ID: 925163188

View in Genome Browser
Species Human (GRCh38)
Location 2:1701172-1701194
Sequence CGCTTCAGTGCTTCCTACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925163185_925163188 3 Left 925163185 2:1701146-1701168 CCATTAACATTTGCCTGACCTAA 0: 1
1: 0
2: 1
3: 8
4: 192
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67
925163181_925163188 27 Left 925163181 2:1701122-1701144 CCCAAAGCCAGGCCATGTGGTTT 0: 1
1: 0
2: 0
3: 20
4: 215
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67
925163183_925163188 20 Left 925163183 2:1701129-1701151 CCAGGCCATGTGGTTTTCCATTA 0: 1
1: 0
2: 1
3: 13
4: 212
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67
925163182_925163188 26 Left 925163182 2:1701123-1701145 CCAAAGCCAGGCCATGTGGTTTT 0: 1
1: 0
2: 0
3: 15
4: 225
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67
925163184_925163188 15 Left 925163184 2:1701134-1701156 CCATGTGGTTTTCCATTAACATT 0: 1
1: 0
2: 1
3: 23
4: 346
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67
925163186_925163188 -10 Left 925163186 2:1701159-1701181 CCTGACCTAAAATCGCTTCAGTG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925163188 Original CRISPR CGCTTCAGTGCTTCCTACTA AGG Intronic
909992869 1:82244762-82244784 CACATCAGTGCTTCCAATTAAGG - Intergenic
914989063 1:152482607-152482629 GGCTACAAAGCTTCCTACTATGG - Intergenic
1063075522 10:2712787-2712809 TGCCTCACTGCTTCCTGCTAGGG - Intergenic
1063258733 10:4358944-4358966 GGCTTCAGTGTTACCTTCTATGG - Intergenic
1065982282 10:30911856-30911878 GGCTCCAGTCCTTCCTACTCTGG + Intronic
1074145088 10:110710559-110710581 CGCCTCAGTCCTTCCTACTGGGG - Intronic
1074424871 10:113342075-113342097 CACTTCAGAGATTCATACTAAGG + Intergenic
1080314746 11:30936219-30936241 GGCTACAGATCTTCCTACTATGG - Intronic
1090133252 11:124168143-124168165 TGCTTACGTGCTTTCTACTAGGG - Intergenic
1091717046 12:2785285-2785307 TGCTTAAGTGCTTTCTACTTGGG - Intergenic
1092332944 12:7602301-7602323 AGCTACAGATCTTCCTACTAGGG + Intergenic
1098407168 12:70138967-70138989 GGCTTCAGGGCTTCATACAAAGG - Intergenic
1100004556 12:89878823-89878845 CACTTCAGTGCTTCCTTCCCAGG - Intergenic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1103196472 12:119047862-119047884 CTTTGCAGTTCTTCCTACTAGGG - Intronic
1104411574 12:128562579-128562601 AGCTGCAGTGCTTCCTTCTAAGG - Intronic
1109798161 13:67342999-67343021 AGCTACAGATCTTCCTACTATGG - Intergenic
1112158920 13:96848521-96848543 TGCTTAAGTGCTTTCTACTCAGG - Intergenic
1113467430 13:110522165-110522187 TGCCTCAGTGCTTCCTCCTGGGG + Intergenic
1120070561 14:80097859-80097881 CACCTCAGTGCTTGCTACAACGG - Intergenic
1120409285 14:84131579-84131601 AGCTCCAGTGTTTCCTACTGAGG + Intergenic
1122445551 14:101765219-101765241 CCCTTCACTGCTTCCTCATAAGG + Intronic
1138423553 16:56915456-56915478 CGCCTCAGGGCTTGCTACGAGGG + Exonic
1144727972 17:17511317-17511339 CAGTTCAGTGCTTCCTGCTCAGG - Intronic
1148214544 17:45827276-45827298 CCCTTCAGTGCTGCCTTCCAGGG - Intronic
1149408034 17:56375011-56375033 TTCTTCAGTGTTTCCTACTCAGG - Intronic
1160048471 18:75409139-75409161 AGCTTGAGTGCTTCCCACAAAGG - Intronic
1161747906 19:6072775-6072797 CTCTTCAGTGCTGCCTACGGAGG + Intronic
