ID: 925170486

View in Genome Browser
Species Human (GRCh38)
Location 2:1747312-1747334
Sequence AGTGTGCGCAGGATCCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925170486_925170493 5 Left 925170486 2:1747312-1747334 CCCTGCGGGATCCTGCGCACACT 0: 1
1: 1
2: 1
3: 3
4: 57
Right 925170493 2:1747340-1747362 GTGGGTTCAGATTAGACTCCGGG 0: 2
1: 0
2: 0
3: 8
4: 96
925170486_925170496 23 Left 925170486 2:1747312-1747334 CCCTGCGGGATCCTGCGCACACT 0: 1
1: 1
2: 1
3: 3
4: 57
Right 925170496 2:1747358-1747380 CCGGGTGCCATCGCCCCTGCGGG No data
925170486_925170492 4 Left 925170486 2:1747312-1747334 CCCTGCGGGATCCTGCGCACACT 0: 1
1: 1
2: 1
3: 3
4: 57
Right 925170492 2:1747339-1747361 AGTGGGTTCAGATTAGACTCCGG 0: 2
1: 0
2: 1
3: 7
4: 107
925170486_925170494 22 Left 925170486 2:1747312-1747334 CCCTGCGGGATCCTGCGCACACT 0: 1
1: 1
2: 1
3: 3
4: 57
Right 925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925170486 Original CRISPR AGTGTGCGCAGGATCCCGCA GGG (reversed) Intergenic
901278350 1:8010760-8010782 TGTTTTCGCAGGATCCAGCATGG + Intronic
903765162 1:25729290-25729312 AGGATGAGCAGGAACCCGCAGGG - Intronic
904028307 1:27518729-27518751 AGTGTGCACAGCATCCCAGAAGG - Intergenic
908355241 1:63321527-63321549 AGTCTGCCCAGGTTCCCCCAAGG + Intergenic
916051487 1:161039631-161039653 AGTGTGTCCAGTATCCAGCATGG + Exonic
916513876 1:165497596-165497618 AGTGTGCCCAGGCACCGGCACGG - Intergenic
920067407 1:203278586-203278608 AGTGTGAGCAAGATGCCGCGGGG + Intergenic
1064397805 10:14995599-14995621 ATTGTTCGCATGATCCCGGAGGG + Intergenic
1074185728 10:111098216-111098238 AGTGTGGGCAGGAGGCTGCAGGG - Intergenic
1075444921 10:122506465-122506487 AGTGTTCACTGGCTCCCGCACGG + Intronic
1076668435 10:132105686-132105708 AGTGTGCCCAGGTTCCTGGAAGG + Intronic
1081897215 11:46596961-46596983 AGTGTGAGGAGATTCCCGCAAGG - Intergenic
1082105243 11:48214575-48214597 ACTCTGCGCAGGATCCTACATGG + Intergenic
1098189134 12:67929331-67929353 AGTCTGCTCAGGTTCCAGCAAGG + Intergenic
1118940544 14:70332405-70332427 TGTCTGCGCAGGATCCTCCAGGG + Intronic
1121331644 14:93053310-93053332 AGTGTGCACTGGAACCCCCAGGG - Intronic
1122205184 14:100144813-100144835 AGTGTGCCCAGCAGCCCCCAAGG + Exonic
1123137781 14:106045445-106045467 AAGGTGCTCAGGATGCCGCAGGG - Intergenic
1124232515 15:27957562-27957584 AGTCTGAGCAGGACCCCGCCCGG + Intronic
1125479925 15:40072873-40072895 ACTGTTCGGAGGATCCCGGAGGG + Intergenic
1135080045 16:19426419-19426441 AGTGTGCTCAGAATCCTGCCAGG - Intronic
1139105601 16:63823343-63823365 AGTGTTGGCAGGCACCCGCAAGG - Intergenic
1139650682 16:68360646-68360668 AGTGTGGGCCGGCTCCTGCAGGG - Exonic
1141489224 16:84360701-84360723 AGGATGCGCAGGAGCCGGCAGGG + Intergenic
