ID: 925170484

View in Genome Browser
Species Human (GRCh38)
Location 2:1747305-1747327
Sequence GCAGGATCCCGCAGGGGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 2, 1: 1, 2: 0, 3: 14, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925170484_925170489 -6 Left 925170484 2:1747305-1747327 CCATCGCCCCTGCGGGATCCTGC 0: 2
1: 1
2: 0
3: 14
4: 114
Right 925170489 2:1747322-1747344 TCCTGCGCACACTCTCCAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 119
925170484_925170493 12 Left 925170484 2:1747305-1747327 CCATCGCCCCTGCGGGATCCTGC 0: 2
1: 1
2: 0
3: 14
4: 114
Right 925170493 2:1747340-1747362 GTGGGTTCAGATTAGACTCCGGG 0: 2
1: 0
2: 0
3: 8
4: 96
925170484_925170494 29 Left 925170484 2:1747305-1747327 CCATCGCCCCTGCGGGATCCTGC 0: 2
1: 1
2: 0
3: 14
4: 114
Right 925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG No data
925170484_925170492 11 Left 925170484 2:1747305-1747327 CCATCGCCCCTGCGGGATCCTGC 0: 2
1: 1
2: 0
3: 14
4: 114
Right 925170492 2:1747339-1747361 AGTGGGTTCAGATTAGACTCCGG 0: 2
1: 0
2: 1
3: 7
4: 107
925170484_925170496 30 Left 925170484 2:1747305-1747327 CCATCGCCCCTGCGGGATCCTGC 0: 2
1: 1
2: 0
3: 14
4: 114
Right 925170496 2:1747358-1747380 CCGGGTGCCATCGCCCCTGCGGG No data
925170484_925170488 -7 Left 925170484 2:1747305-1747327 CCATCGCCCCTGCGGGATCCTGC 0: 2
1: 1
2: 0
3: 14
4: 114
Right 925170488 2:1747321-1747343 ATCCTGCGCACACTCTCCAGTGG 0: 1
1: 0
2: 2
3: 19
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925170484 Original CRISPR GCAGGATCCCGCAGGGGCGA TGG (reversed) Intergenic
901189974 1:7403941-7403963 GTAGGATCCCGCAGGGGTCAGGG - Intronic
901490085 1:9592301-9592323 TCAGGTTCCCTCAGGGGCCAGGG - Intronic
904438137 1:30512624-30512646 GCAGGGCCCCGCAGGAGCCAGGG - Intergenic
905473901 1:38212494-38212516 GGAGGAGCCAGCAGGTGCGAAGG + Intergenic
911115999 1:94247454-94247476 CCAGGGTCCGGCAGGGGCTAGGG - Intronic
913979621 1:143497599-143497621 GCAGAAAGCCGCAGCGGCGATGG - Intergenic
916488307 1:165278892-165278914 GCAGGACCCCGCAAGGGCCATGG + Intronic
919785446 1:201255266-201255288 CCAGGGTCCCGCAGGGGCGGAGG - Intergenic
920367780 1:205457117-205457139 CCGGGAGCCCGCAGGGGCGGGGG + Intergenic
923119535 1:230978187-230978209 CGAGGATGCCGAAGGGGCGAGGG - Intronic
1063125014 10:3129679-3129701 CCAGCATCCCGCAGAGGTGAAGG - Intronic
1063309277 10:4937507-4937529 GCAGGAGCCCACAGCGGGGACGG + Intronic
1067038834 10:42937794-42937816 TCAGGATCCCTCAGTGGCCATGG - Intergenic
1067060875 10:43077348-43077370 GCCGGCTCCCGCAGGGGCCAGGG + Intronic
1075846848 10:125551787-125551809 CCAGGTTCCCACAGGAGCGAGGG - Intergenic
1075922587 10:126225478-126225500 GCAGGATCACGCATGGATGACGG - Intronic