1163225122 19:15955163-15955185 AGATGCAGTCCTTCCTACTAGGG + Intergenic
1167865652 19:52325344-52325366 CGCTGCAGTGCTTTCCACAATGG - Exonic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
925912132 2:8580983-8581005 GGCTTGAGGGCTTCCTCCTAGGG + Intergenic
928710027 2:33993908-33993930 TGCCACAGTGTTTCCTACTATGG - Intergenic
936293582 2:111247910-111247932 CGCTTCAGTGTTTGCTCCTGGGG + Intergenic
940368430 2:152874717-152874739 GTCTTCACTGCTTCCTACTGTGG + Intergenic
942942947 2:181640762-181640784 CACTTCAGAACTTCCTACTTTGG + Intronic
943964164 2:194310228-194310250 CGTTTCAATTCTTCCTACCAGGG + Intergenic
1169877307 20:10312128-10312150 CTCTTCAGAGAGTCCTACTAAGG + Intergenic
1171933134 20:31246576-31246598 TGCTAGAGTGCTTCCTACTCTGG + Intergenic
1178477987 21:32954600-32954622 GGCTTACGTGCTTCCTACAACGG - Intergenic
950178067 3:10889918-10889940 CACTTCAGAGCTTCCTGCAAAGG + Intronic
951283470 3:20780379-20780401 CACTTCTGGGCTGCCTACTATGG - Intergenic
953033405 3:39192105-39192127 GGCTTCAGGGCTTCCTCCCAGGG - Intronic
955023957 3:55149086-55149108 CTGTTCACTGCTTCCTTCTATGG - Intergenic
958600864 3:96295006-96295028 CTCTTCAGTGCTGCCTACGCTGG + Intergenic
959089208 3:101884512-101884534 TGCTTCAACCCTTCCTACTAAGG - Intergenic
959246035 3:103869181-103869203 CACTTTACTGCTTCTTACTAAGG + Intergenic
961125797 3:124416464-124416486 CTCTTCAGTGCCTCTTACTGAGG + Intronic
963518435 3:146336358-146336380 GGCTACAGATCTTCCTACTATGG + Intergenic
968216203 3:196893286-196893308 TGCTTCTGAGCTTCCTATTATGG - Intronic
981300163 4:143178161-143178183 AGCTACAGATCTTCCTACTATGG - Intergenic
982968692 4:161950481-161950503 CGCTGCAGTGCTTCATACTCTGG + Intronic
985012134 4:185593622-185593644 TGCTTCAGTGATTCCTAAGATGG - Intronic
989796896 5:45485270-45485292 CATTTTAGTTCTTCCTACTAAGG + Intronic
996122037 5:119683574-119683596 AGCTTCACTGCTTCCTTATATGG - Intergenic
999045828 5:148468457-148468479 AGATTCAGTTCTTCCTTCTAAGG - Intronic
1006683719 6:35815072-35815094 CGCCTCAGTGCCTCCTTCTAGGG - Intronic
1011700186 6:89948578-89948600 CGCATCATGGCTTCCTACCAAGG - Intronic
1023770856 7:43555434-43555456 CTCTTCAGTGCTTCCTGATCAGG - Intronic
1031059932 7:117039757-117039779 CACTTCAGTACTTCCCAGTAGGG + Intronic
1031534282 7:122914671-122914693 CGCTTCAATGTTGCTTACTAAGG - Intergenic
1032249837 7:130246475-130246497 CGCCACAGTGCTTTCTACAATGG - Intergenic
1033351894 7:140568673-140568695 CGCTTCTGTCCCTCATACTAAGG + Intronic
1036040073 8:5067932-5067954 CTTTTAAGTGCTTCGTACTATGG - Intergenic
1039300723 8:36205853-36205875 TGCTTCTGTGCTTCCTGCTTTGG + Intergenic
1041892041 8:62879974-62879996 CTCTTCATTGCTTCCTAATAAGG - Intronic
1044911628 8:97065950-97065972 TGCTTCAGTGCTTTCTCCTTGGG - Intronic
1055035565 9:71814693-71814715 CGTTTCAGTCCTCCCTAATACGG + Intronic
1056058259 9:82852232-82852254 AGCTACAGAGCTTCATACTATGG - Intergenic
1057982785 9:99679225-99679247 CACTTCATTGGTTCCTACTCTGG + Intergenic
1185699294 X:2218278-2218300 TGCTTCATTGCTTTCTACTTAGG + Intergenic
1192235928 X:69296094-69296116 CCCTTCAGAGCTTCCCACTGAGG + Intergenic
1195768235 X:108319428-108319450 TGCTTCAGTGCTTAATTCTAGGG - Intronic