ID: 925164367

View in Genome Browser
Species Human (GRCh38)
Location 2:1706260-1706282
Sequence ACTGGCAGCCTGGTATTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925164352_925164367 22 Left 925164352 2:1706215-1706237 CCAGCACCTAAAGATCTATCTGG 0: 1
1: 0
2: 1
3: 8
4: 99
Right 925164367 2:1706260-1706282 ACTGGCAGCCTGGTATTCACTGG 0: 1
1: 0
2: 1
3: 8
4: 133
925164357_925164367 16 Left 925164357 2:1706221-1706243 CCTAAAGATCTATCTGGGAGGGT 0: 1
1: 0
2: 0
3: 12
4: 85
Right 925164367 2:1706260-1706282 ACTGGCAGCCTGGTATTCACTGG 0: 1
1: 0
2: 1
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925164367 Original CRISPR ACTGGCAGCCTGGTATTCAC TGG Intronic
901181562 1:7345621-7345643 TCTAGCAGCCTGTTATTCCCAGG - Intronic
901245070 1:7723857-7723879 ACTGGCAGGCTGGAGTTCAGTGG + Intronic
901336286 1:8451866-8451888 ACTGCCAGACTGGTCTTCAAGGG + Intronic
902560195 1:17272580-17272602 ACTGGCAGCCTGGAACTCCTGGG + Intronic
902704157 1:18192969-18192991 ACTGGAATCCTGGTCCTCACAGG + Intronic
906697610 1:47834038-47834060 ACCAGCAGCCTGGCAGTCACTGG + Intronic
910972719 1:92872775-92872797 ACTGAGAGCTTGGTATTCATTGG + Intronic
913359156 1:117960283-117960305 ACTAGTAGCCTGTTATTGACTGG + Exonic
915908730 1:159899201-159899223 ACTGGCAGCCTGGGGTTTGCTGG - Intronic
916268257 1:162914043-162914065 ACTGGCAGCCTGGAACCCACTGG - Intergenic
918205453 1:182304399-182304421 ACTGGCACCGTGCCATTCACTGG - Intergenic
920161821 1:204004461-204004483 ACTGGCTGCCTCGATTTCACAGG - Intergenic
920300395 1:204985150-204985172 ACAGGCAGCCTGGGAGACACTGG + Intronic
921914596 1:220593605-220593627 ACTGTCAGCCTGGGAGTCTCTGG + Intronic
1063968186 10:11363066-11363088 ACTCTCAGCCTGGAACTCACCGG + Intergenic
1065033274 10:21610296-21610318 ACTGGCAGCCTGGCCGTCATAGG + Intronic
1065725317 10:28663137-28663159 ACTGACAGCATTGTATTAACAGG - Intergenic
1067454483 10:46408025-46408047 ACCAGCAGCCTGGTAGCCACTGG - Intergenic
1067632719 10:47976607-47976629 ACCAGCAGCCTGGTAGCCACTGG + Intergenic
1069994668 10:72335118-72335140 CCTGGCAGCCTGGAAGCCACAGG - Exonic
1070942208 10:80357426-80357448 ACTGGCAGCCCGGCATGCTCTGG + Intronic
1073175534 10:101554326-101554348 ACAGGCACCTGGGTATTCACAGG - Exonic
1074058699 10:109944855-109944877 ACTGGCTGCCTGATGATCACAGG - Intronic
1077928720 11:6708464-6708486 ACTAACAGCCTGGCTTTCACAGG + Intergenic
1079347017 11:19661984-19662006 ACTGGCTGCCTGGAATGCAGTGG + Intronic
1085440805 11:76560833-76560855 ACTTGAAGCCTGGGACTCACTGG - Intergenic
1086928895 11:92670866-92670888 ATTGTCAGCCTGGGATTCAGAGG - Intronic
1087906056 11:103699380-103699402 ACCGGCAGCCTGGCAGTCAGTGG - Intergenic
1089159784 11:116428637-116428659 ACTGGCAGCCTGCCCTTCTCTGG - Intergenic
