842 7:128346795-128346817 AGTGTTAATGGGAAACCATTAGG - Intergenic
1033508308 7:142028570-142028592 AATATCAATGTAAAAACACATGG - Intronic
1034231739 7:149534968-149534990 AATGTAAATGGAACCACACATGG + Intergenic
1034397033 7:150834736-150834758 AATGCAAATAAAAAACCACAAGG + Intronic
1036845669 8:12168379-12168401 AACGTTCATGGATGACCACATGG - Intergenic
1036867037 8:12410698-12410720 AACGTTCATGGATGACCACATGG - Intergenic
1037045297 8:14293452-14293474 TATGTTAATGGGAAATCACTGGG - Intronic
1037153903 8:15676006-15676028 AATTATAATGGAAAACAACATGG - Intronic
1037617520 8:20532916-20532938 ATGGTTTGTGGAAAACCACATGG - Intergenic
1038152182 8:24952466-24952488 AATGTTAATGTTAAACTTCATGG - Exonic
1040807922 8:51415150-51415172 AATTATAATTGAAATCCACAAGG + Intronic
1041606144 8:59784535-59784557 AATCTATATGGAATACCACAAGG - Intergenic
1041850583 8:62387262-62387284 AGTTTTATTGAAAAACCACATGG - Intronic
1043814882 8:84790170-84790192 AATGTTAATTGAAAAAAGCAGGG + Intronic
1044107451 8:88228458-88228480 AATGTTAATGGAAAAATATCAGG + Intronic
1044270484 8:90237077-90237099 AAGATATATGGAAAACCACATGG - Intergenic
1044370308 8:91402679-91402701 TATGTGAAAGGAAAAACACATGG + Intergenic
1044819033 8:96143697-96143719 AAGGATAATGAGAAACCACAAGG - Exonic
1045473166 8:102530929-102530951 AACCGTAATGGAAGACCACAAGG - Intronic
1045692175 8:104771177-104771199 AAAGCTAATGAAAGACCACAAGG - Intronic
1045777020 8:105816547-105816569 AATGTAAATCAAAAACTACAAGG - Intergenic
1046111188 8:109727517-109727539 AATGTAAATGGAAAACAGTATGG + Intergenic
1046585380 8:116144258-116144280 AATGTTGATGGAAAACTTTAAGG + Intergenic
1048117079 8:131535550-131535572 AATGTTAATGGTAACCTAGATGG - Intergenic
1048838882 8:138547288-138547310 AATGATAAGGGAAAATCCCAGGG - Intergenic
1049943075 9:567362-567384 AAAGCTAATGAAACACCACAAGG - Intronic
1049969351 9:807815-807837 AAGGTTAAGGGAAACCAACATGG - Intergenic
1050404175 9:5290413-5290435 AATGTGATTGCTAAACCACATGG - Intergenic
1050662106 9:7893851-7893873 AATTTTAAGGGAATACAACATGG - Intergenic
1050662715 9:7900656-7900678 AGTGTTAAAGGAAAAGCATATGG + Intergenic
1050856842 9:10368784-10368806 AATGCTAATGGAAAGACATATGG + Intronic
1050930807 9:11323520-11323542 AATGTAATTCTAAAACCACATGG + Intergenic
1050986371 9:12088409-12088431 AATGAAAAAGGAAAATCACAGGG - Intergenic
1051803939 9:20969850-20969872 AATGTTAATGGGAGTCCTCAAGG - Intronic
1052619457 9:30887507-30887529 AATGTCAGTTTAAAACCACAGGG + Intergenic
1053146456 9:35715353-35715375 AAGGTCAATGGGAAACCTCAGGG + Intronic
1054898738 9:70344092-70344114 AATGTTAATGTTAAAGCAGAGGG - Intronic
1055576760 9:77668020-77668042 AATATTAAAGGAAAATGACAAGG + Intergenic
1055940026 9:81640602-81640624 AATGATACTGAAAACCCACAAGG + Intronic
1056508456 9:87280132-87280154 AACCTCAATGGAAAACCTCAGGG + Intergenic
1058933315 9:109743976-109743998 AACAGAAATGGAAAACCACAAGG + Intronic
1058979614 9:110157026-110157048 AATGACAGTTGAAAACCACATGG + Intronic
1059678145 9:116560100-116560122 AATGTTAATTGCAACCCACTTGG - Intronic
1059844197 9:118253680-118253702 AATCTTAATGGGATATCACATGG + Intergenic
1059990613 9:119861922-119861944 GATGTTCATGCAAAATCACAAGG + Intergenic
1060501672 9:124161940-124161962 CATGTAAATGGAATACCAGAAGG - Intergenic
1187498342 X:19815136-19815158 TAATTTAATGGAAAACAACAAGG + Intronic
1187647193 X:21360674-21360696 AATGTTAATGGAAAAGAGCTTGG + Intergenic
1187832059 X:23392327-23392349 AATGTTAATGGATAACGAAAGGG - Intronic
1187973810 X:24685550-24685572 AATGTATATTGTAAACCACAGGG + Intergenic
1190990105 X:55538914-55538936 GATGTTAATTGAAATCCTCATGG - Intergenic
1193765205 X:85519975-85519997 AATATTATTGGAAGAACACAAGG - Intergenic
1194346152 X:92769586-92769608 AATGTTAATTTAAAACCCCATGG + Intergenic
1194705651 X:97172262-97172284 AAGCTAAATGGAAAACTACAGGG - Intronic
1195633271 X:107083512-107083534 CATGTTATTGGAATACCAAAAGG - Intronic
1196070331 X:111514026-111514048 GATTTTAAAGGAAAACTACATGG - Intergenic
1196147509 X:112334875-112334897 GATGTTAATGGTAATCCCCAGGG - Intergenic
1197176818 X:123494978-123495000 AATGACAATGGAAAAGCAGATGG + Intergenic
1200135265 X:153871648-153871670 AATGCAAAGGGAAAACCCCAGGG + Intronic
1200654490 Y:5886233-5886255 AATGTTAATTTAAAACCCCATGG + Intergenic
1201734059 Y:17238285-17238307 AATACTAATGGAAAGCCACAAGG + Intergenic
1201896187 Y:18994867-18994889 AATGTTAAAGCAAATTCACATGG + Intergenic