ID: 925163185

View in Genome Browser
Species Human (GRCh38)
Location 2:1701146-1701168
Sequence TTAGGTCAGGCAAATGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925163185_925163188 3 Left 925163185 2:1701146-1701168 CCATTAACATTTGCCTGACCTAA 0: 1
1: 0
2: 1
3: 8
4: 192
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925163185 Original CRISPR TTAGGTCAGGCAAATGTTAA TGG (reversed) Intronic
902499368 1:16898766-16898788 TTAGGTCTCTAAAATGTTAAAGG + Intronic
914239236 1:145840816-145840838 TTTGATCAGGAAAATGGTAAAGG + Intronic
916392689 1:164348040-164348062 TTTAGACAAGCAAATGTTAAGGG + Intergenic
919309416 1:195889037-195889059 TGAGATCAAGCAAATATTAAAGG + Intergenic
919924310 1:202184643-202184665 AGAGGTCAGGAACATGTTAATGG - Intergenic
923696026 1:236253330-236253352 TTATTTCAGGCTAATGTCAATGG - Intronic
924525404 1:244842604-244842626 TTAGGTCTGGCAAATATTTGAGG - Intronic
1063683082 10:8209195-8209217 TTTGGTCAAGCAAATATCAAGGG + Intergenic
1063871147 10:10419125-10419147 TGAGGTAATGCATATGTTAATGG - Intergenic
1064727161 10:18292147-18292169 TGGGGTAAGTCAAATGTTAAGGG + Intronic
1064913171 10:20425935-20425957 TTCGGGCAAGCAAATGCTAAGGG - Intergenic
1067159728 10:43815189-43815211 TTGGCTCAGTCAGATGTTAAAGG - Intergenic
1072279049 10:93849425-93849447 TCTGGTTAGGAAAATGTTAAAGG - Intergenic
1078572426 11:12470920-12470942 ATAGGCCAGGCAAAAGATAACGG + Intronic
1080845085 11:36019942-36019964 CAAGGTCAGACACATGTTAAAGG - Intronic
1081095943 11:38935420-38935442 TTATGTCAGAAAACTGTTAATGG - Intergenic
1081895274 11:46580598-46580620 TTAGGACAGGCAAGACTTAATGG - Intronic
1082947754 11:58777830-58777852 TTCAGACAAGCAAATGTTAAGGG + Intergenic
1083062619 11:59890485-59890507 TTCGGACAAGCAAATGCTAAAGG - Intergenic
1086808763 11:91278459-91278481 TTAGTCCAGGCAAATGTGACTGG - Intergenic
1087303167 11:96458798-96458820 TTAGTTCTGGCCAATGTGAAAGG + Intronic
1087947082 11:104175778-104175800 TAAGGACAGGCAAATTTTAAAGG - Intergenic
1092666784 12:10809485-10809507 TGAGATCAGGCAAAGGATAAAGG + Exonic
1094791691 12:33922364-33922386 TTCAGACAGGCAAATGCTAAAGG - Intergenic
1095319155 12:40804626-40804648 GTAGGAAAGGCAAATTTTAATGG + Intronic
1095886311 12:47191880-47191902 TTAGCTCAAGAAAATGGTAATGG - Intronic
1098612177 12:72472330-72472352 TTAGTTCAGGAAAACGTTAAAGG - Intronic
1099170180 12:79354852-79354874 AAAGGACAGGGAAATGTTAAAGG - Intronic
1099860499 12:88219778-88219800 TTTAGACAAGCAAATGTTAAGGG + Intergenic
1101471022 12:104997295-104997317 TTCAGACAGGCAAATGCTAAGGG - Intronic
1102192152 12:110996741-110996763 TTAGGTCACCCATATGTAAAAGG + Intergenic
1102735885 12:115159057-115159079 TTAGGGCAGGAAGATGTCAAGGG - Intergenic
1105869883 13:24495486-24495508 TTAGGTCATGCACATGTTAAAGG + Intronic
1106605594 13:31225678-31225700 TTAGGGCAGGAAAATACTAACGG - Intronic
1110048668 13:70864525-70864547 ATAGGCCAAACAAATGTTAAAGG + Intergenic
1111604698 13:90521858-90521880 TTTAGACAAGCAAATGTTAAAGG + Intergenic
