ID: 925163188

View in Genome Browser
Species Human (GRCh38)
Location 2:1701172-1701194
Sequence CGCTTCAGTGCTTCCTACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925163184_925163188 15 Left 925163184 2:1701134-1701156 CCATGTGGTTTTCCATTAACATT 0: 1
1: 0
2: 1
3: 23
4: 346
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67
925163185_925163188 3 Left 925163185 2:1701146-1701168 CCATTAACATTTGCCTGACCTAA 0: 1
1: 0
2: 1
3: 8
4: 192
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67
925163181_925163188 27 Left 925163181 2:1701122-1701144 CCCAAAGCCAGGCCATGTGGTTT 0: 1
1: 0
2: 0
3: 20
4: 215
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67
925163182_925163188 26 Left 925163182 2:1701123-1701145 CCAAAGCCAGGCCATGTGGTTTT 0: 1
1: 0
2: 0
3: 15
4: 225
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67
925163183_925163188 20 Left 925163183 2:1701129-1701151 CCAGGCCATGTGGTTTTCCATTA 0: 1
1: 0
2: 1
3: 13
4: 212
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67
925163186_925163188 -10 Left 925163186 2:1701159-1701181 CCTGACCTAAAATCGCTTCAGTG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925163188 Original CRISPR CGCTTCAGTGCTTCCTACTA AGG Intronic