ID: 925170490

View in Genome Browser
Species Human (GRCh38)
Location 2:1747323-1747345
Sequence ACCCACTGGAGAGTGTGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925170490_925170494 11 Left 925170490 2:1747323-1747345 CCTGCGCACACTCTCCAGTGGGT 0: 1
1: 0
2: 1
3: 14
4: 118
Right 925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG No data
925170490_925170496 12 Left 925170490 2:1747323-1747345 CCTGCGCACACTCTCCAGTGGGT 0: 1
1: 0
2: 1
3: 14
4: 118
Right 925170496 2:1747358-1747380 CCGGGTGCCATCGCCCCTGCGGG No data
925170490_925170492 -7 Left 925170490 2:1747323-1747345 CCTGCGCACACTCTCCAGTGGGT 0: 1
1: 0
2: 1
3: 14
4: 118
Right 925170492 2:1747339-1747361 AGTGGGTTCAGATTAGACTCCGG 0: 2
1: 0
2: 1
3: 7
4: 107
925170490_925170493 -6 Left 925170490 2:1747323-1747345 CCTGCGCACACTCTCCAGTGGGT 0: 1
1: 0
2: 1
3: 14
4: 118
Right 925170493 2:1747340-1747362 GTGGGTTCAGATTAGACTCCGGG 0: 2
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925170490 Original CRISPR ACCCACTGGAGAGTGTGCGC AGG (reversed) Intergenic
900601647 1:3505331-3505353 ACGCCCTGCAGAGTGTGAGCTGG - Exonic
901139857 1:7021564-7021586 AACCACTGGACAGTGAGCACGGG + Intronic
901788214 1:11638533-11638555 ACCAAGTGGAGTGTGTGTGCTGG - Intergenic
902195744 1:14796676-14796698 ACCCAATGGAGAGTCTTCCCTGG - Intronic
905027320 1:34859684-34859706 CCGCACTGGGGAGTGTGGGCTGG - Exonic
905569020 1:38989610-38989632 AGCCACTGGAGAGTTTGAGGTGG - Intergenic
906265321 1:44424574-44424596 ACCCACTGAGGAGTCTGGGCAGG + Intronic
915699456 1:157777117-157777139 ACCAACTGGAGACTCTGAGCAGG + Exonic
917350611 1:174073505-174073527 ACCCACTGGAGAGTGAAAGAGGG - Intergenic
917972328 1:180216906-180216928 AGCCACTGGAGAGGGTCCCCAGG + Intergenic
924841922 1:247720630-247720652 AGCCTCTGGACAGTGTGTGCAGG - Intergenic
1063420237 10:5906625-5906647 ACCCGCTGGTGAGTGAGTGCTGG + Exonic
1064759786 10:18606220-18606242 ACCCCCTGGAGATTGTGAGTAGG - Intronic
1067772639 10:49138432-49138454 ACCCACTGGAGAGTGGCAGGGGG - Intergenic
1069909427 10:71750499-71750521 ACCCACTGGAGATGGTGCTGAGG - Exonic
1070663620 10:78328215-78328237 AGCTACTAGAGAGTGTGTGCTGG + Intergenic
1070833174 10:79432489-79432511 ACCCACAGGAGCCTGTCCGCAGG + Intronic
1071915073 10:90285508-90285530 AACCACTGGAGAGTGTTCAATGG + Intergenic
1074721076 10:116265791-116265813 ACACACAGGAGAAAGTGCGCCGG - Intronic
1075722188 10:124593641-124593663 ACCCTCTGGATAGAGTGCCCTGG - Intronic
1076250460 10:128980332-128980354 CCTCACTGCAGAGTGTGGGCGGG - Intergenic
1077330854 11:1983278-1983300 ACCCCTTGGAGAGTGGGGGCAGG + Intronic