1076774928 10:132689987-132690009 GCTGGCTCCAGCAGGGGCGCAGG - Intronic
1076774950 10:132690068-132690090 GCTGGCTCCAGCAGGGGCGCAGG - Intronic
1077201471 11:1309555-1309577 GCAGGCTCCGGCGGGGGCGCAGG - Exonic
1077352374 11:2098919-2098941 GCAGGATCCAGGAGGGGTGCTGG - Intergenic
1077442426 11:2574914-2574936 GCAGGCTCCCGCAGGGGGGCTGG - Intronic
1081708328 11:45199801-45199823 GCAGGATCTCGCAGGGCCTGTGG - Intronic
1083280446 11:61623752-61623774 GCAGGACCCCGCTGGAGCGAGGG - Intergenic
1084975069 11:72792579-72792601 GCATGATCCTGCAGGTGCCATGG + Intronic
1088480913 11:110296172-110296194 GGAGAATCCCGCGGCGGCGAAGG + Intronic
1093346289 12:18040490-18040512 ACAGGAGCCCACAGGGGCGGGGG - Intergenic
1096073575 12:48788944-48788966 GCCGGAGCCCGCGGGGGCGGCGG - Intronic
1096581811 12:52590544-52590566 GAAGGAGCCCGCAGGAGCAATGG - Intronic
1100586888 12:95988784-95988806 ACAGAATCCCGAGGGGGCGATGG + Intronic
1103991992 12:124805471-124805493 GCTGGATCCTGCAGGGCCCAGGG + Intronic
1104330391 12:127839075-127839097 GCACCACCCCACAGGGGCGAAGG + Intergenic
1104897797 12:132172787-132172809 GGAAGAGGCCGCAGGGGCGAGGG + Intergenic
1113376682 13:109770493-109770515 CCAGGTTCACGCAGGGGTGAAGG + Intronic
1114066000 14:19060288-19060310 TCAGGACCCCTTAGGGGCGAGGG + Intergenic
1114096268 14:19339737-19339759 TCAGGACCCCTTAGGGGCGAGGG - Intergenic
1115768649 14:36647949-36647971 GCAGGGTCCAGCAGGGGCTCAGG + Intergenic
1117742656 14:58834197-58834219 GCAGGAGCCCACAGCGGCGGAGG - Intergenic
1118440836 14:65810087-65810109 GCAGGATCCAGCAAGGGACATGG - Intergenic
1118470565 14:66070942-66070964 GCAGGACCCCTCAGGGAGGATGG - Intergenic
1121439449 14:93939665-93939687 GCACGATCCTGCCGGGTCGAGGG + Exonic
1122265122 14:100543005-100543027 GGAGGATCCCAAAGGGGCCAAGG - Intronic
1122719271 14:103713083-103713105 AGAGGAACCCCCAGGGGCGAAGG - Intronic
1124849347 15:33321345-33321367 GCAGGACCTCTCAGGGGAGAGGG - Intronic
1129412969 15:75359981-75360003 GAAGGAGCCTGCAGGGGCCAAGG + Exonic
1132136223 15:99342268-99342290 GCAGGATTCCCCGGGGGCTAAGG - Intronic
1132314371 15:100879657-100879679 TCGGGCTCCCGCAGGGGCGGCGG + Exonic
1132596290 16:751972-751994 GCGAGATCGCGCAGGGGCGGTGG + Intronic
1132643888 16:990026-990048 GCAGGAGCCCTCAGGGGAGAGGG + Intergenic
1132684467 16:1156528-1156550 GCAGGAGGCGGCAGGGGCGGTGG + Intronic
1133329971 16:4966863-4966885 GCAGGGTCCCGAAGGGGTAAAGG - Intronic
1136089879 16:27911121-27911143 GCAGGATCCGGCAGCTGCTAGGG - Intronic
1136532523 16:30879089-30879111 GCAGGATCCTGCTAGGGTGATGG + Intronic
1139545689 16:67648555-67648577 GCAGGAGCGGGGAGGGGCGAAGG - Intronic
1140209114 16:72957448-72957470 GCTGGATCCCGCCGGGCCCATGG - Exonic
