ID: 925169451

View in Genome Browser
Species Human (GRCh38)
Location 2:1742106-1742128
Sequence ATCCAGCCAGGACTCCATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925169448_925169451 20 Left 925169448 2:1742063-1742085 CCAGGAGACACGGGACTTGCTAA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 925169451 2:1742106-1742128 ATCCAGCCAGGACTCCATTCTGG 0: 1
1: 0
2: 0
3: 6
4: 128
925169447_925169451 21 Left 925169447 2:1742062-1742084 CCCAGGAGACACGGGACTTGCTA 0: 1
1: 0
2: 1
3: 8
4: 78
Right 925169451 2:1742106-1742128 ATCCAGCCAGGACTCCATTCTGG 0: 1
1: 0
2: 0
3: 6
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925169451 Original CRISPR ATCCAGCCAGGACTCCATTC TGG Intronic
900137322 1:1123253-1123275 CTGCAGCCAGGACTCCCGTCCGG - Intergenic
901701217 1:11045589-11045611 ATCCAGCCTGGACTCCTCCCAGG + Intronic
902570416 1:17343459-17343481 ATCCAGTGAGGACTGTATTCCGG + Intronic
902839844 1:19067830-19067852 GTCCAGCCAGGACTCCTTGTCGG + Intergenic
903202051 1:21749383-21749405 ATCCAGCCACGACTTCTTCCTGG + Intronic
906250664 1:44308521-44308543 ATCCAGCCATGGCTCCACTGTGG + Intronic
907374368 1:54023695-54023717 AGCCAGCCAGGTCTGAATTCTGG - Intergenic
915427613 1:155840425-155840447 ATCAAGCTAGGATTCGATTCTGG - Intronic
916098470 1:161372698-161372720 ATCAAGCCAGGACTCCACCTTGG - Exonic
917410594 1:174756590-174756612 ATGGGGCCAGGAATCCATTCAGG + Intronic
917473077 1:175342603-175342625 CTGGAGGCAGGACTCCATTCAGG + Intronic
919852948 1:201685949-201685971 AGCAAGCCAAGACTGCATTCAGG - Intronic
922505237 1:226122182-226122204 ACGCAGCCAGGACTGCACTCGGG + Intergenic
922633569 1:227140547-227140569 ATCCACACAGGCCTCCTTTCTGG - Intronic
924035295 1:239930210-239930232 ATCTAGCCAGGAGTCCCTTGTGG - Intergenic
1068387630 10:56352186-56352208 ATCCAGCGAGGCATCCATTGCGG + Intergenic
1070724647 10:78779809-78779831 ATACAGCCAGGATTCCAGTGAGG + Intergenic
1070773996 10:79099400-79099422 AACCAGCCAGGAGTACATCCTGG - Intronic
1070779191 10:79127652-79127674 GCCCAGCCAGGACTCCAACCAGG + Intronic
1072076866 10:91984876-91984898 ATCCAACCATGAATCCATCCAGG + Intronic
1075062798 10:119268506-119268528 ATCCAGCCAGCCCAGCATTCTGG - Intronic
1076472020 10:130725541-130725563 ATCCAGCCCGGGCTCCAAACTGG - Intergenic
1084284956 11:68125057-68125079 CTCCACCCAGGACCCCATCCAGG + Intergenic
1087966820 11:104425135-104425157 AGGCAGCAAGGACTCCAGTCTGG - Intergenic
1088086690 11:105989762-105989784 TTCCATCTAGGACTCCGTTCAGG + Intergenic
1088731743 11:112689785-112689807 ATCCAGCCAGGCCAGCTTTCTGG - Intergenic
1095837178 12:46651844-46651866 GCCCAGCCAGCACTACATTCTGG + Intergenic
1097811528 12:64024397-64024419 CTCCAGCCTGGACTCCAGCCTGG + Intronic
1102569552 12:113819164-113819186 TTCCAGCCAGCCCTCCACTCTGG + Intronic
1103486245 12:121284691-121284713 GTCCAGCCTGGACTTTATTCAGG - Intronic
1106284946 13:28310319-28310341 ATGCAGTCAGGACTCCTTTTAGG - Intronic
1110144709 13:72176710-72176732 ATACTGCAATGACTCCATTCAGG + Intergenic
1111340468 13:86878996-86879018 ATCCAGCCAGTACTGAAGTCTGG - Intergenic
1113827657 13:113268922-113268944 AGCCTTCCAGAACTCCATTCTGG - Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1123759150 15:23419409-23419431 ATCGAGCCTGCACTCCAGTCTGG - Intergenic
1125930459 15:43596002-43596024 GTCCAGCCAGGTCACCCTTCAGG - Exonic
1125943627 15:43695834-43695856 GTCCAGCCAGGTCACCCTTCAGG - Exonic