1116010525 14:39346347-39346369 ATAAGCCAGGCAAATGTGAATGG + Intronic
1116298853 14:43149945-43149967 GTAGTTCAGGCAAATGATCAGGG - Intergenic
1116782616 14:49252541-49252563 TTCAGACAAGCAAATGTTAAGGG + Intergenic
1120502442 14:85313364-85313386 TCAGGTCAGGAAAATGTAGAAGG + Intergenic
1126083788 15:44991107-44991129 TTGGGACAAACAAATGTTAAGGG - Intergenic
1126213735 15:46130813-46130835 TTTGGACAAGCAAATGCTAAGGG - Intergenic
1126310611 15:47312162-47312184 TTAGGTGAGGACAATGGTAATGG - Intronic
1128190664 15:65692281-65692303 TTATACCAGTCAAATGTTAATGG + Intronic
1133426313 16:5693211-5693233 TTAGGTCAGGAGAGGGTTAAAGG - Intergenic
1134541301 16:15068198-15068220 TGAGGGCAGGCAAATCTTCAGGG + Exonic
1135359291 16:21797779-21797801 TGAGGGCAGGCAAATCTTCAGGG + Intergenic
1135436759 16:22432755-22432777 TGAGGGCAGGCAAATCTTCAGGG + Intronic
1136263499 16:29099162-29099184 TGAGGGCAGGCAAATCTTCAGGG - Intergenic
1137323849 16:47413293-47413315 TTCAGACAAGCAAATGTTAAGGG + Intronic
1142329907 16:89445136-89445158 TCAGAGGAGGCAAATGTTAACGG + Intronic
1145912200 17:28549298-28549320 TCAGGTGAGGCTGATGTTAAGGG + Intronic
1146559478 17:33855738-33855760 TTAGGTCAGGCAACAGAAAAGGG - Intronic
1147461254 17:40570750-40570772 TCAGGACAAGCAAATGTTGAGGG + Intergenic
1150970981 17:70028174-70028196 TTCAGACAAGCAAATGTTAAAGG - Intergenic
1153525327 18:5989725-5989747 TCAGGTGAGGCTAATGTTACTGG + Intronic
1157353693 18:46914525-46914547 TTCGATTAGGCAACTGTTAAGGG - Intronic
1158291388 18:55948644-55948666 TTAGGTAATGCACATGTTACAGG - Intergenic
1158512083 18:58099590-58099612 TTAGGCCAATCACATGTTAATGG + Intronic
1162383948 19:10350012-10350034 TGAGGTCACACAAATGTGAAAGG + Intergenic
1163819127 19:19486225-19486247 TCAGGTCAGGCAGATGTTTCAGG + Intronic
1164496969 19:28774796-28774818 TTAAGACAAGCAAATGCTAAGGG + Intergenic
1164852591 19:31497124-31497146 TTAGCTCATGGCAATGTTAATGG - Intergenic
1168594315 19:57663382-57663404 TTATGTCAGGAAAATGCTATAGG + Intergenic
925163185 2:1701146-1701168 TTAGGTCAGGCAAATGTTAATGG - Intronic
925981018 2:9177489-9177511 TGTGGTCTGGCAAATGTTAATGG + Intergenic
926754830 2:16226483-16226505 TTAGGTGAGGCTAATGTCACAGG + Intergenic
927679114 2:25128527-25128549 TTCGGTAACGCACATGTTAAGGG - Intronic
928239981 2:29577907-29577929 TTAGGTCAGGGGAAAGTTGAGGG + Intronic
930520468 2:52459571-52459593 TTATATGAGGCAAATGTAAATGG - Intergenic
933566636 2:83958175-83958197 TTTGGTCAGGGAAATGATCATGG + Intergenic
935013554 2:99158129-99158151 TTAGGTCATTCAACTGATAAAGG + Intronic
936149556 2:110007579-110007601 TTCAGACAAGCAAATGTTAAGGG - Intergenic
936195122 2:110363790-110363812 TTCAGACAAGCAAATGTTAAGGG + Intergenic
936994502 2:118398915-118398937 GCAGGTCAGTCAAATCTTAAAGG - Intergenic
937543476 2:122988379-122988401 CTACATCAGGCAAATTTTAATGG + Intergenic
938659613 2:133472159-133472181 TTAGGGCAGGCAAAGGCTCAAGG - Intronic
