ID: 925167526

View in Genome Browser
Species Human (GRCh38)
Location 2:1727275-1727297
Sequence TCTGAAGGAGGGGCAGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925167526_925167530 -10 Left 925167526 2:1727275-1727297 CCAGCGGCTGCCCCTCCTTCAGA 0: 1
1: 0
2: 1
3: 28
4: 241
Right 925167530 2:1727288-1727310 CTCCTTCAGACAAAGTTCTTTGG 0: 1
1: 0
2: 1
3: 13
4: 188
925167526_925167533 26 Left 925167526 2:1727275-1727297 CCAGCGGCTGCCCCTCCTTCAGA 0: 1
1: 0
2: 1
3: 28
4: 241
Right 925167533 2:1727324-1727346 TTTATCGCACTTAAATGTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925167526 Original CRISPR TCTGAAGGAGGGGCAGCCGC TGG (reversed) Intronic
900525205 1:3125168-3125190 TCTCAAGGAGGTGCAGCTGCGGG - Intronic
900553315 1:3267705-3267727 TCAGAAGGAGGGGCAGGGGCTGG - Intronic
900959345 1:5909322-5909344 TCTGTAACAGGGGCAGCCGCTGG + Intronic
901022342 1:6261576-6261598 TCTGAAGCAGGGGCAGCGAGGGG + Intergenic
901066929 1:6498639-6498661 TCTCGAGGAGGGGCTGCCACAGG + Intronic
901231411 1:7643508-7643530 TCTGATGGATGGGCAGCTCCAGG - Intronic
901816010 1:11794017-11794039 GCTGAAGGAGGAGCTGCTGCGGG - Exonic
903450844 1:23452708-23452730 TCTGATGAAGGGGCAGCTGAGGG - Exonic
903762768 1:25710746-25710768 TCTGAACAAAGGGCAGCAGCAGG - Intronic
905018788 1:34794534-34794556 GCAGAAGGAGGGGGAGCTGCGGG + Exonic
905258275 1:36699742-36699764 TCTGAAGGATGGGCAGGAGTAGG - Intergenic
909562981 1:77025782-77025804 CCTGGAGGAGGGGCAGCAGGAGG - Intronic
911498655 1:98660562-98660584 TCTGAAGGATGGGCAGGAGATGG + Intergenic
912420685 1:109540377-109540399 TCTGAAGGAAGGCCAGGCTCAGG + Intronic
912514062 1:110207158-110207180 CCTGAAGGAGGGTCAGTCCCTGG + Intergenic
914060998 1:144207901-144207923 TCTGGAGGAGGGGCAACCTTGGG + Intergenic
914118152 1:144758468-144758490 TCTGGAGGAGGGGCAACCTTGGG - Intergenic
914817078 1:151071064-151071086 ACTGAAGCGGGGGCAGCGGCGGG + Intronic
915097036 1:153470413-153470435 CCAGCAGCAGGGGCAGCCGCTGG + Intergenic
915191868 1:154157600-154157622 TCAGAGGGAGGAGCAGCAGCAGG + Intronic
915195026 1:154182946-154182968 CATGAGGGAGGGGCAGGCGCTGG - Intronic
915356384 1:155257430-155257452 GCTGAAGGATGGGCAGACGTGGG + Intronic
915447066 1:155979842-155979864 TAGGAAGGAGGGGAAGCCGGAGG - Intronic
915474906 1:156147576-156147598 ACTGGGGGAGGGGCAGCCTCAGG + Intronic
916718318 1:167463061-167463083 TCTGGAGGATGGGCAGTCGCCGG + Intronic
917148300 1:171916499-171916521 TCAGAAGGAGGGGCATCAGAAGG + Intronic
921386216 1:214572472-214572494 TCTGAAAGAGGGGCAGGAACAGG + Intergenic
922250659 1:223846029-223846051 CCTGGGGGAGGGGCGGCCGCGGG + Intergenic
922604338 1:226879998-226880020 TCAGAAAGAAGGGCAGCCACAGG + Intronic
922814740 1:228440427-228440449 TCTGAAGTAGAGGCAGCCTCGGG + Intergenic
1065050637 10:21787989-21788011 TCTGATGGTGGGGTAGCCTCAGG - Intronic
