ID: 925170485

View in Genome Browser
Species Human (GRCh38)
Location 2:1747311-1747333
Sequence GTGTGCGCAGGATCCCGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 2, 1: 1, 2: 2, 3: 2, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925170485_925170493 6 Left 925170485 2:1747311-1747333 CCCCTGCGGGATCCTGCGCACAC 0: 2
1: 1
2: 2
3: 2
4: 91
Right 925170493 2:1747340-1747362 GTGGGTTCAGATTAGACTCCGGG 0: 2
1: 0
2: 0
3: 8
4: 96
925170485_925170496 24 Left 925170485 2:1747311-1747333 CCCCTGCGGGATCCTGCGCACAC 0: 2
1: 1
2: 2
3: 2
4: 91
Right 925170496 2:1747358-1747380 CCGGGTGCCATCGCCCCTGCGGG No data
925170485_925170494 23 Left 925170485 2:1747311-1747333 CCCCTGCGGGATCCTGCGCACAC 0: 2
1: 1
2: 2
3: 2
4: 91
Right 925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG No data
925170485_925170492 5 Left 925170485 2:1747311-1747333 CCCCTGCGGGATCCTGCGCACAC 0: 2
1: 1
2: 2
3: 2
4: 91
Right 925170492 2:1747339-1747361 AGTGGGTTCAGATTAGACTCCGG 0: 2
1: 0
2: 1
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925170485 Original CRISPR GTGTGCGCAGGATCCCGCAG GGG (reversed) Intergenic
900998767 1:6136949-6136971 GTGTGCACAGGAACCCACAAAGG + Intronic
901278351 1:8010761-8010783 GTTTTCGCAGGATCCAGCATGGG + Intronic
901934272 1:12617068-12617090 CCGGGCGCGGGATCCCGCAGCGG + Intronic
904312646 1:29639313-29639335 GTGTGAGCAGGAGCCAGAAGAGG + Intergenic
905803644 1:40861433-40861455 GTGTGCGCAGGGCCCGGCACCGG - Exonic
914201236 1:145487362-145487384 GTGGGCACAGGCTCCCTCAGTGG - Intergenic
914480353 1:148060494-148060516 GTGGGCACAGGCTCCCTCAGTGG - Intergenic
919785451 1:201255272-201255294 CTGTCCCCAGGGTCCCGCAGGGG - Intergenic
920067408 1:203278587-203278609 GTGTGAGCAAGATGCCGCGGGGG + Intergenic
1063787932 10:9407206-9407228 CTGTGTGTAGGATCCCGCTGGGG - Intergenic
1063787938 10:9407233-9407255 CTGTGTGTAGGATCCCGCTGGGG - Intergenic
1063787944 10:9407260-9407282 CTGTGTGTAGGATCCCGCTGGGG - Intergenic
1063787950 10:9407287-9407309 CTGTGTGTAGGATCCCGCTGGGG - Intergenic
1063787956 10:9407314-9407336 CTGTGTGTAGGATCCCGCTGAGG - Intergenic
1063787967 10:9407368-9407390 CTGTGTGTAGGATCCCGCTGAGG - Intergenic
1063787971 10:9407395-9407417 CTGTGTGTAGGATCCCGCTGAGG - Intergenic
1063787975 10:9407422-9407444 CTGTGTGTAGGATCCCGCTGGGG - Intergenic
1063787991 10:9407503-9407525 CTGTGTGTAGGATCCCGCTGAGG - Intergenic
1067434878 10:46269881-46269903 GTGGGCCCAGCAGCCCGCAGGGG - Intergenic
1067806732 10:49397892-49397914 GTGTGTGCGGGAACCCTCAGCGG + Intergenic
1069558438 10:69413125-69413147 GTGTGCGCATGTTCCTGAAGAGG + Intronic
1069869814 10:71526299-71526321 GTGAGCGCTGGATGCTGCAGTGG - Intronic