939421793 2:141981061-141981083 TAAGGTCACGCAGTTGTTAATGG - Intronic
939742223 2:145922705-145922727 TTAAGTCAGACACATGATAAAGG - Intergenic
940399396 2:153229890-153229912 TTGGCTAAAGCAAATGTTAATGG + Intergenic
940456759 2:153911615-153911637 TTCAGACAGGCAAATGCTAAGGG - Intronic
943825782 2:192389487-192389509 TCAGTTCAGCCAAATGGTAAGGG - Intergenic
944199398 2:197089989-197090011 TTAGGGCAGCTAAATGTAAAGGG + Intronic
944344321 2:198642822-198642844 TAAGGTATGGCAAATATTAAAGG + Intergenic
945526183 2:210890211-210890233 TTCAGACAGGCAAATGCTAAGGG + Intergenic
945799521 2:214410148-214410170 TTAGCTCAGGCAAGTGGCAATGG + Exonic
946129734 2:217597356-217597378 TTAGGTCTGGCGATTTTTAAAGG - Intronic
946856168 2:223951948-223951970 TTACTTCATCCAAATGTTAAAGG - Intergenic
947412878 2:229860502-229860524 TTAGGGCAGGCAAAACATAAGGG - Exonic
947778685 2:232737368-232737390 TTAGGTGAGGCTACTGTTTAAGG - Intronic
1170572519 20:17640597-17640619 TTAGGTGAGGAGAAGGTTAACGG - Intronic
1170831897 20:19850129-19850151 TTAGATTAACCAAATGTTAATGG - Intergenic
1173689985 20:44953165-44953187 TTAGGTGAGGAAAGAGTTAAAGG - Intronic
1176588446 21:8614221-8614243 TTAGTTCAAGCAGATGTTTAGGG - Intergenic
1177972822 21:27811281-27811303 TTGGGCCAGGCAAATGTTCTTGG + Intergenic
1179102948 21:38371931-38371953 TTAGGTCAATCAAATATTTAAGG - Intergenic
1180271275 22:10591217-10591239 TTAGTTCAAGCAGATGTTTAGGG - Intergenic
1180583201 22:16860785-16860807 TTCAGACAAGCAAATGTTAAGGG + Intergenic
1182078830 22:27514519-27514541 TTAGGTCAGGTAAATTTGAGTGG - Intergenic
949090415 3:21316-21338 TAAGGTCAGGGAAAGGTTGAGGG + Intergenic
949138882 3:607542-607564 TTAGTTCAAGCAGATGTTTAGGG + Intergenic
949821534 3:8121195-8121217 TGATGGCAGGCAAATGTTACTGG - Intergenic
951272425 3:20643329-20643351 TTACTTCAGTTAAATGTTAACGG - Intergenic
957030310 3:75233077-75233099 TAAGGTCAGGGAAAGGTTGATGG + Intergenic
957736766 3:84213638-84213660 TTAAGACAAGCAAATGCTAAGGG + Intergenic
957878975 3:86185395-86185417 TTCAGACAAGCAAATGTTAAGGG + Intergenic
960015511 3:112883747-112883769 TTCAGACAAGCAAATGTTAAGGG - Intergenic
962779867 3:138702485-138702507 TTAGGTCAGGTACAAGTTTATGG + Intronic
964710466 3:159666298-159666320 TTTGCTCAGGCAAATAATAAAGG + Intronic
966011986 3:175089817-175089839 TGAGATCAGGCAAATGCTGATGG + Intronic
966290080 3:178344900-178344922 TAAGGTTAGTCAAATGTTAAAGG + Intergenic
966800653 3:183760920-183760942 TAAAGTCAGCCAAATGTTAGGGG + Intronic
971075994 4:23150713-23150735 TTAGGTATGACAAATTTTAAAGG - Intergenic
972256392 4:37360385-37360407 TTCATTCAGTCAAATGTTAAAGG + Intronic
972848092 4:43014207-43014229 TTAGGCCTGGAAAATGTTCAAGG - Intronic
973926768 4:55746881-55746903 TTGGGCCAGGATAATGTTAAGGG + Intergenic
974306236 4:60144330-60144352 TGATCTCAGGGAAATGTTAAAGG + Intergenic
974942605 4:68487628-68487650 TTCAGACAAGCAAATGTTAAGGG - Intronic
976879190 4:89898072-89898094 TTAGGCCATGCAAATGACAATGG + Intronic