1065742547 10:28810465-28810487 CCTGGGGGAGGGGCACCCGCAGG - Intergenic
1065867268 10:29925126-29925148 TCTTAAGGAGGGGCAGGCACTGG + Intergenic
1067243607 10:44517485-44517507 TTTGAAGGAGTGGCTGCCGGAGG - Intergenic
1068591474 10:58857109-58857131 TCTGAAGGACGGGCTGCCGTGGG - Intergenic
1069816214 10:71196218-71196240 TCTTATGGAGGGGCTGCCTCAGG - Intergenic
1070649962 10:78228299-78228321 TCTGAAATAGGGGCAGGAGCAGG - Intergenic
1071489601 10:86127372-86127394 ATAGAAGGAGGGACAGCCGCGGG - Intronic
1076124292 10:127962234-127962256 CCTAATGGAGGGGCAGCCCCAGG + Intronic
1076236291 10:128865688-128865710 GCTAAAGGAGGGCCAGCCCCGGG - Intergenic
1076522170 10:131088059-131088081 GCGGAAGGAGAGGCAGTCGCTGG - Intergenic
1077387425 11:2276836-2276858 TCAGAAGGTGGGGGAGCCACAGG - Intergenic
1077407409 11:2388803-2388825 TCTCAAGGAGGGCCAGGCCCTGG - Intronic
1078258733 11:9683951-9683973 TGAGAAGGTGGGGCAGCCGAGGG + Intronic
1080749539 11:35139427-35139449 TCAGCCGGAGGGGCTGCCGCCGG - Intronic
1083342521 11:61967750-61967772 TGTGGGGGAGGGGCGGCCGCTGG + Intergenic
1083387777 11:62324669-62324691 CCTGAAGGCAGGCCAGCCGCTGG + Intergenic
1083631086 11:64095869-64095891 TCTGGGGAAGGGGCAGCCGAGGG + Intronic
1084029543 11:66473292-66473314 CCTGGAGGAGGGGCTGCCGAGGG + Exonic
1084476885 11:69394320-69394342 TCTGAAAGAGGGGAAGGAGCTGG + Intergenic
1084733350 11:71088803-71088825 TCAGGACGAGGGGCAGCCCCTGG - Intronic
1084859758 11:72010770-72010792 GCTGAAGGTGGGGCAGCTGGGGG - Exonic
1087672727 11:101127462-101127484 GCTCAAGGAGGGCCTGCCGCAGG - Exonic
1089114224 11:116081195-116081217 CCAGAAGGAAGGGCAGCTGCTGG - Intergenic
1092232283 12:6782904-6782926 TTTGAAGGAGGGATAGCAGCAGG - Intergenic
1096594793 12:52688029-52688051 TCAGAAGGTGTGGCAGCTGCTGG - Intergenic
1096806275 12:54143071-54143093 TCTTCAGGTGGGGCAGCCACGGG - Intergenic
1100733062 12:97495171-97495193 TCTTATGGGGGGGGAGCCGCTGG + Intergenic
1104532496 12:129585426-129585448 TTTGAAAGTGGAGCAGCCGCAGG + Intronic
1108695064 13:52895920-52895942 TCTGAAGGAGGAGCAGAAGCTGG - Intergenic
1112238024 13:97653624-97653646 GCTGAAGCAGGAGCAGCCTCTGG - Intergenic
1112441101 13:99425834-99425856 CCTGGAGGAGGGGCGGCCGCGGG + Intergenic
1114524547 14:23359678-23359700 TCTGGAGAAGGGGGAGCCTCTGG + Exonic
1121261762 14:92571621-92571643 TCTGAAGGAGGAGCAGCCCGTGG - Intronic
1122483091 14:102060378-102060400 TCGGAAGGAGGGTCCGCTGCAGG - Intergenic
1123025328 14:105421217-105421239 GCTGTGGGAGGGGCTGCCGCTGG - Intronic
1123038197 14:105479774-105479796 ATTGGAGGAGGGGCAGCCACGGG + Intronic
1124492560 15:30167194-30167216 TCAGAAGGAGAGACAGCCGAGGG - Intergenic
1124750974 15:32371131-32371153 TCAGAAGGAGAGACAGCCGAGGG + Intergenic
1125158248 15:36614217-36614239 TCAGAGGGAGGAGCAGCAGCAGG - Intronic