1074185727 10:111098215-111098237 GTGTGGGCAGGAGGCTGCAGGGG - Intergenic
1077603272 11:3588965-3588987 GGCTGCGCAGGAGCCCACAGAGG - Intergenic
1083772963 11:64878610-64878632 GGGTGCGCAGCATTCGGCAGAGG - Exonic
1084831765 11:71774980-71775002 GGCTGCGCAGGATCCCACGGCGG - Intergenic
1085399295 11:76225982-76226004 GGGTGTGCAGGATGCAGCAGTGG - Intergenic
1089062075 11:115633967-115633989 GTCTGCACAGGAGCCCACAGAGG + Intergenic
1091395936 12:154319-154341 GTGGGGGCAGGCTGCCGCAGAGG - Intronic
1096607598 12:52777749-52777771 GTGTCCACAGGCTCCCACAGTGG + Intergenic
1113744281 13:112732017-112732039 GTATGCACAGGATGCCGCTGCGG - Intronic
1114680804 14:24482214-24482236 GAGAGGGCAGGATCCCGAAGGGG + Intergenic
1122514572 14:102297974-102297996 GGCTGCGCAGGAGCCCACAGCGG - Intronic
1122779466 14:104137641-104137663 GTGTGCGCAGCGGCCGGCAGGGG + Intergenic
1123142577 14:106095155-106095177 GAGTGCTCAGAATCCAGCAGGGG - Intergenic
1127293724 15:57592025-57592047 TGGAGCGCAGCATCCCGCAGCGG - Exonic
1128104138 15:65030571-65030593 GTGTGCAAAGGAACCCACAGGGG - Intergenic
1129600855 15:76997166-76997188 GTGTGGGCAGGATGCCGCTCAGG - Intronic
1131385773 15:92005695-92005717 GTGTGCTCTGCATCCCTCAGCGG - Intronic
1132525395 16:411695-411717 GTGTGGGCAGGCTGGCGCAGGGG - Intronic
1142813427 17:2407344-2407366 GAGTCCGCTGGATCACGCAGGGG + Intronic
1148241254 17:46000713-46000735 GGGTGCACAGGAGGCCGCAGTGG - Intronic
1151385144 17:73750670-73750692 GAGTGGGCAGCATCCCCCAGAGG - Intergenic
1152282307 17:79392084-79392106 GTTTGCCCAAGGTCCCGCAGCGG - Intronic
1152409096 17:80112960-80112982 GTGTGCGCTGGACCCAGCTGGGG + Intergenic
1154259725 18:12820009-12820031 TTGTGCGCAGGACCCCGTAGGGG - Intronic
1158017149 18:52797677-52797699 GTGTGTGCAGGCACCAGCAGTGG + Intronic
1161055775 19:2190081-2190103 GTGTCCGCAGGTCCCAGCAGAGG + Intronic
1161724077 19:5918427-5918449 GTGTGCCCAGGAACCCCCACAGG + Intronic
1163666388 19:18605981-18606003 CCGTGCGCCGGGTCCCGCAGGGG + Intronic
1166014638 19:39970955-39970977 GCGTGCGCAGTATCACGCGGTGG - Intergenic
1166824260 19:45599402-45599424 GTGGGAGCAGGAGCCCACAGAGG - Intronic
925170485 2:1747311-1747333 GTGTGCGCAGGATCCCGCAGGGG - Intergenic
925170498 2:1747371-1747393 GTGTGCGCAGGATCCCGCAGGGG - Intergenic
925170521 2:1747490-1747512 GTGTGCACAGGATCCCGCAGGGG - Intergenic
925170533 2:1747550-1747572 GTGTGCACAGGATCCTGCAGGGG - Intergenic
926302913 2:11617255-11617277 GAGTAGTCAGGATCCCGCAGAGG + Intronic
940145788 2:150542761-150542783 GGGTGCGCCGGGTCCCCCAGCGG - Intergenic
943033779 2:182716107-182716129 GTGTGCGCGGGATCCGGCTCCGG - Intronic
944482830 2:200175024-200175046 CCGTGCGCAGGAGCCCACAGCGG - Intergenic