978260121 4:106745953-106745975 TCAAGCCAGGCAAATGTTAGAGG - Intergenic
980654540 4:135765612-135765634 TTAGGTCATGCTCATGTTAGAGG + Intergenic
984188554 4:176576721-176576743 TTATGTGTGTCAAATGTTAATGG - Intergenic
986397301 5:7343563-7343585 GTAGGGCAGTCAAATTTTAAAGG - Intergenic
990879411 5:60522700-60522722 TGAGGTCTGGCAAATGTCAGAGG - Intergenic
991247352 5:64522116-64522138 CTAGGTGAGGCAAATATAAACGG + Intronic
993228567 5:85202943-85202965 ATAGGACAAGCAAATGCTAAGGG - Intergenic
993437739 5:87918789-87918811 TTAGGTTAGGCTAAAATTAAAGG + Intergenic
994147304 5:96409736-96409758 TTATGGCAGGCACATTTTAAAGG - Intronic
994307152 5:98220478-98220500 TTAGGTGATGCCAATGTTACTGG + Intergenic
994535816 5:101027699-101027721 ATATGACAGGCAAATGCTAAGGG + Intergenic
995811947 5:116117430-116117452 TAAAATCAGGCAAAAGTTAAAGG - Intronic
996019537 5:118576506-118576528 TTGGGTCTGGAGAATGTTAATGG + Intergenic
996790972 5:127292328-127292350 TTACATCAGACAATTGTTAAAGG + Intronic
997934811 5:138101138-138101160 TTAGTTCAGGCAAGAGCTAATGG + Intergenic
998731199 5:145079534-145079556 TTATGTCTGGCAAATCTGAAAGG - Intergenic
1000063013 5:157672646-157672668 ATAGGTCAGAAAAATGTAAATGG + Intronic
1003620229 6:7692848-7692870 TCAGGTTAGCCAAAAGTTAAGGG + Intergenic
1006554504 6:34853872-34853894 TTATATCAAGCAAAAGTTAAAGG + Intronic
1006674727 6:35754232-35754254 TCAGGGCAGGCACATGATAATGG + Intergenic
1007495001 6:42253758-42253780 GTAGGTGAGGCAAATGTTGGTGG + Intronic
1007847912 6:44775878-44775900 TTTGGTCAATGAAATGTTAATGG + Intergenic
1008703232 6:54126925-54126947 CTAGGTCATGGAAAGGTTAAAGG - Intronic
1009454938 6:63845455-63845477 TTAAGGCATGCAGATGTTAAAGG + Intronic
1011257695 6:85440409-85440431 TTAGGGCGGGCCAATGTAAATGG + Intergenic
1011652782 6:89522287-89522309 GTAGGGCAGGCAACTGTTAGGGG + Intronic
1014600276 6:123402753-123402775 TTAGACTAAGCAAATGTTAATGG + Intronic
1014634334 6:123826155-123826177 TTATGTCATGCATCTGTTAATGG - Intronic
1015584032 6:134757622-134757644 TTTGGTCAGACAAGGGTTAATGG + Intergenic
1016237796 6:141889014-141889036 TTTGGACAAGCAAATGCTAAGGG + Intergenic
1016256678 6:142114592-142114614 ATACGTCATGTAAATGTTAATGG - Intergenic
1021819512 7:24482247-24482269 TTAGGTCAGGAGGATGTTAATGG - Intergenic
1023453040 7:40308570-40308592 TGAGGTCAGGAAAGTGTAAAAGG - Intronic
1024341019 7:48259815-48259837 TTGGGACAAGCAAATGCTAAGGG - Intronic
1024445868 7:49478298-49478320 TTCAGACAAGCAAATGTTAAGGG - Intergenic
1024810441 7:53205091-53205113 TTAGGTCAACCAGATGTCAATGG + Intergenic
1026117874 7:67511525-67511547 TTAGGTCATGGAACTGTGAAAGG + Intergenic
1027633642 7:80641610-80641632 TTAGGTCTGGCAAGTGTCTATGG + Intronic
1027662799 7:81007213-81007235 TTAGGTCAGCCAAGAGCTAAAGG - Intergenic
1030421477 7:109311432-109311454 TTCAGACAGGCAAATGCTAACGG + Intergenic
1031365600 7:120896849-120896871 TCAGGTCATCAAAATGTTAATGG + Intergenic
1034034802 7:147807904-147807926 ATATGACTGGCAAATGTTAAGGG - Intronic
