ID: 925170487

View in Genome Browser
Species Human (GRCh38)
Location 2:1747313-1747335
Sequence GAGTGTGCGCAGGATCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925170487_925170493 4 Left 925170487 2:1747313-1747335 CCTGCGGGATCCTGCGCACACTC 0: 1
1: 0
2: 2
3: 12
4: 107
Right 925170493 2:1747340-1747362 GTGGGTTCAGATTAGACTCCGGG 0: 2
1: 0
2: 0
3: 8
4: 96
925170487_925170496 22 Left 925170487 2:1747313-1747335 CCTGCGGGATCCTGCGCACACTC 0: 1
1: 0
2: 2
3: 12
4: 107
Right 925170496 2:1747358-1747380 CCGGGTGCCATCGCCCCTGCGGG No data
925170487_925170492 3 Left 925170487 2:1747313-1747335 CCTGCGGGATCCTGCGCACACTC 0: 1
1: 0
2: 2
3: 12
4: 107
Right 925170492 2:1747339-1747361 AGTGGGTTCAGATTAGACTCCGG 0: 2
1: 0
2: 1
3: 7
4: 107
925170487_925170494 21 Left 925170487 2:1747313-1747335 CCTGCGGGATCCTGCGCACACTC 0: 1
1: 0
2: 2
3: 12
4: 107
Right 925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925170487 Original CRISPR GAGTGTGCGCAGGATCCCGC AGG (reversed) Intergenic
902471589 1:16650147-16650169 GAGTATGCGCAAGGTCGCGCTGG + Intergenic
920067406 1:203278585-203278607 GAGTGTGAGCAAGATGCCGCGGG + Intergenic
924587000 1:245368753-245368775 GAGTGTGTGGAGGATCTCACAGG + Intronic
924731032 1:246711710-246711732 GAGTGTGGGTAGGATCATGCTGG + Intergenic
1064096040 10:12425164-12425186 GAGGGTGCCCAGGAGCCAGCTGG - Intronic
1069158074 10:65053982-65054004 GAGCCTGCGCTGGAGCCCGCTGG - Intergenic
1069599763 10:69696294-69696316 TAGTGTGCGGAGCATCCGGCAGG + Intergenic
1074185729 10:111098217-111098239 GAGTGTGGGCAGGAGGCTGCAGG - Intergenic
1074503023 10:114043615-114043637 GTGCGTCCGCAGGAACCCGCGGG + Intergenic
1076700840 10:132271827-132271849 CAGTGTGCCCAGGAGGCCGCAGG - Intronic
1077555428 11:3223792-3223814 GAGGGTGCGCAGGACCCTGCTGG - Intergenic
1079128791 11:17735781-17735803 GAATGTGCGCGGGATCCCAGGGG - Exonic
1086578894 11:88373626-88373648 GAGTATGGGCAGGATCCAGGGGG + Intergenic
1101717239 12:107321337-107321359 GAGTGTGCGCAGGAACAAGCGGG + Intronic
1104307322 12:127621478-127621500 GAGTGAGCGCAGGGTCTGGCAGG + Intergenic
1107460568 13:40597896-40597918 GAATGTGCCCAGGAGCCGGCAGG + Intronic
1108508405 13:51133984-51134006 GAGCGTGCACAGGATGCTGCAGG - Intergenic
1112848408 13:103672727-103672749 GAGTGTGGGCAGGAAGCAGCAGG - Intergenic
1113994241 14:16053456-16053478 GAGTCGGGGGAGGATCCCGCCGG + Intergenic
1121331645 14:93053311-93053333 GAGTGTGCACTGGAACCCCCAGG - Intronic
1121629399 14:95411636-95411658 GAATTAGGGCAGGATCCCGCTGG + Intronic
1122476712 14:102015230-102015252 CAGGCTGCGCAGCATCCCGCTGG + Exonic
1123137782 14:106045446-106045468 GAAGGTGCTCAGGATGCCGCAGG - Intergenic
1125479924 15:40072872-40072894 GACTGTTCGGAGGATCCCGGAGG + Intergenic
1128683685 15:69668664-69668686 GAGGGTGGGCAGGAGCCAGCTGG - Intergenic
1131370822 15:91880242-91880264 GAGTGTGTACAGGATCACTCTGG - Intronic
1135640952 16:24119432-24119454 GAGTGTGTGCTGGGACCCGCAGG + Intronic
1136912789 16:34158829-34158851 GAGTCGGGGGAGGATCCCGCCGG + Intergenic
1141068625 16:80933721-80933743 GAGTGGGCCCATGATCCCACAGG + Intergenic
1141072890 16:80974077-80974099 GTGTGTGTGGAGGATCCAGCGGG - Exonic
1144606172 17:16667152-16667174 GAGGCTGCGCTGGACCCCGCTGG + Intergenic
1144904991 17:18634944-18634966 GAGGCTGCGCTGGAGCCCGCTGG - Intergenic