1128517650 15:68352898-68352920 TCTAAAGGAGGGCCGGCCACAGG - Intronic
1129411432 15:75352580-75352602 TCTGAGGAAGGGGCAGGGGCAGG - Exonic
1133771257 16:8868442-8868464 TCTGGGGGAGGAGGAGCCGCCGG - Intronic
1134367446 16:13592422-13592444 TCTGAAGTAGGGGCAGTTTCTGG + Intergenic
1134388233 16:13794152-13794174 GCTGGAGGAGGGGCAGGGGCTGG - Intergenic
1134401361 16:13913437-13913459 TCTGGAGGAGTGGCAGGGGCAGG - Intergenic
1136248716 16:28989846-28989868 TCTGCGGGAGGGGCAGGAGCTGG + Intronic
1136293090 16:29287492-29287514 GCTGACGGATGGGCAGCCACAGG + Intergenic
1137440784 16:48497168-48497190 TCTGAAGCTGGGGCAGCAGCCGG - Intergenic
1139423807 16:66866463-66866485 TCTGAAGGAGGCGGAGGCCCAGG + Intronic
1140479053 16:75252755-75252777 TCAGACAGAGGGGCAGCTGCAGG - Intronic
1141614663 16:85203343-85203365 TCTAAAGGTGGGGCAGGTGCGGG + Intergenic
1142098974 16:88261499-88261521 GCTGACGGATGGGCAGCCACAGG + Intergenic
1142230307 16:88897038-88897060 TCTGAGGCTGGGGGAGCCGCGGG - Intronic
1142251923 16:88995962-88995984 GCTGAAGTGGGGGCAGCTGCAGG + Intergenic
1143469169 17:7161000-7161022 TCTGAAGGAGGGGTGGCTGGAGG - Intergenic
1144785145 17:17827322-17827344 TGTGAAGAAGGGTCAGCCACAGG + Intronic
1145736963 17:27239907-27239929 TCTGAAGGAAGGGCAGGGGGCGG - Intergenic
1145996053 17:29105644-29105666 TCTGAAGGCTGGGCATCTGCTGG + Intronic
1147187726 17:38721937-38721959 GCTGGAGGAGGGGCAGCGGTGGG - Exonic
1147384282 17:40072353-40072375 GCTGAGAGAGGGGCAGCCCCGGG - Intronic
1148189153 17:45666781-45666803 TCTGGAGGAGGGGCTGCCACAGG - Intergenic
1148645503 17:49217798-49217820 TCTGGCCGGGGGGCAGCCGCTGG - Exonic
1151783886 17:76265775-76265797 TCTGCACGTGGGGCAGCCGAGGG + Intronic
1151975077 17:77480011-77480033 TCTGAAGGGGGAGCAGGAGCAGG + Intronic
1152639849 17:81444869-81444891 TTGGAAGGAGGGGCAGCCGGGGG + Intronic
1152679159 17:81656764-81656786 TCTGGAAGATGGGCAGCTGCAGG - Intronic
1152702184 17:81824605-81824627 ACAGAAGGAGGGGGAGGCGCAGG + Exonic
1152798026 17:82317453-82317475 CCAGAAGCAGGGGCAGCAGCAGG + Exonic
1152931281 17:83111452-83111474 TCTGAAGGAGGGGCTCCCAGAGG - Intergenic
1153791672 18:8584747-8584769 ACAGAAGGAGGAGCAGCAGCAGG + Intergenic
1153875086 18:9363024-9363046 TAGGAAGGAGGAGCAGCGGCAGG - Intronic
1154496253 18:14963460-14963482 GCTGATGGAGGGGCGGCCTCTGG + Intergenic
1157409631 18:47452933-47452955 TCTGAAGTAGGGGCAGTCTTTGG + Intergenic
1158950272 18:62488069-62488091 TCTGAAGGAGGGTGGGACGCAGG + Intergenic
1159136902 18:64347448-64347470 AGTGAAGGAGGGTCAGCCTCTGG + Intergenic
1160722947 19:605238-605260 CCTGACGGAGGGGGAGACGCAGG + Intronic
1160869563 19:1271030-1271052 TCTGAAGGTGAGGCTGCTGCTGG + Exonic
1160879654 19:1313604-1313626 ACTCAGGGAGGGGCAGCTGCCGG - Intergenic
1161102816 19:2429656-2429678 TCTGAAGGAGGCTCTGCCGTCGG + Exonic