1038118707 8:24587365-24587387 TTAAGTCAGGCACATAATAAGGG - Intergenic
1039499040 8:38002450-38002472 CTAGGGCAGTCAAGTGTTAAGGG + Intergenic
1042325970 8:67528278-67528300 GTTGGCCAGGCAAATGTGAAGGG + Intronic
1043610613 8:82057952-82057974 GTAGGGCAGGCATAAGTTAATGG - Intergenic
1044094884 8:88050897-88050919 TCATTTCAGGAAAATGTTAATGG + Intronic
1045496413 8:102713098-102713120 CTGGGTCCTGCAAATGTTAAGGG + Intergenic
1045520948 8:102902774-102902796 GTAGCTGTGGCAAATGTTAATGG - Intronic
1046053853 8:109056366-109056388 GCAGGTCAGTCAAATATTAAAGG + Intergenic
1047548311 8:125841142-125841164 TTCAGACAAGCAAATGTTAAGGG + Intergenic
1047555962 8:125930653-125930675 TTTGGTCAAGCCAACGTTAATGG + Intergenic
1047758183 8:127934564-127934586 TTAGGTCAGGAAAGAGTGAATGG + Intergenic
1048755261 8:137731291-137731313 TTAGCTCATGGAAATGTGAAGGG - Intergenic
1051832954 9:21300981-21301003 TACAGACAGGCAAATGTTAAGGG + Intergenic
1051951669 9:22642252-22642274 CTAGGTCATGCAAATATTCATGG + Intergenic
1052250546 9:26392589-26392611 TTAAGGCAAGCAAATGCTAAGGG - Intergenic
1052252635 9:26417008-26417030 CTAGGTCAGGCAAGTTTTGATGG + Intergenic
1053039207 9:34855482-34855504 TCAGGACAAGCAAATGTTAAGGG - Intergenic
1054883231 9:70167692-70167714 TTCCATCAGGCAAATTTTAAAGG - Intronic
1055069167 9:72149103-72149125 TTAGTTCAGGCACAGGTGAAAGG - Intronic
1055132911 9:72795580-72795602 TTTGGGCAAGCAAATGTTGAGGG + Intronic
1055595535 9:77861635-77861657 GTAGGGCAGTCAAATCTTAAAGG + Intronic
1055863085 9:80777547-80777569 TGAGATCAGGCAAATGTAAAGGG + Intergenic
1057153369 9:92815571-92815593 ATAAGTCAGGCTAATGTTATTGG - Intergenic
1057746833 9:97759253-97759275 TGAGGTTAGGCAACTGTCAAGGG + Intergenic
1203618453 Un_KI270749v1:92784-92806 TTAGTTCAAGCAGATGTTTAGGG - Intergenic
1190756438 X:53405731-53405753 TTGGGTCAGGCCAGTGTTCAAGG - Intronic
1190990678 X:55547055-55547077 AAAGGTCAGCCAAATGTAAAAGG + Intergenic
1191131729 X:57020657-57020679 TTCAGACAAGCAAATGTTAAGGG - Intergenic
1191654248 X:63578550-63578572 TGAGGTTGGGGAAATGTTAATGG - Intergenic
1191919843 X:66243873-66243895 TTCAGGCAGGCAAATGCTAAGGG - Intronic
1192866110 X:75133765-75133787 TTCAGACAAGCAAATGTTAAGGG + Intronic
1193294387 X:79817458-79817480 TTTGGTTAAGCAAATGTTGAGGG - Intergenic
1194013184 X:88586332-88586354 TTCAGACAAGCAAATGTTAAGGG + Intergenic
1194810373 X:98380925-98380947 TGAGGTCAGGCCAAAGTTCAGGG + Intergenic
1194982175 X:100451945-100451967 TTCAGACAAGCAAATGTTAAGGG + Intergenic
1195831273 X:109061386-109061408 TTCAGTCAAGCAAATGCTAAGGG + Intergenic
1196873785 X:120138249-120138271 TTATGTCTGGCAGATGTTTAAGG + Intergenic
1198679694 X:139168461-139168483 TTATGTTAGGTAAATGTTGAGGG + Intronic
1199397170 X:147352137-147352159 CTAGGTCAAGAAAATGTTAAAGG + Intergenic
1200336450 X:155355630-155355652 TTCAGACAAGCAAATGTTAAGGG + Intergenic
1200350020 X:155485597-155485619 TTCAGACAAGCAAATGTTAAGGG - Intergenic