1145734633 17:27218990-27219012 GAGTGTGCTCAAGAACCTGCAGG - Intergenic
1146225333 17:31061235-31061257 TAGTGTGCTCAGGAACCTGCAGG + Intergenic
1147219341 17:38919388-38919410 CAGTGTGCGAAGGAACGCGCGGG - Exonic
1152409094 17:80112958-80112980 GTGTGTGCGCTGGACCCAGCTGG + Intergenic
1154259727 18:12820011-12820033 AATTGTGCGCAGGACCCCGTAGG - Intronic
1167702033 19:51054482-51054504 CAATGTGCGCAGGATTCCTCTGG - Intergenic
1202703988 1_KI270713v1_random:6942-6964 GAGTATGCGCAAGGTCGCGCTGG + Intergenic
925170487 2:1747313-1747335 GAGTGTGCGCAGGATCCCGCAGG - Intergenic
925170500 2:1747373-1747395 ATGTGTGCGCAGGATCCCGCAGG - Intergenic
925170523 2:1747492-1747514 GTGTGTGCACAGGATCCCGCAGG - Intergenic
925170535 2:1747552-1747574 GTGTGTGCACAGGATCCTGCAGG - Intergenic
925170541 2:1747596-1747618 GTGTGTGCACAGGATCCTGCGGG - Intergenic
925170550 2:1747640-1747662 GTGTGTGCACAGGATCCTGCGGG - Intergenic
926326078 2:11785902-11785924 GATTGTGTGCTGGGTCCCGCCGG + Intronic
934739314 2:96707693-96707715 GAGTGAGCACAGGGGCCCGCGGG - Exonic
938089484 2:128421956-128421978 AAGTGAGTGCAGGATCCAGCCGG + Intergenic
947227243 2:227852483-227852505 GAGTGAGTGTAGGATCCAGCCGG + Intergenic
948255368 2:236564320-236564342 GAGTGGGAGCAGGATCCATCAGG - Intergenic
948602585 2:239115832-239115854 GAGTGTTCCCAGGATCCGGCAGG - Intronic
948932678 2:241142085-241142107 GAGAGTGCCCAGGATACTGCAGG - Intronic
948952659 2:241264497-241264519 GAAAGTGCCCAGGAACCCGCTGG - Exonic
1169118298 20:3081339-3081361 GAGTTTGCGGAGGATCCCGAAGG + Intergenic
1171567479 20:26208634-26208656 GAGTAAGGGGAGGATCCCGCCGG - Intergenic
1171810881 20:29743602-29743624 GAGTCGGGGGAGGATCCCGCCGG - Intergenic
1171866318 20:30489195-30489217 GAGTCGGGGGAGGATCCCGCCGG - Intergenic
1174201325 20:48808566-48808588 CAGTTTTCGCAGGATCCCTCTGG - Intronic
1175393665 20:58643949-58643971 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393671 20:58643975-58643997 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393677 20:58644001-58644023 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393683 20:58644027-58644049 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393689 20:58644053-58644075 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393695 20:58644079-58644101 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393701 20:58644105-58644127 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393707 20:58644131-58644153 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175823397 20:61923953-61923975 GAGTGTGGCCAGGATCGGGCCGG - Intronic
1176407399 21:6428675-6428697 GAGTGTGAGCTGGAGCCCGGGGG + Intergenic
1176547343 21:8207635-8207657 GAGTCGGGGGAGGATCCCGCCGG + Intergenic
1176555248 21:8251844-8251866 GAGTCGGGGGAGGATCCCGCCGG + Intergenic
1176566294 21:8390682-8390704 GAGTCGGGGGAGGATCCCGCCGG + Intergenic
1176574168 21:8434868-8434890 GAGTCGGGGGAGGATCCCGCCGG + Intergenic
1177043830 21:16145702-16145724 GACTGTGTGCAGGGTCCTGCTGG + Intergenic
1179187622 21:39096977-39096999 GAGGGTGCACAGGAGCCCGTGGG + Intergenic
1179981265 21:44897129-44897151 GAGTGGGAGCAGGACCCTGCGGG - Intronic
1180313028 22:11254059-11254081 GAGTCGGGGGAGGATCCCGCCGG - Intergenic
