ID: 925163186

View in Genome Browser
Species Human (GRCh38)
Location 2:1701159-1701181
Sequence CACTGAAGCGATTTTAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925163186_925163188 -10 Left 925163186 2:1701159-1701181 CCTGACCTAAAATCGCTTCAGTG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925163186 Original CRISPR CACTGAAGCGATTTTAGGTC AGG (reversed) Intronic