1083169824 11:60916769-60916791 AGCCACTGGAGAGTTGGGGCTGG + Intronic
1087082602 11:94186425-94186447 TCCCACTTAAGAGTGTGGGCAGG - Intergenic
1089212413 11:116814402-116814424 ACCCATAGGAGAGCGTGTGCTGG - Intergenic
1089669153 11:120040415-120040437 CCCCAATGGAGAGTGTGTGCAGG - Intergenic
1202813834 11_KI270721v1_random:38457-38479 ACCCCTTGGAGAGTGGGGGCAGG + Intergenic
1091555814 12:1572724-1572746 GCCCACTGGAGATTGTGACCGGG + Intronic
1096809277 12:54159349-54159371 ACCAACAGGAGAGTGTGGGGAGG + Intergenic
1100854434 12:98746220-98746242 AACCACTGGAGAGTGAGAGCCGG - Intronic
1104505285 12:129326143-129326165 ACCCCATGGAGAGTGTCCACGGG - Intronic
1105477387 13:20740141-20740163 AGCAACTGCAGAGGGTGCGCCGG - Intronic
1109677381 13:65695514-65695536 ACACACTGCAGAGTGTGCATGGG + Intergenic
1111189239 13:84787727-84787749 AACCACTGGCAAGTATGCGCAGG - Intergenic
1113856034 13:113445958-113445980 AACCCCTGGAGAGAGTGCACAGG + Intronic
1114725034 14:24927262-24927284 ACCCTCTGGAGAGTGAGCCAGGG - Intronic
1119509380 14:75198940-75198962 CCCCACAGGAGTGTGTGTGCAGG + Intergenic
1121859839 14:97307192-97307214 ACCCACTAGAGAGAAAGCGCTGG + Intergenic
1123998794 15:25737533-25737555 ATGCCCTGGGGAGTGTGCGCAGG + Intronic
1125520571 15:40345860-40345882 ACTCCCTGGAGAGGGTGTGCTGG - Intergenic
1126735605 15:51729279-51729301 AGCCACTGGAGAGTGAAGGCAGG + Intronic
1127374765 15:58374380-58374402 ACCCACTGGACTGTGAGGGCTGG - Intronic
1129305790 15:74660691-74660713 ACCCACTGAAGAGTGACCACTGG - Intronic
1130935247 15:88464697-88464719 ACCCACCTGAGAGTGTGGCCAGG + Exonic
1131250712 15:90828304-90828326 GCCCAGTGGTGAGTGTGGGCCGG - Intergenic
1132095652 15:98982572-98982594 ACCCACTGAAGCGGGTGCCCAGG + Intronic
1133857683 16:9564957-9564979 AGCCACTGGAGAGTTTGAGTGGG - Intergenic
1135507710 16:23053102-23053124 AGACACTGGAGAGTGAGTGCTGG - Intergenic
1136068586 16:27774972-27774994 ACTCCCTGGAGGGTGTGGGCGGG + Exonic
1138441489 16:57037583-57037605 TCCCACTGGAGAGTTTGGGCTGG - Intronic
1139249259 16:65479176-65479198 AGCCACTGAAGAGTTTGAGCAGG + Intergenic
1140306584 16:73808525-73808547 ACACACTGGACAGTGTGCCTGGG - Intergenic
1142494167 17:297524-297546 GCCCACTGGAGAATGTGCTGCGG + Intronic
1143252288 17:5532706-5532728 ACCCAGTGGTGAGTGTGAGTTGG + Intronic
1144945718 17:18968562-18968584 ACCCACTGGGGGGTGGGGGCAGG + Intronic
1149521137 17:57319027-57319049 GCCCACTGGAAAGTGTGTGTGGG + Intronic
1152314832 17:79574018-79574040 GCCCACTGGAGAAGGTGGGCTGG + Intergenic
1152979970 18:267745-267767 ACCCGCTGGAGGGTGGGCGGAGG + Intronic
1154313783 18:13287502-13287524 TCCCTCTGGAGAGTGGGTGCAGG + Intronic