1161252150 19:3285988-3286010 GCTGCAGGAGGGGCGGCGGCTGG - Exonic
1161395255 19:4042114-4042136 GCTGAAGGAGCCGCAGCCTCAGG - Intergenic
1161417328 19:4154755-4154777 TCTCAGCGAGGGGCAGCAGCTGG + Intronic
1162788890 19:13053034-13053056 TGTGCAGGAGGGGCAGCCTGTGG - Intronic
1162797794 19:13095598-13095620 TCTGCATGAGGGGCAGGGGCAGG - Exonic
1163117312 19:15196210-15196232 TCGAAGGGCGGGGCAGCCGCGGG + Intronic
1163672347 19:18636626-18636648 TCTGAAGAAGGGGCAGGCCCAGG - Intergenic
1164715229 19:30385916-30385938 TCTGAAGGAGTGGCAGTGCCTGG + Intronic
1165782323 19:38441690-38441712 CCTGGAGGAGGGGCAGGGGCTGG + Intronic
1166038991 19:40191239-40191261 TCCGAAGGAGGGGCCGAGGCCGG + Intergenic
1166069860 19:40380746-40380768 TCGGAAGAAGGGGCTGCTGCCGG + Exonic
1166118019 19:40667580-40667602 TCTGGAGCTGGGGCAGGCGCTGG + Exonic
1166243024 19:41506914-41506936 TCAGAGGGAGGAGCAGCAGCAGG - Intergenic
1166294761 19:41883409-41883431 GCCCAAGGAGGGGCGGCCGCTGG - Intronic
1166365817 19:42278018-42278040 TCTGATGGAGGGTCAGGCCCTGG - Intronic
1166677168 19:44747484-44747506 CCTGGGGGCGGGGCAGCCGCTGG - Intergenic
1166853678 19:45771891-45771913 TCTGCCGCAGGGACAGCCGCTGG + Exonic
1168107091 19:54172197-54172219 TCTGAGGGAGGAGGAGCCGGGGG - Intronic
1168107105 19:54172234-54172256 TCTGAGGGAGGAGGAGCCGGGGG - Intronic
1168107119 19:54172271-54172293 TCTGAGGGAGGAGGAGCCGGGGG - Intronic
1168107133 19:54172308-54172330 TCTGAGGGAGGAGGAGCCGGGGG - Intronic
1168107147 19:54172345-54172367 TCTGAGGGAGGAGGAGCCGGGGG - Intronic
1168107161 19:54172382-54172404 TCTGAGGGAGGAGGAGCCGGGGG - Intronic
1168107188 19:54172456-54172478 TCTGAGGGAGGAGGAGCCGGGGG - Intronic
1168107217 19:54172530-54172552 TCTGAGGGAGGAGGAGCCGGGGG - Intronic
1168252310 19:55147733-55147755 TCTGAGGGAGGAGGGGCCGCGGG + Intronic
1202700406 1_KI270712v1_random:159789-159811 TCTGGAGGAGGGGCAACCTTGGG + Intergenic
925167526 2:1727275-1727297 TCTGAAGGAGGGGCAGCCGCTGG - Intronic
926134406 2:10326405-10326427 TCTGAAGCAGGCCCAGCCACAGG - Intronic
927209917 2:20632773-20632795 TCTGGAGGTGGGGCAGCCCCTGG - Intronic
927766115 2:25809886-25809908 TCAGAGGGAGGAGCAGCAGCAGG + Intronic
932340719 2:70961228-70961250 CCTGAAGGAGGGGAAGCCAGGGG + Intronic
932487824 2:72095318-72095340 TTTGCAGGAGGGCCAGCTGCAGG + Intergenic
932845749 2:75134405-75134427 TCTGAAGGAGTGGCTGTCTCTGG + Intronic
933585469 2:84175319-84175341 TCTGAAGCAGGGGCAGGGGTGGG - Intergenic
934171334 2:89543262-89543284 TCTGGAGGAGGGGCAACCTTGGG + Intergenic
934281643 2:91617580-91617602 TCTGGAGGAGGGGCAACCTTGGG + Intergenic
934792060 2:97069902-97069924 CCAGAAGGAGGGGCAGCCGAAGG + Intergenic
934814559 2:97313808-97313830 CCAGAAGGAGGGGCAGCCGAAGG - Intergenic
934823135 2:97394675-97394697 CCAGAAGGAGGGGCAGCTGAAGG + Intergenic