1142275752 16:89118005-89118027 GCAGGTTCCCTCAGGCGCCAGGG + Intronic
1142363514 16:89638156-89638178 GCAGGAGCCCCCAGTGGCGATGG - Exonic
1142427983 16:90010944-90010966 ACAGGTTCCTGCAGGGGCAATGG - Intronic
1147311085 17:39596592-39596614 GCGGGATCCAGCAGGGGCAGGGG - Intergenic
1152093152 17:78257900-78257922 GCTGGATCCCACAGAGGCCAGGG - Intergenic
1153015612 18:580235-580257 GCAAGATCCCGCAGATGGGAGGG + Intergenic
1159810335 18:73011732-73011754 GCCGGATCCAGGAGGGGCCAGGG + Intergenic
1161326758 19:3667874-3667896 GCAGGCCCCCGCTGGGGCGAGGG + Intronic
1161384094 19:3981880-3981902 GCCGGAGCCCACAGGGCCGAGGG + Intronic
1163638241 19:18447507-18447529 GCAGGCCCCTGAAGGGGCGAAGG - Intronic
1167045829 19:47048229-47048251 GCAGGTGCCCGCAGAGGGGATGG - Intronic
1168231167 19:55032464-55032486 GGCGGATCCCGCAGGAGGGAAGG + Intronic
925170484 2:1747305-1747327 GCAGGATCCCGCAGGGGCGATGG - Intergenic
925170497 2:1747365-1747387 GCAGGATCCCGCAGGGGCGATGG - Intergenic
925170507 2:1747424-1747446 ACAGGACCCTGCAGGGGTGATGG - Intergenic
925170520 2:1747484-1747506 ACAGGATCCCGCAGGGGCGATGG - Intergenic
925170532 2:1747544-1747566 ACAGGATCCTGCAGGGGTGATGG - Intergenic
926115221 2:10208937-10208959 GCAGGATCCAGCACGTGGGAGGG - Intronic
934724209 2:96604807-96604829 GCAGGCTTCAGCAGGGGCCAAGG - Exonic
936089411 2:109491256-109491278 CCAGGATCCCCCAGGGTTGAGGG - Intronic
936572307 2:113627169-113627191 GAAGGACCCCGCCGGGGCGCTGG - Intergenic
946688351 2:222293280-222293302 GCAGGAGACGGCAGGGGGGAGGG - Intronic
947571527 2:231239328-231239350 GCAGGATCCAGCAGCGTTGATGG + Intronic
948811564 2:240481012-240481034 TCAGGATCCCGTAGCAGCGAGGG + Exonic
1168891175 20:1296196-1296218 GCAGGACACCCCAGGAGCGAGGG - Intronic
1170687687 20:18584334-18584356 GCAGGATGCTGCAGGAGGGATGG + Intronic
1172936337 20:38623174-38623196 CAAGGATCCCGCAGGGGTGATGG + Intronic
1174736727 20:52972229-52972251 ACAGCGTCCCGCAGGGGAGAGGG - Intergenic
1175943224 20:62547404-62547426 GCAGGAGCCCGGAGGCGGGAAGG - Intergenic
1176217516 20:63955437-63955459 GCTGGATGCCGCAGGGGGAAGGG - Intronic
1179974810 21:44858588-44858610 GCAGGGTCCCGCAGGGGAACAGG - Intronic
1180484480 22:15782880-15782902 TCAGGACCCCTTAGGGGCGAGGG + Intergenic
1181161342 22:20961745-20961767 GCAGGAACAGGCATGGGCGATGG + Intergenic
1181557719 22:23681438-23681460 GCAGGCTCCCACAGGGCCTAAGG - Intergenic
1184172930 22:42769965-42769987 GCGGGGTCCTGCAGGGGCGCTGG - Intergenic
1184688026 22:46105136-46105158 CCAGGAACCCCCAGGGGCCAGGG + Intronic
1185427881 22:50783711-50783733 GAAGGACCCCGCCGGGGCGCTGG + Intergenic
954143318 3:48621487-48621509 GCAAGATACTGCAGGGGCGGCGG - Exonic
954558807 3:51538868-51538890 GCCGGACCGCGCAGGGCCGAGGG - Intergenic
