ID: 925170491

View in Genome Browser
Species Human (GRCh38)
Location 2:1747337-1747359
Sequence GGAGTCTAATCTGAACCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925170491_925170501 21 Left 925170491 2:1747337-1747359 CCAGTGGGTTCAGATTAGACTCC 0: 2
1: 0
2: 0
3: 8
4: 93
Right 925170501 2:1747381-1747403 ATCCTGCGCACACATTCGAGTGG No data
925170491_925170496 -2 Left 925170491 2:1747337-1747359 CCAGTGGGTTCAGATTAGACTCC 0: 2
1: 0
2: 0
3: 8
4: 93
Right 925170496 2:1747358-1747380 CCGGGTGCCATCGCCCCTGCGGG No data
925170491_925170494 -3 Left 925170491 2:1747337-1747359 CCAGTGGGTTCAGATTAGACTCC 0: 2
1: 0
2: 0
3: 8
4: 93
Right 925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG No data
925170491_925170502 22 Left 925170491 2:1747337-1747359 CCAGTGGGTTCAGATTAGACTCC 0: 2
1: 0
2: 0
3: 8
4: 93
Right 925170502 2:1747382-1747404 TCCTGCGCACACATTCGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925170491 Original CRISPR GGAGTCTAATCTGAACCCAC TGG (reversed) Intergenic
900471757 1:2858413-2858435 GGGGTTTAAACTGAACCCTCAGG - Intergenic
902179526 1:14677487-14677509 GGAGTCCACTCTTACCCCACAGG - Intronic
902841919 1:19080037-19080059 GGTGTGCAATCTGAACCCACAGG - Intronic
906362226 1:45172736-45172758 GTAGTCTTATCTGGACCTACAGG + Intronic
911659726 1:100487804-100487826 GGAGCCTAACCTAGACCCACAGG - Intronic
911909376 1:103613153-103613175 GGAGAATCATCTGAACCCAGAGG + Intergenic
912452121 1:109773644-109773666 AGAGTTTAATTTGAACCCAGGGG - Intronic
916208273 1:162336325-162336347 GGAGTCAGAACTGAACCCAGAGG + Intronic
918682166 1:187369256-187369278 GGAATCTGATCTGGTCCCACGGG - Intergenic
920539749 1:206769411-206769433 GGAGTCTGGGCTGAACCCCCAGG + Intronic
1063432312 10:6001093-6001115 GCAGTCTCATCTGAACCTGCAGG + Intergenic
1063432324 10:6001284-6001306 GCAGTCTCATCTGAACCTGCAGG + Intergenic
1065554734 10:26904058-26904080 GGAGTCAAAGCAGAATCCACTGG + Intergenic
1065595891 10:27311118-27311140 GGAGTCAAAGCAGAATCCACTGG - Intergenic
1065969874 10:30797823-30797845 GGAGGCTCATCTGCACCCATTGG - Intergenic
1066577819 10:36845850-36845872 GGAGTCAAAGCAGAATCCACTGG - Intergenic
1068351622 10:55854360-55854382 GGAGTCTAACATGGTCCCACGGG + Intergenic
1088608229 11:111551695-111551717 GTTGTCTAATCTGAAGCCAAAGG - Intronic
1090979417 11:131704236-131704258 GGACTCCATTCTGAATCCACAGG - Intronic
1097910260 12:64961847-64961869 GGAGAATCATCTGAACCCAGTGG - Intergenic
1101274265 12:103181580-103181602 GGAAGTTAATCTGAATCCACTGG + Intergenic
1102906195 12:116676956-116676978 GAAGTCAAATGTGAACCCAAAGG - Intergenic
1104757819 12:131279765-131279787 GGAGGCTGCTCTGACCCCACGGG + Intergenic
1109306928 13:60651224-60651246 GGAGTCTGTTCTGAAGCCAGTGG + Intergenic
1114227461 14:20752215-20752237 ACAGTCTAAACTGACCCCACTGG - Intergenic