936628621 2:114175727-114175749 TCTGATGGAAGGGCAGCCAAAGG + Intergenic
938554993 2:132416360-132416382 TCCCAAGGAGGTGCAGCCCCGGG - Intergenic
938899495 2:135787821-135787843 TCTCAAGGAGGGGCAACCATAGG + Exonic
946767804 2:223056197-223056219 TATGAAGAAGAGGCTGCCGCAGG - Intronic
947488397 2:230573126-230573148 TCAGAGGGAGGAGCAGCAGCAGG + Intergenic
947907095 2:233772893-233772915 TTTGCAGTAGGGGCAGCCGTGGG - Exonic
948368414 2:237473258-237473280 TCTTAAGGAGCAGCAGCCGGTGG - Intergenic
948584714 2:239012211-239012233 TGTGAGAGAGGGGCAGGCGCAGG + Intergenic
949037084 2:241820914-241820936 TCTGAAGAAGGGGCCGGAGCTGG + Intergenic
1171230484 20:23480345-23480367 TCTGCAGAAGGGCCAGGCGCAGG + Intergenic
1172028853 20:31967976-31967998 GCCGAAGGGGGGGCAGCCCCCGG - Intergenic
1172827772 20:37805048-37805070 TTTGTAGGAGTGGCAGCAGCTGG - Intronic
1173246387 20:41340667-41340689 TCTGGAGGTGGGGCAGGCGGTGG + Intergenic
1175374145 20:58513461-58513483 TCTGAAGGAGGGTCAGGGGAGGG - Intronic
1175668716 20:60882672-60882694 TCTGAACAAGGGGCAGATGCTGG - Intergenic
1175869518 20:62201713-62201735 TCTGAAGGACAGGAAGCAGCTGG - Exonic
1175895064 20:62332498-62332520 TCAGCAGGTGGGGCAGCCCCGGG + Intronic
1176171579 20:63698782-63698804 TCTGAGGTAGGGGAAGCCCCGGG - Exonic
1176247329 20:64103655-64103677 TCTGAAGGCTGGGCAGGGGCTGG - Intergenic
1176933540 21:14841851-14841873 TCTGAAGGAGGAGCACCTGGTGG - Intergenic
1178894712 21:36548891-36548913 CCTGGAGAAGGGGCAGCCACTGG - Intronic
1180050651 21:45329583-45329605 GCTGAGGGAGGGGCACCCTCCGG - Intergenic
1181551229 22:23640018-23640040 TCTGAATGAGGGACAGAGGCCGG - Intergenic
1181978479 22:26749449-26749471 ACTCAAGGAGGGCCAGCCGCAGG + Intergenic
1183381579 22:37492905-37492927 TGTGTAGGAGGAGCAGCAGCAGG - Intronic
1183780344 22:39995189-39995211 GCTCAAGGAGGAGCAGCTGCGGG + Exonic
1185054088 22:48569019-48569041 TCTGAAGGAGGGGCAGGGCCGGG + Intronic
949414619 3:3800760-3800782 CCAGAAGGAGTGGCAGCCTCAGG + Intronic
950040405 3:9916155-9916177 TCTGAAGGAGGGTGAGGCGGTGG + Exonic
950129313 3:10531111-10531133 GTTGCAGGAGGGGCAGCCTCTGG + Intronic
953636794 3:44671094-44671116 CCTGAAGGAGGAGCAGCCCCGGG + Intergenic
954204052 3:49044402-49044424 TCTGAAGGATGTTCAGCCCCGGG - Exonic
954371338 3:50170987-50171009 GCTGAAGGAGGGGGAGGCCCAGG - Intronic
954387867 3:50253876-50253898 TCTGAAGGAGAGTCAGCCAGGGG + Intronic
954940103 3:54363914-54363936 TCTGAAGTAAGGGCAGCCATCGG - Intronic
955055050 3:55447259-55447281 TCTGAAGGAAGGGAAGCCTGGGG - Intergenic
955067190 3:55543704-55543726 TCTGGAGGAGGGTCAGGAGCTGG + Intronic
956175656 3:66471095-66471117 TCTGTGGGAGGGTCAGCCTCTGG - Intronic
961458790 3:127037415-127037437 TGGGAAGCAGGGGCGGCCGCAGG + Intergenic
961474460 3:127138074-127138096 TCTGGAGGAGAGGCAGCCACAGG - Intergenic