962852603 3:139319084-139319106 GGAGGATTTGGCAGGGGCGAGGG + Intronic
963554695 3:146772625-146772647 GCAGGAGCCCACAGAGGCGGGGG - Intergenic
964556853 3:157949194-157949216 TCAGGATCCCCCAGGGGAGCTGG + Intergenic
964709689 3:159658520-159658542 GAAGGATCCAGCAGGGGCATTGG - Intronic
966734676 3:183179433-183179455 GCTGGCTCCTGCGGGGGCGACGG - Exonic
968461405 4:727027-727049 CCACGATCCCACAGGGGAGAGGG - Intronic
968702551 4:2063745-2063767 GCAGGAGCCTGCAGGGGATAGGG - Exonic
982709325 4:158744444-158744466 GCAGGACCCCTCTGGAGCGAGGG + Intergenic
983344020 4:166502957-166502979 GCAGATTGCCGCAGGGGTGAGGG + Intergenic
997169591 5:131702864-131702886 GAAGGAACCAGCAGAGGCGAAGG - Intronic
1002090581 5:176803176-176803198 GCATGAGGCCGCAGGGGAGATGG + Intergenic
1002261421 5:177996223-177996245 GCAGCATCCCGGTGGGGAGAAGG - Exonic
1005748783 6:28864332-28864354 GGAGGATTCCGCCCGGGCGATGG - Intergenic
1006302356 6:33200329-33200351 GCTGGATCCCGCAGCGGCGGCGG - Exonic
1006708769 6:36046993-36047015 GCTGGGTCCCACAGGGGCAATGG + Intronic
1015345632 6:132154688-132154710 GCAGGATCCGGCCGGGGGCAAGG + Intergenic
1015773496 6:136792092-136792114 GCAGAAGCCCGAGGGGGCGAAGG + Exonic
1017806247 6:157948077-157948099 GGAGGGTCCCGCAGGTGGGAAGG - Intergenic
1019490511 7:1311126-1311148 TCAGGAGGCCGCAGGGGCGAGGG - Intergenic
1020876790 7:13706083-13706105 GCAGGATGCTGCAGGGGCCTGGG - Intergenic
1033186509 7:139231635-139231657 GCAGGCTCCCGCGGGGCCGGCGG - Exonic
1035354280 7:158267620-158267642 CCAGGAGCTCTCAGGGGCGAGGG - Intronic
1035731124 8:1854146-1854168 CCAGGATCCCCCAGGGCCCAGGG + Intronic
1038885600 8:31659470-31659492 TGAGGCTCCCCCAGGGGCGAGGG + Intronic
1045367308 8:101488545-101488567 CCAGGATCCCGGAAGGGTGAGGG + Intergenic
1049190561 8:141285116-141285138 GCTGGATCCCGCTGGGCCGCTGG - Intronic
1049618315 8:143586182-143586204 GCAGGAGCCCGCAGGTCCGTGGG + Intronic
1050933785 9:11366878-11366900 GCAGGCTCCCACAGGGGCAGAGG - Intergenic
1055038881 9:71847339-71847361 GCATGATCCCACAGGGGAAAAGG + Intergenic
1060757273 9:126223000-126223022 GAAGGAACCCACAGGGGAGACGG - Intergenic
1060999854 9:127896959-127896981 GCAGGATCTCTCGGGGGCTAAGG + Intronic
1061089859 9:128420609-128420631 GCTGGACCCCGGAGGGGCGACGG - Exonic
1062282829 9:135759607-135759629 GCAGGATCTCTGAGGGGCCACGG + Intronic
1062432849 9:136533642-136533664 GCTGCCTCCCGCAGGGTCGAGGG + Intronic
1062594677 9:137293991-137294013 CCAGGATCCCGCCGAGGCAAAGG + Intergenic
1190983525 X:55480060-55480082 GAAGCATCCCGCACGGGAGAAGG - Intergenic
1190985174 X:55493123-55493145 GAAGCATCCCGCACGGGAGAAGG + Intergenic
1195702533 X:107716110-107716132 GCAGCTTCCTGCAGGGGCCAAGG - Intronic