1155115939 18:22767045-22767067 ACCCACTGGAGGGTGAGGGTAGG + Intergenic
1160288957 18:77572568-77572590 ACCCACAGGAAAGGGAGCGCTGG - Intergenic
1165319574 19:35076916-35076938 GCCATCTGGAGAGTGTGTGCGGG - Intergenic
1165658107 19:37550963-37550985 CCCCAGTGGAGGGTGTGAGCAGG - Intergenic
925170490 2:1747323-1747345 ACCCACTGGAGAGTGTGCGCAGG - Intergenic
925170503 2:1747383-1747405 ACCCACTCGAATGTGTGCGCAGG - Intergenic
925170526 2:1747502-1747524 ACCCACTGGAGTGTGTGCACAGG - Intergenic
925170536 2:1747562-1747584 ACTCACTGGAGTGTGTGCACAGG - Intergenic
925170545 2:1747606-1747628 ACCCACTGGCGTGTGTGCACAGG - Intergenic
925170554 2:1747650-1747672 ACCCACTGGTGTGTGTGCACAGG - Intergenic
925494828 2:4435314-4435336 CCCCACTGGAGATTCTGTGCGGG + Intergenic
925534701 2:4903783-4903805 AACCACTGGGGAGTGTGGCCCGG + Intergenic
932261831 2:70333359-70333381 AGCCTCTGGAGTGTGTGGGCAGG + Intergenic
948915900 2:241034991-241035013 ACCCACAGCAGTGTGTGTGCGGG - Intronic
1173362189 20:42354874-42354896 GCCCAGAGCAGAGTGTGCGCAGG + Intronic
1174456930 20:50655378-50655400 ACCCACTGGGCAGTGTGCCCTGG - Intronic
1179063662 21:38004072-38004094 ACCCACTGGGGAGTTGGCACTGG + Intronic
1179437984 21:41375118-41375140 GCCCACTGGAGGGTGTGCCTGGG - Intronic
1179995734 21:44973317-44973339 AACCCCTGGAGAGGGTGGGCAGG - Intronic
1179995747 21:44973360-44973382 AACCCCTGGAGAGGGTGGGCGGG - Intronic
1179995761 21:44973403-44973425 AACCCCTGGAGAGGGTGGGCGGG - Intronic
1179995775 21:44973446-44973468 AACCCCTGGAGAGGGTGGGCGGG - Intronic
1179995802 21:44973532-44973554 AACCCCTGGAGAGGGTGGGCGGG - Intronic
1179995829 21:44973618-44973640 AACCCCTGGAGAGGGTGGGCGGG - Intronic
1179995843 21:44973661-44973683 AACCCCTGGAGAGGGTGGGCGGG - Intronic
1182637148 22:31737143-31737165 ACCCTGTGGAGAGAGTCCGCTGG + Intronic
1182864597 22:33592539-33592561 ACACACTGGAGAGTATGAGTTGG - Intronic
1183368035 22:37417519-37417541 GCCCACTGGGGAGGGTGGGCAGG - Intronic
1183616671 22:38950075-38950097 ACCCACTAGAGAGGGAGCCCAGG + Intergenic
952707968 3:36399266-36399288 ACCCACTGTAGAGGGTGCTGTGG - Intronic
954441254 3:50523464-50523486 GACCACTGGAGAGTGGGCTCAGG - Intergenic
954958904 3:54547506-54547528 ACCCACGGGAGAGTGTAAGCAGG - Intronic
955079743 3:55647893-55647915 GCCCTGTGGAGAGTGTGCGTTGG + Intronic
955627467 3:60933898-60933920 CACCACTGGAGAGTGGGAGCTGG - Intronic
960560040 3:119073615-119073637 AGCAACTGCAGAGCGTGCGCCGG - Intronic
963252903 3:143119259-143119281 ACCCACTAGAGAGGGCGGGCAGG + Intergenic
974548913 4:63348253-63348275 ACCCTCTGTAGAATCTGCGCAGG - Intergenic
981998240 4:150998464-150998486 ACCCACTGGAGATGGTGAGGTGG - Intronic