1090320728 11:125841172-125841194 ACTAACAGCCTGCTATTGACTGG + Intergenic
1092052784 12:5484279-5484301 TCTGGCACCCTGGGCTTCACAGG + Intronic
1093154552 12:15665774-15665796 AGTGGCAGCCTGGTCTGCATGGG - Exonic
1093918340 12:24831310-24831332 ACTAGTAGCCTGCTGTTCACCGG - Intronic
1094528151 12:31246705-31246727 ACCGGCAGCCTTGCACTCACAGG + Intergenic
1098281572 12:68867764-68867786 AGTGGCAGCCTGGGCTCCACAGG - Intronic
1099831197 12:87844967-87844989 ACTGGCAGGCTGCTCTACACTGG - Intergenic
1101397177 12:104358579-104358601 AGTGGAAGCCTGCTGTTCACAGG - Intergenic
1107518663 13:41157832-41157854 TCTGACAGCCTGGGATCCACTGG - Intergenic
1110311032 13:74049286-74049308 GCTGGCAGCCTGGTCTACAATGG + Intronic
1110772569 13:79366677-79366699 ACTGGGGGCCTGAGATTCACAGG + Exonic
1111368924 13:87290177-87290199 ACTGGCAGCCTGGTCTAAGCTGG - Intergenic
1112972683 13:105280138-105280160 CCAGGCAGCCTGTTATTCAGAGG - Intergenic
1114055873 14:18966606-18966628 ACTGACAGCCTGGTGTTTCCCGG - Intergenic
1114106673 14:19435156-19435178 ACTGACAGCCTGGTGTTTCCCGG + Intergenic
1117403893 14:55383178-55383200 ACAGCCAGCCCTGTATTCACAGG + Intronic
1119823874 14:77641380-77641402 ACTGGCAGCCTAGAACTCCCGGG - Intergenic
1120461921 14:84807856-84807878 CCTGGCAGCCTGTTATTCCTGGG - Intergenic
1123489101 15:20765546-20765568 GCTGGAAGCCTGGGAGTCACAGG - Intergenic
1123545600 15:21334633-21334655 GCTGGAAGCCTGGGAGTCACAGG - Intergenic
1130386674 15:83418080-83418102 GCTGGCCACCTGGTATTCTCAGG - Intergenic
1142080808 16:88147749-88147771 ACTGGCCTCCTGGTCATCACAGG + Intergenic
1144761600 17:17710498-17710520 ACTGGCAGCCTCTGACTCACAGG - Intronic
1145254356 17:21314538-21314560 ACTGGCAGCCTGCTGTGCAGGGG - Exonic
1146692997 17:34889571-34889593 CCTGGGAGCCTGGCATTCAGGGG - Intergenic
1146918241 17:36691704-36691726 TCTGGCAGCCTGGTAGTTGCAGG + Intergenic
1147448106 17:40487316-40487338 TCTGGGAGCCTGGAAGTCACTGG + Exonic
1147553233 17:41460050-41460072 CTGGGCAGCCTGGTATTCAGTGG - Exonic
1150440299 17:65185904-65185926 CCTGGCTGCCTGGTGTTCTCTGG - Intronic
1150599048 17:66634398-66634420 ACTGGCAGCCTGTCATTAAGTGG - Intronic
1151131248 17:71898941-71898963 AGGGGCAGCCTGGTACTCAGAGG - Intergenic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152272840 17:79335131-79335153 TCTGGCAGCCTCGTCTACACAGG - Intronic
1157176830 18:45459600-45459622 ACCTGCAGCCTGCTATTCCCGGG + Intronic
925164367 2:1706260-1706282 ACTGGCAGCCTGGTATTCACTGG + Intronic
925762593 2:7199957-7199979 ACTTGAATCCAGGTATTCACTGG + Intergenic
926650785 2:15342351-15342373 AATGGCATCATGGTATTCATTGG - Intronic
926672773 2:15591462-15591484 ACTGGCTGCCAGGCACTCACTGG + Intronic