1141810183 16:86370942-86370964 ATTGTGCGCTGGGTCCTGCAGGG + Intergenic
1142813426 17:2407343-2407365 AGAGTCCGCTGGATCACGCAGGG + Intronic
1147219340 17:38919387-38919409 AGTGTGCGAAGGAACGCGCGGGG - Exonic
1154259726 18:12820010-12820032 ATTGTGCGCAGGACCCCGTAGGG - Intronic
1160619421 18:80160345-80160367 AGCGTGCGCGTGACCCCGCACGG - Exonic
1164522667 19:28990885-28990907 AGTGTGCACAGGGTCCTGCCTGG - Intergenic
925170486 2:1747312-1747334 AGTGTGCGCAGGATCCCGCAGGG - Intergenic
925170499 2:1747372-1747394 TGTGTGCGCAGGATCCCGCAGGG - Intergenic
925170522 2:1747491-1747513 TGTGTGCACAGGATCCCGCAGGG - Intergenic
925170534 2:1747551-1747573 TGTGTGCACAGGATCCTGCAGGG - Intergenic
925170540 2:1747595-1747617 TGTGTGCACAGGATCCTGCGGGG - Intergenic
925170549 2:1747639-1747661 TGTGTGCACAGGATCCTGCGGGG - Intergenic
928058520 2:28084324-28084346 AGTGTGCATAGGATACCTCAGGG + Intronic
931924336 2:67054829-67054851 AGTGTGCCCAGGAGTCAGCATGG - Intergenic
932781052 2:74558722-74558744 AGTGGGAGAAGGATCCCTCAAGG - Exonic
940173059 2:150849638-150849660 AGTGAGTGCAGGATCCGGCCAGG + Intergenic
948932677 2:241142084-241142106 AGAGTGCCCAGGATACTGCAGGG - Intronic
1168763230 20:363853-363875 AGTGTGCCCAGGTACACGCAAGG + Intronic
1170594063 20:17792389-17792411 CGTGTTCTCAGGATCCCGGAAGG - Intergenic
1176189842 20:63803178-63803200 AGTGTGGGCACCATCCCCCAGGG + Intronic
1177994274 21:28076448-28076470 AGTTTGCCCTGGATCCCGAATGG + Intergenic
1181401289 22:22651500-22651522 ACTCTGCCCTGGATCCCGCAAGG - Intergenic
1184474760 22:44714459-44714481 GGTGTGAGCAGGGTCCTGCAGGG + Intronic
955492680 3:59498964-59498986 ATTGTGGCCTGGATCCCGCATGG + Intergenic
961469210 3:127100902-127100924 AGTGAGCGCAGGGCCACGCATGG + Intergenic
961605950 3:128095478-128095500 AGTGTGTGCCAGATCCAGCATGG - Intronic
968949046 4:3680916-3680938 CTTGGGCGCAGGATCCCGCCGGG + Intergenic
970654776 4:18218942-18218964 AGTGTGTGCAGGATCTCCCATGG - Intergenic
972056379 4:34807683-34807705 AGTATTCACAGGATCCCACATGG - Intergenic
986918827 5:12660690-12660712 ACTGTGCTCATGATCCAGCAAGG - Intergenic
1001948110 5:175797061-175797083 AGGGTGCGGAGGAGCCCGCCCGG - Intronic
1016409707 6:143769341-143769363 AGTGTGCCCAGGAACCCGAGGGG + Intronic
1036432340 8:8702441-8702463 AGGTTGAGCAGGAGCCCGCAGGG - Exonic
1047430217 8:124784742-124784764 CCTGTGCTCAGGATTCCGCAAGG + Intergenic
1049039125 8:140099167-140099189 AGGCTGCGCAGGATCACGGAGGG - Intronic
1049156021 8:141067323-141067345 ACTGTGGCCAGGATCCTGCAAGG + Intergenic
1050294595 9:4192920-4192942 AGTGTGGACAGGATACTGCAAGG + Intronic
1057199727 9:93133743-93133765 AGTGCGCGGAGGAGCCGGCACGG + Intronic
1061850871 9:133414484-133414506 AGTGTGCGCATGATAAGGCAGGG - Intronic