985574684 5:668516-668538 GCCCCCTGGAGAGTGTGCAGGGG - Intronic
991112286 5:62914532-62914554 ACTCACTGGAGATTGTGCACTGG + Intergenic
992626653 5:78642118-78642140 ACACACTGGAGAGTGAGCTCTGG + Intronic
993083764 5:83337506-83337528 GCCCACTGGAGAGCGTACACTGG - Intronic
994536459 5:101036876-101036898 ACCACCTTGAGAGTGAGCGCTGG + Intergenic
1002323225 5:178388036-178388058 ACACCGTGGAGAGCGTGCGCTGG - Intronic
1003532819 6:6952255-6952277 ACCCAGTTGAGAGTGTGGGAGGG - Intergenic
1004892807 6:20117659-20117681 GTCCACTGGAGAGTTTGGGCAGG - Intronic
1008577938 6:52879337-52879359 CCCCACTGGACAGTGTGTGCAGG + Intronic
1008815186 6:55556590-55556612 AGCCACTAGAGAGTGGGCTCGGG + Intronic
1010159839 6:72840462-72840484 AGCCACTGGAGAGTGAGCTGGGG - Intronic
1012446948 6:99316329-99316351 ACCCTCTGGGGAGTGTGCCTTGG - Intronic
1014845270 6:126268228-126268250 CCCCTGTGGAGAGTGTGCACTGG - Intergenic
1019067947 6:169318289-169318311 GGCCACTGCAGAGTGTGAGCTGG - Intergenic
1019937612 7:4266776-4266798 GCCCACTGGCGTGTGTGCCCCGG + Exonic
1023968439 7:44975475-44975497 ACCTACTGGAGAAGGTGGGCAGG - Exonic
1024845476 7:53636851-53636873 ACCCACTGGAGACTCTGTGTGGG - Intergenic
1032552440 7:132797052-132797074 ACCCTCTGGAAGGTGTGTGCAGG - Intronic
1036663149 8:10721344-10721366 ACCCGCGGGAGAGAGTGCACAGG + Intergenic
1040586280 8:48745440-48745462 ACCCCTTGGAGACTGTGCCCAGG - Intergenic
1040755581 8:50770505-50770527 ACCCACTGAAGGGTGTGGGCTGG + Intronic
1041559045 8:59193555-59193577 ACCCAGTGTAGAGTGAGTGCTGG - Intergenic
1050021156 9:1285797-1285819 ACCAACTGGAGAGTGTGCAATGG - Intergenic
1051937836 9:22466041-22466063 AGCCACTGGACAGTCTGAGCAGG + Intergenic
1053282251 9:36828095-36828117 AGCCACTGGAGAGTGTTCATGGG - Intergenic
1056457150 9:86771664-86771686 ACCCTGTGGAGAGTCTGCTCTGG - Intergenic
1057110017 9:92460418-92460440 ACCTCCTGGAGAATGTGCACAGG - Intronic
1058523569 9:105835768-105835790 AACCACGGGAGAGTTTGGGCAGG + Intergenic
1059727217 9:117020924-117020946 CGCCACTGGAGAGTGTGGGGAGG - Intronic
1061746518 9:132744131-132744153 GCACACTGGAGGGTGTGAGCCGG - Intronic
1062535661 9:137020113-137020135 AGGCACTGGAGAGTCTGCTCTGG - Intronic
1186473269 X:9837580-9837602 GCTCACAGGAGAGTGGGCGCTGG + Intronic
1193584398 X:83302983-83303005 AACTACTGGAGAATGTGCACAGG + Intergenic
1197774832 X:130111868-130111890 AGGCTCTGGAGAGAGTGCGCTGG + Intergenic
1197833687 X:130672399-130672421 GCCCACTGGATGGTGTGCGGGGG - Intronic
1199003053 X:142663115-142663137 TCCCAGTGGAGAGTGTGTGGGGG - Intergenic
1201901110 Y:19046780-19046802 AGCAACTGCGGAGTGTGCGCCGG - Intergenic