1120807616 14:88769779-88769801 AGATTCTAATCCGAAACCACAGG + Intronic
1121823678 14:96992814-96992836 GCAGTGCAATCTGCACCCACAGG - Intergenic
1123427999 15:20188382-20188404 GGAGTCATATCTGAACTCAGTGG + Intergenic
1125270586 15:37934615-37934637 GGAGTCTAATCTTTCTCCACTGG - Intronic
1126278519 15:46914731-46914753 GGAGTCTCATCTGAAAGCCCAGG + Intergenic
1131562447 15:93456390-93456412 GGAGTCAAGTCTGAAAGCACAGG - Intergenic
1133881106 16:9783247-9783269 GGGGTCTCATGTGAAACCACGGG - Intronic
1141362124 16:83405560-83405582 GGAGTCTAAAATGAATCCAAAGG - Intronic
1155870860 18:31026361-31026383 GGAGTCTAATGGAAAACCACTGG + Intronic
1158209081 18:55026076-55026098 GAAGTCTTCTCTGAACTCACTGG - Intergenic
1160884661 19:1340151-1340173 GGATTCTAATCCCAACCCCCAGG + Intergenic
1163531102 19:17849289-17849311 GGAGCATAATCTGGAGCCACAGG + Intergenic
925170491 2:1747337-1747359 GGAGTCTAATCTGAACCCACTGG - Intergenic
925170527 2:1747516-1747538 GGAGTCTAATCTGAACCCACTGG - Intergenic
925295489 2:2773726-2773748 GGAGTTAATGCTGAACCCACGGG - Intergenic
925500647 2:4500628-4500650 GGAGATTAATCTGAAAACACAGG - Intergenic
933466717 2:82660411-82660433 TGAGTGTAATCTAAAACCACAGG + Intergenic
935670903 2:105556515-105556537 GGAAATTAATCTGAACCCAAGGG - Intergenic
938589082 2:132720034-132720056 GGAGTCTCACCTGGACCCAATGG - Intronic
940095861 2:149973532-149973554 GGAGTGTCATCAGAACCCACTGG - Intergenic
944484421 2:200189968-200189990 GGAGTATAAGGTGAAACCACAGG - Intergenic
944675177 2:202029455-202029477 GGAGTCAAATCTGTACTCAAAGG - Intergenic
945335581 2:208588868-208588890 GGAGTCTCATCTGAACCTCAGGG + Intronic
947468979 2:230382591-230382613 GGAGTGAAATCTGAATCCCCTGG + Intronic
1169976776 20:11338144-11338166 GGGGTCTCAGCTGACCCCACAGG + Intergenic
1171358473 20:24568500-24568522 GGAGTCAAGTCTGAACACACAGG + Intronic
1172100164 20:32480511-32480533 GGAGTCTCTTCTCAACCCACTGG + Intronic
1172997330 20:39080861-39080883 GGAGGCTCATCTGAACCCAGGGG - Intergenic
1173162482 20:40663141-40663163 GGAGTTTAACCTGAAAGCACTGG - Intergenic
951606335 3:24439010-24439032 GAAGTCTAGTCTGATCCCACAGG + Intronic
952273714 3:31857358-31857380 GGAGCCTAATCTGAACTGGCAGG + Intronic
952884918 3:38006373-38006395 GGAGGCTGCACTGAACCCACAGG - Intronic
953188016 3:40656144-40656166 GGAGTCAAATCTGGATCCAAAGG - Intergenic
964024164 3:152051673-152051695 GGAATGTAATCTGATCCCAGTGG + Intergenic
964661847 3:159128679-159128701 GGAGACTAATCTGGCCACACAGG - Intronic
967975647 3:195033119-195033141 GGGCTCTGATCTGTACCCACAGG + Intergenic
971229920 4:24793307-24793329 AGAGTGAAATCTGAACCCACTGG - Intronic
971328841 4:25665736-25665758 GGAGGCTCATTGGAACCCACTGG + Intronic
971585653 4:28402768-28402790 GGAGTCTTCTCTGACCCCTCTGG + Intronic