929599828 2:43198155-43198177 ACTGCCAGCCTGGCCTTCAGGGG - Intergenic
931798420 2:65734403-65734425 AATGGCTGCCTGGTATTCTGTGG + Intergenic
933147821 2:78876887-78876909 ACTGTCAGCCTGGTATTTTTGGG - Intergenic
935407937 2:102728643-102728665 ACTGGCCTCCTTGTACTCACAGG + Intronic
937941420 2:127289113-127289135 GCTGGTAGGCTGGTCTTCACAGG - Intronic
938705746 2:133923986-133924008 ACTTGCAGCCCTGTGTTCACAGG - Intergenic
938814343 2:134884589-134884611 ATTGTCTGCTTGGTATTCACTGG - Intronic
939192032 2:138928248-138928270 ACTGGCAGCTTGGTAGTGACGGG - Intergenic
945934105 2:215885860-215885882 ACTGGCATCCTGGAATTTCCAGG - Intergenic
1169261997 20:4146035-4146057 TCTGGCACTCTGGTGTTCACTGG - Intronic
1174487508 20:50870663-50870685 ACCGGCAGTCTGCTTTTCACGGG + Intronic
1175898769 20:62351816-62351838 CCTGGCCGCCTGGTGCTCACGGG - Intronic
1177755368 21:25340855-25340877 AATTGCATCATGGTATTCACAGG - Intergenic
1179839472 21:44061917-44061939 TCAGGCAGGCTGGTAATCACAGG + Intronic
1181875917 22:25940720-25940742 CCTGGAAGCCTGGAGTTCACAGG - Intronic
1184462154 22:44645308-44645330 AATGGCAGCTTTGTATTCAGGGG - Intergenic
1184638994 22:45858966-45858988 CCTGGCACCCTGGCATTCAGTGG + Intergenic
952284473 3:31955110-31955132 ACTGGCATCCAGGCATCCACTGG + Intronic
952794299 3:37225168-37225190 GCTGGCAGGCTGGTACTAACTGG + Intergenic
954128756 3:48548960-48548982 AGTGGCAGCCTGGTAGCCACTGG + Intronic
954140146 3:48600654-48600676 AGTGGCAGCCTGGTATTCCTAGG - Intronic
959483356 3:106899900-106899922 ATTGGCAGCCTTGCACTCACAGG + Intergenic
960991403 3:123314021-123314043 AGTGGGAGCCTGTTCTTCACTGG - Intronic
963460836 3:145613009-145613031 ACTTGGAGCCTGATATTCAAAGG - Intergenic
966321438 3:178705330-178705352 AGTGGCAGCATGGTTTTCACAGG - Intronic
967069605 3:185951164-185951186 ACAGGCAGGCTGGGATTCTCAGG - Intergenic
968487728 4:872003-872025 ACTGGCAGCCTGGGTTTCCCAGG - Intronic
974639493 4:64610093-64610115 ATTGGCAGCCTAGCACTCACAGG - Intergenic
975492102 4:75000481-75000503 ACTGGCATCCTTGGCTTCACAGG + Intronic
979627657 4:122863815-122863837 ACTGGCAGGCTAGAATTCTCTGG + Intronic
989265784 5:39471980-39472002 ACTGGCCCCCTGGTAATGACTGG + Intergenic
992589935 5:78284271-78284293 TCTGTCTGCCTGGTATACACAGG + Intronic
993665396 5:90689211-90689233 ACAGGCAGCCAGGTATTCCTAGG - Intronic
993805305 5:92400449-92400471 ACTGGCATCCTGGATTTCAAAGG + Intergenic
996205898 5:120734998-120735020 AATGGGAACCTGGTATTCAATGG - Intergenic
997235111 5:132268130-132268152 ACTGGCAGCCTGGTCTTCAAGGG - Intronic
999116206 5:149165823-149165845 ACTCTCAGCCTAGTGTTCACAGG - Intronic
1009703912 6:67220185-67220207 AGTGGCAGCAGGGTCTTCACTGG - Intergenic