948629000 2:239289767-239289789 GTTTGGGCAGGATCAGGCAGCGG - Intronic
948787207 2:240358908-240358930 GTGTGGGGAGGGTCCCGGAGGGG - Intergenic
1176217519 20:63955443-63955465 GGCTGCGCTGGATGCCGCAGGGG - Intronic
1180109464 21:45641444-45641466 GAGGCCGCAGGCTCCCGCAGAGG + Intergenic
1181013548 22:20055824-20055846 ATGTGCGCAGTAGCCCGCTGCGG - Intronic
1181085687 22:20438334-20438356 GAGTGCGCAGGAGTGCGCAGGGG - Intronic
1183271034 22:36862739-36862761 GAGGGCGCAGGTTCGCGCAGCGG + Intronic
949894698 3:8760457-8760479 GTGTGGACAGGAGCCTGCAGAGG + Intronic
950399673 3:12760343-12760365 GTGTGGGGAAGATCTCGCAGGGG - Intronic
954395012 3:50288886-50288908 GAGTGCGCAGGACACTGCAGAGG + Exonic
954408276 3:50357626-50357648 GTGTCAGCAGGCTCCCTCAGTGG + Intronic
954442972 3:50531720-50531742 GTGTGCTCAAGGTCCCACAGCGG - Intergenic
969396387 4:6924405-6924427 GAGTGCACAGGGCCCCGCAGAGG - Intronic
969401137 4:6956467-6956489 GCGTGCGCAGGAGCCATCAGCGG - Intronic
972724313 4:41732848-41732870 GTGTGGGTAGGATCCCCAAGGGG - Intergenic
976087877 4:81424692-81424714 GTGTGCGTTGGATTCCCCAGTGG - Intergenic
977291569 4:95170289-95170311 GTGTTCGCAGGATCCAGCAGCGG + Exonic
978126843 4:105146203-105146225 GTGTGCGCGGGACCTCGAAGTGG + Intronic
980463546 4:133148150-133148172 GTGTTCGCAGATACCCGCAGCGG + Intergenic
985269343 4:188179246-188179268 GGCCGCGCAGGAGCCCGCAGCGG - Intergenic
997665528 5:135627047-135627069 GAGAGCCCAGGATCACGCAGAGG + Intergenic
998295727 5:140967276-140967298 GAGTGCGCAGGACCCCGACGTGG + Exonic
1006400213 6:33813291-33813313 GTGTGTGGAGGCTCCCACAGAGG + Intergenic
1006978326 6:38124403-38124425 GGCTGCGCAGGAGCCCACAGCGG + Intronic
1016409708 6:143769342-143769364 GTGTGCCCAGGAACCCGAGGGGG + Intronic
1016992270 6:149938472-149938494 GAGTGCCCAGGATCCAACAGGGG - Intergenic
1020006106 7:4784468-4784490 GTGTGCCCAGGATGCAGCAGAGG + Intronic
1023378025 7:39577685-39577707 GGCTGCGCAGGAGCCCACAGTGG - Intronic
1025017068 7:55448622-55448644 GGGTGTGGAGGATCCCGCGGAGG - Intronic
1033599297 7:142877310-142877332 CTGTCCCCAGGATCCTGCAGGGG + Intronic
1034265391 7:149778145-149778167 GTTTGGGAATGATCCCGCAGTGG + Intergenic
1035027527 7:155835830-155835852 GTGTGGGCAGGTTCTTGCAGTGG - Intergenic
1035519841 8:266944-266966 GTGTTAGGAGGATCCTGCAGTGG + Intergenic
1035747966 8:1974690-1974712 GTCTGGGCGGGATTCCGCAGGGG + Intronic
1048203899 8:132400540-132400562 GTGTGTGCAGGGACCCGCGGTGG - Intronic
1049409160 8:142464810-142464832 GGGTCTGCATGATCCCGCAGGGG - Exonic
1060785352 9:126448178-126448200 GTGCTCACAGGATCCAGCAGAGG - Intronic
1061488805 9:130934055-130934077 GTGGGCTCTGGATCCAGCAGAGG + Intronic