971620726 4:28851227-28851249 GGAGCCAAATGTGATCCCACAGG + Intergenic
973566498 4:52194050-52194072 GGGGTGTAATCTGATCCCAGAGG + Intergenic
974505424 4:62763955-62763977 GGAGTAAAATATGAAGCCACAGG + Intergenic
974680237 4:65151117-65151139 GGAGAATCATTTGAACCCACAGG - Intergenic
974849739 4:67390198-67390220 TGAGAGGAATCTGAACCCACAGG + Intergenic
976147152 4:82053154-82053176 ATGGTCTAATCTGCACCCACTGG + Intergenic
980466324 4:133188226-133188248 GTTGTCTAAACTGGACCCACTGG - Intronic
986564696 5:9100401-9100423 GGAGTCTTCTCTGAAGCCCCAGG + Intronic
987287725 5:16475310-16475332 TGACTTTAATCTGAACCCTCTGG + Intronic
988689380 5:33557164-33557186 GCAGCCTCACCTGAACCCACAGG - Intronic
995240976 5:109885104-109885126 GGACTGCAGTCTGAACCCACTGG - Intergenic
998158979 5:139802464-139802486 GGATTCAACTCTCAACCCACAGG + Intronic
998473329 5:142400471-142400493 GGAGACTAAAGTGAGCCCACAGG + Intergenic
1000220138 5:159207820-159207842 GGAGTCTACTCTGAATACAAAGG + Intronic
1003946144 6:11077844-11077866 GGACTCTTGGCTGAACCCACAGG + Intergenic
1006165292 6:32061295-32061317 GGAGACAAGTCTGGACCCACAGG + Intronic
1007600007 6:43075788-43075810 GTAGACCAATCTGAACCCAAAGG - Intergenic
1010689830 6:78896732-78896754 GGAGGATCATCTGAACCCAGGGG + Intronic
1013771711 6:113635055-113635077 AGAGTCTAATGTAACCCCACTGG - Intergenic
1016089969 6:139964938-139964960 GGAGTCTAATCTGAAAACTAAGG - Intergenic
1018145573 6:160884195-160884217 GGAGTTTAATCTCAACCAGCAGG + Intergenic
1019907161 7:4073618-4073640 GGGGTCTACTCTGAACCTATGGG - Intronic
1025768749 7:64483513-64483535 GGAGAATAACTTGAACCCACAGG + Intergenic
1026643653 7:72149375-72149397 GGAGTATCATTTGAACCCAGAGG + Intronic
1027054673 7:75041771-75041793 GGAGAATAATTTGAACCCAGGGG + Intronic
1028405852 7:90473036-90473058 AGAGTTTACTCTGAATCCACTGG + Intronic
1037300316 8:17444453-17444475 GGACTCTAATCTAGAGCCACAGG + Intergenic
1037452651 8:19032089-19032111 GGATGCTAATCTGAAACCAATGG + Intronic
1043351449 8:79365741-79365763 GGATTCTAATGTGAAACCATTGG + Intergenic
1043694382 8:83201589-83201611 GGAGTAGACTCTGACCCCACTGG - Intergenic
1044112604 8:88294801-88294823 GGAGACTAACATGAACCCAGAGG - Intronic
1058089366 9:100786979-100787001 AGATTCTAATCTGAACCTACTGG - Intergenic
1187218252 X:17298147-17298169 GGAGAATCATTTGAACCCACAGG + Intergenic
1189674730 X:43450295-43450317 GGAGTTTATTCTGAAGCCAGTGG + Intergenic
1194456280 X:94107720-94107742 GCAGTCTAATTTGAACCTCCTGG + Intergenic
1195624434 X:106992936-106992958 GGAGCCCAATCTGATCCCAGAGG - Intronic
1196187336 X:112758427-112758449 GGAGTCTCACCTGCACACACAGG - Intergenic
1197990537 X:132312386-132312408 GGGTTCTAATCTGTACCCTCTGG + Intergenic
1198433402 X:136590596-136590618 GGAGTGAAATCTGAAACCATGGG + Intergenic