961707161 3:128796086-128796108 TCTGAAGCAGGCACAGCAGCAGG - Intronic
962247293 3:133806153-133806175 CCTGAAGCAGCGGCAGCAGCTGG + Intronic
962601269 3:136992403-136992425 GCTGCAGGAGAGGCAGCCACAGG + Intronic
963712274 3:148760077-148760099 TGTGGAGGAGGGGCAGCAGTGGG - Intergenic
966711571 3:182978497-182978519 TCTGGAGTAGGGGCAACCACAGG + Intronic
966819788 3:183915353-183915375 ACTGAAGGAGGGGCAGACTCAGG + Intergenic
968054186 3:195678579-195678601 TGTGGAGGAGAGGGAGCCGCAGG + Intergenic
968468406 4:764690-764712 TCTGCAGGGGGTGCAGGCGCAGG - Intronic
969548143 4:7845630-7845652 TGTGAAGCAGGGGCAGAAGCGGG - Intronic
969583407 4:8078414-8078436 TCTGCTGGAGGGGCAGGCCCAGG - Intronic
970608312 4:17702955-17702977 TGTGAAGGTGGGGAAGCCACGGG + Intronic
973706165 4:53582898-53582920 TTTGAAGAAGTGGCAGGCGCTGG - Intronic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
984704313 4:182836649-182836671 GCTGAAGGATGTGCAGCTGCTGG - Intergenic
984704327 4:182836728-182836750 GCTGAAGGATGTGCAGCTGCTGG - Intergenic
984704337 4:182836806-182836828 CCTGAAGGATGTGCAGCTGCTGG - Intergenic
985493704 5:193212-193234 CCTGAAGGAGGGGCAGCTGGCGG + Intronic
985805611 5:2040399-2040421 TCTGAAGGAGGCTCAGCATCTGG + Intergenic
986113054 5:4739281-4739303 CCGGGAGGAGGGGCAGCCACAGG + Intergenic
986246044 5:6007865-6007887 TCTGAAGGAGGGAAAGACGAAGG - Intergenic
987037191 5:14030565-14030587 GCTGAAGGAAGGGCTGCTGCTGG - Intergenic
989619014 5:43366812-43366834 TCTGAAAGAAAGGCAGCAGCCGG - Intergenic
998407679 5:141883208-141883230 TCTGGAGGCTGGGCAGCCCCCGG + Intergenic
999765517 5:154737807-154737829 TCACAAGGAGGGGCAGGGGCGGG - Intronic
1002874975 6:1202594-1202616 TCTAATGGAGGGGCAGCCCCCGG - Intergenic
1004251788 6:14028873-14028895 TCAGAAAGGGGGCCAGCCGCAGG + Intergenic
1006219241 6:32474124-32474146 CCTGAAGGAGCAGCAGCCCCGGG + Intergenic
1006225107 6:32530829-32530851 CCTGAAGGAGCAGCAGCCCCGGG + Intergenic
1006393574 6:33772828-33772850 TTTGTAGGAGGGGCATCCACAGG - Intronic
1006614682 6:35318354-35318376 GCTGCAGGAGGCGCAGCGGCAGG + Exonic
1006924359 6:37646309-37646331 TGTGGAGAAGGGGCAGCTGCTGG - Exonic
1007179218 6:39916146-39916168 TCTGAAGCTGGGGCAGTAGCCGG + Exonic
1007352290 6:41282689-41282711 ACTGAAAGAGGGGCAGACCCTGG - Exonic
1007840928 6:44715399-44715421 GCTGAAGCAGGGGCAGAGGCAGG - Intergenic
1015812945 6:137179236-137179258 TCTGAAGAAGGGGAAGCCACTGG + Intergenic
1016861301 6:148721244-148721266 GCTGCAGCAGGGGCAGCCACAGG - Intergenic
1016922227 6:149307052-149307074 GCTGGAGGAGGGGCAGCCTTTGG - Intronic
1017099143 6:150832105-150832127 TCTGGAGCTGGAGCAGCCGCCGG + Exonic
1019310886 7:360047-360069 GCTGCAGGAGGGGCATCCCCAGG + Intergenic
1019528466 7:1492052-1492074 ACTCAAGGTGGGGCAGCCGCTGG + Intronic
1019641219 7:2104855-2104877 TTGGAAGGAGAGGCAGCTGCAGG - Intronic
