ID: 925163186

View in Genome Browser
Species Human (GRCh38)
Location 2:1701159-1701181
Sequence CACTGAAGCGATTTTAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925163186_925163188 -10 Left 925163186 2:1701159-1701181 CCTGACCTAAAATCGCTTCAGTG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925163186 Original CRISPR CACTGAAGCGATTTTAGGTC AGG (reversed) Intronic
900501029 1:3004728-3004750 CACAGAAGCGATTTCATGTTGGG + Intergenic
905690851 1:39941537-39941559 GACTGAAGAGATTTTAGCACTGG + Intergenic
905832245 1:41080259-41080281 CAGTGAAGCCAGTTTAGGCCTGG - Intronic
907650823 1:56293247-56293269 CCCTGAAGCAATTTTTGGTCTGG - Intergenic
916959748 1:169877105-169877127 CACTGAAATGATTTTTGGTTTGG - Intronic
918367266 1:183821566-183821588 CACTTTATAGATTTTAGGTCTGG + Intronic
922945259 1:229508472-229508494 CACTGCAGCGGTTCTAGATCTGG - Intergenic
923377959 1:233385025-233385047 CACTGCAGAGATTTAAGGCCTGG + Exonic
1066224647 10:33370328-33370350 CAGTCAAGCCATTTTAGGTTTGG + Intergenic
1075414820 10:122254999-122255021 CAATGAAGCGATCTCAGGCCAGG - Intergenic
1079607384 11:22387062-22387084 AATTGAAGGGATTTTAGGTGGGG + Intergenic
1080171719 11:29311652-29311674 CACTGATGTGATTTGAGCTCAGG + Intergenic
1088138790 11:106590980-106591002 CAGGGAAGCCATTTTAGGTTTGG - Intergenic
1094682932 12:32682049-32682071 AACTGAAGCCATTTAAGGTATGG - Intronic
1100519263 12:95357707-95357729 TACTGAAGCGATATTAGGTTTGG + Intergenic
1105661619 13:22502166-22502188 CACTGAAGACAGTTTAGATCAGG - Intergenic
1114408468 14:22478341-22478363 CACTGAAAAGCTTTTAGCTCTGG - Intergenic
1116382766 14:44291980-44292002 CCCTGAAGAAATTTTAGCTCAGG + Intergenic
1119593168 14:75909275-75909297 CCCTGAGACGATTTTAGGGCAGG - Intronic
1120517092 14:85483639-85483661 GACTGAATTGATTTTAGGTGGGG + Intergenic
1123115394 14:105892094-105892116 CACTGAGGGGCTTTTGGGTCTGG + Intergenic
1131607605 15:93925190-93925212 CAGTGAAGTTATTTTAGGTTTGG + Intergenic
1137319451 16:47365196-47365218 CACTGAACAGCTTTTAGGTGGGG + Intronic
1139294699 16:65890179-65890201 CACTGAAGGGTTTTAAGCTCTGG - Intergenic
1139508991 16:67415849-67415871 GACTAAAGTGATTTCAGGTCGGG - Intronic
1151778717 17:76227414-76227436 CTCTGAAGAGATTATAGGCCAGG - Intronic
1153005289 18:492906-492928 CACTTAAGAGATTTCAGGTCAGG + Intronic
1159759986 18:72413321-72413343 CACTGAAGCGATTTAAGAATCGG - Intergenic
925163186 2:1701159-1701181 CACTGAAGCGATTTTAGGTCAGG - Intronic
928336111 2:30399913-30399935 GACTGAAGGGATGTTAGGTGGGG + Intergenic
928369252 2:30728697-30728719 CATTGAAGCGTTTTTAAGCCTGG + Intronic
930399344 2:50863315-50863337 CACCGCAGCAATTTCAGGTCTGG + Intronic
934067052 2:88350404-88350426 TCCTGAAGGGATTTCAGGTCGGG - Intergenic
942826061 2:180178284-180178306 CAATGAGGCAATTTTAAGTCTGG + Intergenic
944744801 2:202644650-202644672 CACTGAAGATATTCAAGGTCTGG - Intronic
945918295 2:215728034-215728056 CACAGATGTGGTTTTAGGTCAGG + Intergenic
948929590 2:241123471-241123493 CTATGAAGCCACTTTAGGTCGGG - Intronic
949372124 3:3346984-3347006 CACTGAAGAGGTTTAATGTCAGG - Intergenic
952286335 3:31973072-31973094 CACTGATGCGATTTGGGGCCAGG - Intronic
958034461 3:88153014-88153036 AACAGAAGAGATTTTAGGTAAGG + Intronic
961973245 3:130992367-130992389 CAGTGAAACGATTTTAGATCAGG + Intronic
961980913 3:131077355-131077377 CAGTGACGTGATTTTAGGTAAGG + Intronic
964240875 3:154593199-154593221 CACAGAGGAGATTTTAAGTCAGG + Intergenic
967510416 3:190304652-190304674 AAATGAAGAGATTTTAGGGCAGG + Intergenic
980830430 4:138124707-138124729 CAGTGGAGAGATTTTGGGTCAGG + Intergenic
982797966 4:159668345-159668367 CACTGAAGCCATTTTAGCACTGG + Intergenic
994650313 5:102519268-102519290 CACAGAAGCCATTTTGGGTTAGG - Intergenic
999487339 5:152010601-152010623 CATTGAAGCCATTTTGGGCCTGG + Intergenic
1003262974 6:4539830-4539852 CAGTGAAGCCATTTTGGGGCTGG - Intergenic
1011687425 6:89834764-89834786 CACTGAAGGGCTTTTTGGTGGGG + Intronic
1013477056 6:110518305-110518327 CAATGAAGCTATTTTAAGGCAGG - Intergenic
1022206551 7:28169935-28169957 TGCAGAAGCGATTTAAGGTCTGG + Intronic
1027926606 7:84473084-84473106 CTCTGAAGCAATTTTATGTATGG - Intronic
1030122092 7:106120048-106120070 CACTGAATCGCTTTTGGGTGAGG - Intergenic
1032752525 7:134855796-134855818 CTCCAAAGAGATTTTAGGTCAGG + Intronic
1036749941 8:11437167-11437189 CACTGCAGGGCTTTGAGGTCGGG + Intronic
1038321497 8:26531398-26531420 CTCAGAAGAGATTTTAGGGCTGG + Intronic
1038468068 8:27784861-27784883 CACTGAGGCAATTTAAGGTGAGG - Intronic
1042449979 8:68932870-68932892 CATTGAAGCGATTTTAGAAAGGG + Intergenic
1045209955 8:100086868-100086890 CACTGAAGAGTTTTTAGCTGAGG + Intronic
1045706791 8:104933096-104933118 TACTGAAGAGCTTTTAGGTGAGG - Intronic
1052151127 9:25116937-25116959 CACTGAAGTGTTTTTAGAGCAGG + Intergenic
1056128943 9:83565187-83565209 CACTGATGCTATTTTTGATCTGG + Intergenic
1060000047 9:119950349-119950371 AGCTGAAGAGATTTTAAGTCAGG + Intergenic
1191791183 X:64974353-64974375 CACTGAAATGTTTTTAGGACAGG + Intronic
1193375943 X:80761425-80761447 CACTGAAGCAATTATATGACAGG + Intronic
1194839754 X:98726107-98726129 TACTTAAGAGATTTTGGGTCAGG - Intergenic
1195762886 X:108265870-108265892 CACTGAAGGGATATCTGGTCAGG + Intronic
1196746772 X:119078109-119078131 CACTGAAGAGGTTTTACGTTTGG - Intergenic