1129270789 15:74418274-74418296 ATCCAGACAGGACCCCTTTGTGG + Exonic
1129320906 15:74774258-74774280 GTGCAGCCAGGACTCCAACCTGG + Intergenic
1130515316 15:84621809-84621831 CTTCAGCCGGGGCTCCATTCTGG + Exonic
1131381276 15:91965814-91965836 ATCCCTCCAGGAGTACATTCTGG - Intronic
1134418223 16:14062761-14062783 ATCCAGCCAGGCCTGCAGTGTGG - Intergenic
1138511689 16:57512418-57512440 ACCCACCCAGGACTTCATGCAGG - Exonic
1142285404 16:89169606-89169628 CTCCAGCTAGGACCCCACTCTGG - Intergenic
1143001922 17:3800071-3800093 ATCCAGCCTGGGCTCCAGCCTGG + Intronic
1144729895 17:17520217-17520239 ATGCAGCCAGGGCCCCATCCTGG + Intronic
1147903981 17:43810854-43810876 AACCAGCCTGGAGGCCATTCAGG - Exonic
1148787892 17:50154430-50154452 GTGCAGCTAGGACTCAATTCAGG - Intergenic
1149382279 17:56106198-56106220 ACACAGCCAGGACTCCAACCAGG + Intergenic
1149798699 17:59545905-59545927 ATCCAGCCTGCACTCCAGCCTGG + Intergenic
1151123480 17:71819297-71819319 AGCCATCCAGGATTACATTCTGG + Intergenic
1151506341 17:74530121-74530143 GTCCAGCCAGGACTGGAGTCGGG + Intronic
1152137027 17:78510520-78510542 ATCCAGGCAGGATTCATTTCAGG + Intronic
1152459178 17:80432379-80432401 ATCCAGACAGGACTCCACAGGGG - Intronic
1157220685 18:45826706-45826728 ATGGAGCCAGGACCCCATACAGG - Intronic
1163439416 19:17314172-17314194 TTCCAGCCAAGACCCCAATCGGG - Intronic
1163722410 19:18904607-18904629 ACTCAGCCTTGACTCCATTCCGG - Intronic
1164062754 19:21689775-21689797 ATCCAGCCTGATATCCATTCTGG - Intergenic
1165417801 19:35705475-35705497 ATCCAACCTGGACTCCATACTGG - Intronic
1167782924 19:51612200-51612222 CTCCAGCCAGGACTGAACTCTGG + Exonic
925169451 2:1742106-1742128 ATCCAGCCAGGACTCCATTCTGG + Intronic
927227943 2:20788974-20788996 AGAGAGCCAGGACTCCATGCTGG - Intronic
929463737 2:42126166-42126188 TTCCAGCCGGGACACCATTGAGG - Intergenic
929499956 2:42481821-42481843 ATCCCTCCAGGACCCTATTCAGG + Intronic
936141456 2:109945577-109945599 CTCCAGCTAGGACACAATTCTGG + Intergenic
936178145 2:110243525-110243547 CTCCAGCTAGGACACAATTCTGG + Intergenic
936203237 2:110425906-110425928 CTCCAGCTAGGACACAATTCTGG - Intronic
936827457 2:116599746-116599768 ATCCAGCCCTCACTCCATTTGGG + Intergenic
937931150 2:127205941-127205963 CTCCCGCCAGGACTCCATGTTGG + Intronic
940259860 2:151768384-151768406 ATACAACCAGGTCTCTATTCTGG + Intergenic
945492364 2:210471507-210471529 ATCCATACAGGAATCCATACAGG - Intronic
948635834 2:239336865-239336887 ATCCATCCAGGATCCCATCCAGG + Intronic
1170594871 20:17797693-17797715 ACCCATCCAGGTTTCCATTCAGG + Intergenic
1170691879 20:18623718-18623740 GTCCAGCCGGGTCTCCTTTCAGG + Intronic
1172098345 20:32471574-32471596 ATCCAGCCAGGAGTGATTTCAGG - Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1178787448 21:35666960-35666982 ATCCACCCAGGACACTATTAAGG - Intronic
1181636756 22:24178133-24178155 ATCCAGCCAGGAGTCCTCGCTGG + Exonic
1182572742 22:31250833-31250855 ATCCAGCAAGGACCCTGTTCAGG - Intronic
949991559 3:9583430-9583452 ATCCAGCCAGGAGCCCCTTGTGG - Intergenic
950739747 3:15040833-15040855 ATCCAGCCAGGTATACAGTCAGG + Intronic
953603520 3:44390986-44391008 AGCCTCCCAGGACTCCATCCAGG + Intronic
954384047 3:50235192-50235214 AGCCATCCTGGACTCCAATCTGG - Intronic
958075162 3:88666882-88666904 ATCCAGGCAGTTCTCCATTTGGG + Intergenic
962187518 3:133275533-133275555 ATGCAGCCTGGACTCTTTTCTGG + Intronic
962393434 3:134993079-134993101 AACCAGGCAGGACATCATTCTGG - Intronic