1019716486 7:2541717-2541739 CCTGGAGGAGCTGCAGCCGCTGG - Exonic
1022529752 7:31059612-31059634 TCTGGAGGAGGAGGAGCCACTGG + Intronic
1023780104 7:43647470-43647492 TCTGATGGAGGAGCAGGAGCAGG + Intronic
1023832967 7:44050827-44050849 TCTGGAGGAGGAGCAGTCACGGG - Intronic
1024960570 7:54970647-54970669 TCAGCAGGAGGGACGGCCGCTGG + Intergenic
1031053788 7:116972127-116972149 TCAGAGGGAGGAGCAGCAGCAGG + Intronic
1032089746 7:128905501-128905523 TCTAAAGGACGGGCAGGAGCCGG - Intronic
1032092502 7:128918030-128918052 TCTAAAGGACGGGCAGGAGCCGG + Intergenic
1032166666 7:129550709-129550731 TGTGAAGGAGGGGCACACGCAGG + Intergenic
1033406378 7:141074053-141074075 TCTGAGGCAGGTGCAGCCTCCGG - Intergenic
1033658414 7:143388251-143388273 TCTGAAGGAGGTGGAGGAGCTGG + Exonic
1034970861 7:155418297-155418319 CCTGAAGGAGGGACAGCTGGAGG + Intergenic
1035085300 7:156253042-156253064 TCAGAAGGAGGAGCAGGAGCAGG + Intergenic
1035278494 7:157762939-157762961 TCTGATGGAGGGTTAGCCTCCGG - Intronic
1035372292 7:158387175-158387197 CCTGAAGCCAGGGCAGCCGCTGG - Intronic
1037906814 8:22720330-22720352 TGTGATGGAGGGCCAGCAGCCGG + Intronic
1038537086 8:28361021-28361043 TCCGAGGGTGGGGCAGCCGAGGG + Exonic
1039454136 8:37696723-37696745 TCTAAAGGAGGGGCTGCAGTTGG - Intronic
1039618153 8:38973625-38973647 TATGAAGGACTGGCTGCCGCAGG - Exonic
1039819927 8:41126355-41126377 ACGCAAGGAGGGGCAGCGGCAGG - Intergenic
1048990712 8:139758624-139758646 CCTGAAGGAGGGGTTGCCCCAGG + Intronic
1053372790 9:37576462-37576484 TCTGCAGGAGGGGCACCGGGAGG + Intronic
1056077757 9:83059002-83059024 TCCAAAGGAGGGACAGCCTCAGG - Intronic
1056541034 9:87571635-87571657 GCAGACGGATGGGCAGCCGCAGG - Intronic
1057265460 9:93614426-93614448 TCAGCAGGAGGGGCAGCCAGAGG - Intronic
1057292461 9:93815344-93815366 TAAGAAGGAGGGACACCCGCCGG - Intergenic
1057476718 9:95409165-95409187 TCAGGAGGAGGGTCAGCTGCTGG + Intergenic
1057829936 9:98398611-98398633 TCTGAAGGATGGTCAGGAGCAGG - Intronic
1058952551 9:109917109-109917131 TCAGAAGGAGGGGTGGCTGCAGG + Intronic
1059038401 9:110785602-110785624 TCAGAAGGAGCGGCATCCTCTGG - Exonic
1060552319 9:124491480-124491502 TGTGAAGGAGGGGTGGACGCGGG - Intronic
1060815365 9:126632409-126632431 TCTGGCGGAGGGGCTGCCGAGGG + Intronic
1061048241 9:128178988-128179010 GCTGAAGCAGGTGCAGCCACAGG - Exonic
1061140677 9:128764378-128764400 TCTGAATGAGGGAGAGCCACTGG + Intronic
1062521376 9:136959361-136959383 TCTGTGGGAGGGGCAGGCACAGG - Intergenic
1062596968 9:137303857-137303879 TCTTAAGGAGGGGGAGCCGCTGG + Intergenic
1192244238 X:69359851-69359873 TCTGAGGGAGGGGCTGGGGCAGG - Intergenic
1192568937 X:72186454-72186476 TCTAAAGGGGGAGCAGCCTCTGG + Exonic
1195116911 X:101708132-101708154 TCTGCAGGTGGGGCAGCCTAGGG + Intergenic
1200062382 X:153489314-153489336 GCTGAAGGAGGGGCAGGTGCAGG - Intronic