1182715371 22:32353439-32353461 GATTGTGCTCAGGATCCCCGCGG + Intergenic
1184037787 22:41926651-41926673 CGGCGTGCGCAGGAGCCCGCAGG + Exonic
1184474759 22:44714458-44714480 GGGTGTGAGCAGGGTCCTGCAGG + Intronic
1185129767 22:49032334-49032356 GAGGGTGCGTAGGAGCCCCCTGG + Intergenic
1185237086 22:49720438-49720460 GCCTGTGCCCAGGGTCCCGCAGG + Intergenic
1185258144 22:49848151-49848173 GACAGTGAGCAGGAGCCCGCCGG - Intergenic
1203252216 22_KI270733v1_random:123920-123942 GAGTCGGGGGAGGATCCCGCCGG + Intergenic
1203260271 22_KI270733v1_random:169005-169027 GAGTCGGGGGAGGATCCCGCCGG + Intergenic
950098346 3:10343040-10343062 TAGTGTCCGCAGGCTCCTGCTGG + Intronic
954297833 3:49684094-49684116 GAGTATGCGCAAGGTCCCGCTGG - Exonic
959220720 3:103515309-103515331 GGGTATGCGCAGGGTCCCTCTGG - Intergenic
959693470 3:109224318-109224340 GAGTGAGTGCAGGATCTGGCCGG + Intergenic
962119798 3:132549466-132549488 GAGTGAGTGCAGGACCCAGCTGG - Intergenic
966872729 3:184301904-184301926 GAGTGAGCAGAGGCTCCCGCTGG - Exonic
968949045 4:3680915-3680937 CCTTGGGCGCAGGATCCCGCCGG + Intergenic
985793779 5:1947119-1947141 GAGTGTGCCCAGGAGCCACCGGG - Intergenic
1006409646 6:33865197-33865219 GAGTGAGTGCAGGATCCAGCCGG - Intergenic
1011237743 6:85236379-85236401 GAGTATGTGGAGGATCCTGCAGG - Intergenic
1013216445 6:108032091-108032113 GAGTGAGTGCAGGATCCAGCCGG + Intergenic
1013216478 6:108032261-108032283 GAGTGAGTGCAGGATCTGGCTGG + Intergenic
1013463882 6:110400323-110400345 GAGGGTGCGCAGGAGCGGGCCGG + Intronic
1016409706 6:143769340-143769362 CAGTGTGCCCAGGAACCCGAGGG + Intronic
1019139720 6:169935797-169935819 GAGGGTGCGCAGTATTCCTCAGG + Intergenic
1026458587 7:70594280-70594302 GAGTGTGTGCAGAATCCCCTGGG + Intronic
1033406384 7:141074074-141074096 GAGGATGCCCAGGAGCCCGCGGG + Intergenic
1034383912 7:150722263-150722285 GAGTGTGCGCAGGCGCCCTAGGG + Exonic
1035015698 7:155763944-155763966 GAGTGTGCGTGGGGCCCCGCTGG - Exonic
1037056328 8:14445871-14445893 TAGTGAGTGCAGGATCCAGCTGG - Intronic
1039587303 8:38718106-38718128 AAGTGTGCATAGGATCCCACAGG + Intergenic
1042861023 8:73314528-73314550 GCCTGTGCTCAGGTTCCCGCTGG - Intronic
1046438778 8:114231021-114231043 GAGTGGGTGCAGGAACCGGCTGG - Intergenic
1058317540 9:103586966-103586988 AAGTGAGTGCAGGATCCAGCTGG - Intergenic
1061182443 9:129032738-129032760 GAGCAAGTGCAGGATCCCGCTGG - Intergenic
1061850872 9:133414485-133414507 GAGTGTGCGCATGATAAGGCAGG - Intronic
1203468619 Un_GL000220v1:107070-107092 GAGTCGGGGGAGGATCCCGCCGG + Intergenic
1203476440 Un_GL000220v1:151042-151064 GAGTCGGGGGAGGATCCCGCCGG + Intergenic
1186466036 X:9785703-9785725 GAGTGCGCGCAGGGCCGCGCGGG + Intronic
1190268070 X:48840915-48840937 AAGTGTGCGCAGGGTGCGGCTGG - Intergenic
1190629192 X:52368671-52368693 GAGTGTGAGGAGGAGCCTGCGGG + Intergenic
1190630430 X:52380755-52380777 GAGTGTGAGGAGGAGCCCGCGGG + Intergenic
1190634372 X:52419804-52419826 GAGTGTGAGGAGGAGCCCGTGGG + Intergenic
1190650448 X:52563631-52563653 GAGTGTGAGAAGGAGCCTGCGGG - Intergenic
1190679323 X:52811419-52811441 GAGAGTGCGGAGGAGCCAGCGGG + Intergenic
1193485394 X:82080317-82080339 GTGTGAGTGCAGGATCCGGCTGG + Intergenic
1195355935 X:104040092-104040114 GAGGGTGCCGAGGCTCCCGCAGG + Exonic
1198022865 X:132676285-132676307 GAGTGTGACAAGGTTCCCGCCGG + Intronic