962976458 3:140450308-140450330 ATCCATCCAGGCCTCCATCCAGG + Intronic
964544240 3:157815936-157815958 AACCTACAAGGACTCCATTCTGG - Intergenic
967977092 3:195041425-195041447 CAGCAGCCAGCACTCCATTCTGG + Intergenic
968051654 3:195658536-195658558 GCCCAGCCAGGACTCCACCCCGG - Intergenic
968104161 3:195989797-195989819 GCCCAGCCAGGACTCCACCCCGG + Intergenic
968302463 3:197627387-197627409 GCCCAGCCAGGACTCCACCCCGG + Intergenic
968480907 4:832668-832690 ACCCAGCCAGGACCCCATGGAGG + Intergenic
970928130 4:21476925-21476947 ATCCAGGCAGGACTCTGTCCTGG + Intronic
972786739 4:42333285-42333307 AGCCACCCAGGACTTCATTATGG + Intergenic
975177232 4:71301757-71301779 AGCCAGCCAGGAATCCCTTGAGG + Intronic
977115367 4:93017761-93017783 CTCCAGCCAGGACTCCAGCCAGG + Intronic
981835574 4:149049581-149049603 ACCAAGCCAGGAATCCATTTGGG + Intergenic
985027964 4:185758255-185758277 CTCTAGCCAGGACCCCATTGAGG + Intronic
987473554 5:18362411-18362433 ATCCCACCAAGACTCCATTCTGG + Intergenic
987844696 5:23267759-23267781 ATCCTGCCAAGGCTTCATTCAGG + Intergenic
993904858 5:93611684-93611706 CTCCCACCAGGACCCCATTCTGG - Intergenic
997361524 5:133298367-133298389 ATCCAGCCAACACTCCATCGTGG + Intronic
997388550 5:133495067-133495089 ATCCTGACAGGAATCCATCCGGG + Intronic
998253238 5:140566591-140566613 AGCCAGCCAGGAATCCCTTGAGG - Exonic
1004096281 6:12558002-12558024 CTCCAGCCAGAAATCCTTTCTGG - Intergenic
1012077539 6:94710566-94710588 ATACAACCAGGACTCCACTCAGG - Intergenic
1013908541 6:115246596-115246618 ATCCAGGCAGGACTCACTGCAGG + Intergenic
1014029481 6:116683952-116683974 CTCCAGCCTGGACTCCAGCCTGG - Intronic
1016783171 6:147982617-147982639 ATCCAGCAAAGACTCCAAACAGG + Intergenic
1018816430 6:167336049-167336071 ATCTACCCAGGGGTCCATTCAGG - Intronic
1020555367 7:9663844-9663866 AACCAGCCCGGACTCCACTGGGG - Intergenic
1022148704 7:27575832-27575854 GTCCAGCCCAGAATCCATTCAGG - Intronic
1022220670 7:28310417-28310439 GTCCAGCCAGGACTAGAATCTGG - Intronic
1024233147 7:47377983-47378005 ATCAAGCCAGGACTCAAGCCTGG - Intronic
1026446870 7:70492297-70492319 ATCCAGCCACCACTCCCGTCAGG + Intronic
1031452742 7:121941926-121941948 ATCTAGCCAGGATTCCACTGAGG + Intronic
1035832478 8:2712192-2712214 ATCAACGCAGGGCTCCATTCAGG - Intergenic
1035996360 8:4551714-4551736 CTCCAGCCTGGACTCCAGCCTGG - Intronic
1037246833 8:16845006-16845028 CTCCAGCCAGGATTTCTTTCTGG + Intergenic
1048196641 8:132336925-132336947 ATCCAGCCCACATTCCATTCAGG + Intronic
1048790332 8:138097996-138098018 CTCCAGCCTGGACTCCAGCCTGG - Intergenic
1052069083 9:24059129-24059151 ATAAAGCCAGGACTCCACTTGGG - Intergenic
1053467278 9:38317934-38317956 AGCCAGGCTGCACTCCATTCTGG + Intergenic
1055616974 9:78083185-78083207 CCCCTGCCAGGACTCCATTTTGG - Intergenic
1056992252 9:91423385-91423407 AACCAGCCAGGACTACGTGCCGG + Intronic
1060046367 9:120344526-120344548 ATCCTCCCAGGACTCCATGTAGG + Intergenic
1060137323 9:121170006-121170028 AGCCAGCCAGAGCTCCATTGAGG - Intronic
1062388651 9:136325315-136325337 ATCCAGCCAGGACCCACTGCAGG + Intergenic
1062409069 9:136413020-136413042 ATCCACCCAAGTCTCCATCCAGG - Intronic
1188960589 X:36486748-36486770 CTCCAGCCATGTCTCCATACTGG - Intergenic
1195499590 X:105579742-105579764 ATGAAGCCAGTACTCAATTCTGG + Intronic
1197414995 X:126164739-126164761 TTCCAGCCTGGACTCCATGCCGG - Exonic
1199129494 X:144167500-144167522 AGCCAGTCAGGACTTCATTATGG + Intergenic