1010712407 6:79190594-79190616 ACAGGAAGCTTGGTATTAACTGG + Intergenic
1013786150 6:113783533-113783555 ACTGCTTGCCTGGTATGCACTGG - Intergenic
1014349372 6:120320538-120320560 ACTAGAAGCCTGGTATCCAATGG + Intergenic
1015907339 6:138130318-138130340 TTTGGCAGCCTGGACTTCACTGG + Intergenic
1019190494 6:170247995-170248017 ACCGGCATCTTGGTTTTCACCGG - Intergenic
1020382713 7:7564727-7564749 ACTGGCAGCATGGAGCTCACAGG + Intergenic
1021268316 7:18552959-18552981 ACTGGCAGCGTGTTATTTTCAGG + Intronic
1025023893 7:55500212-55500234 AGTGGCCATCTGGTATTCACAGG - Intronic
1025214562 7:57045070-57045092 ACTGACAGCCTGTTAGTGACCGG + Intergenic
1025657391 7:63531742-63531764 ACTGACAGCCTGTTAGTGACCGG - Intergenic
1028428358 7:90716965-90716987 ACTGGCAGCACGGGAATCACTGG - Intronic
1029684302 7:102135175-102135197 ACTGACAGCCTGCTAGTGACCGG + Intronic
1031755249 7:125631827-125631849 ACTGGCAGGCTGGAATGCAGTGG - Intergenic
1032357280 7:131222608-131222630 ACTGGCAGTCACGTGTTCACAGG + Intronic
1035568608 8:658303-658325 ACTGCCAGCCTGGCCTCCACTGG + Intronic
1038986840 8:32820406-32820428 ACTGGCATCCATGTATTCACAGG + Intergenic
1042333369 8:67605958-67605980 ACTGGCTGTCTGTTATACACAGG + Intronic
1042463365 8:69097311-69097333 ACTGGCACCCTGGAATTCAGAGG - Intergenic
1044400093 8:91760292-91760314 ACTGTAAGGCTGGTGTTCACTGG - Intergenic
1045017926 8:98015013-98015035 AGTAACAGCCTGGTTTTCACAGG + Intronic
1049182743 8:141231334-141231356 ACTTGCAGCGTGGCCTTCACGGG - Intronic
1049239864 8:141531862-141531884 ACAGGCAGCCTGGGACTCAGGGG - Intergenic
1050560144 9:6826909-6826931 ATTGGCAGGATGGTTTTCACAGG + Intronic
1051712569 9:19946996-19947018 ACTGGGAGCTTGCTATTGACAGG - Intergenic
1051915641 9:22203819-22203841 ATTGACAGCCTGGGATCCACAGG + Intergenic
1053451439 9:38197358-38197380 ACAGGCAGGCTCGTTTTCACTGG + Intergenic
1056858436 9:90156825-90156847 TCTGGCAGCCTGCTACTTACAGG - Intergenic
1062630634 9:137461649-137461671 ACTGGCAGGCGGGTGTCCACAGG - Intronic
1187821590 X:23293492-23293514 CCTGGCTGCCTGGAATTCATAGG - Intergenic
1194950550 X:100120826-100120848 ACTGGCAACATGGTGTTCGCTGG + Intergenic
1196128917 X:112131443-112131465 ACTGGAAGACTGATATTGACAGG + Intergenic
1196981729 X:121221724-121221746 ATAGGCAGCCTGATTTTCACTGG + Intergenic
1198752005 X:139945531-139945553 AATGGCACCCAGGTATCCACAGG + Intergenic
1199448872 X:147957523-147957545 TCTGTCAGCATGGAATTCACTGG + Intergenic
1200180462 X:154147294-154147316 ACTGGCTGCCTTGTTTTCAGAGG + Intronic
1200186290 X:154185689-154185711 ACTGGCTGCCTTGTTTTCAGAGG + Intergenic
1200191942 X:154222827-154222849 ACTGGCTGCCTTGTTTTCAGAGG + Intronic
1200197697 X:154260631-154260653 ACTGGCTGCCTTGTTTTCAGAGG + Intronic