ID: 925170494

View in Genome Browser
Species Human (GRCh38)
Location 2:1747357-1747379
Sequence TCCGGGTGCCATCGCCCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925170491_925170494 -3 Left 925170491 2:1747337-1747359 CCAGTGGGTTCAGATTAGACTCC 0: 2
1: 0
2: 0
3: 8
4: 93
Right 925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG No data
925170484_925170494 29 Left 925170484 2:1747305-1747327 CCATCGCCCCTGCGGGATCCTGC 0: 2
1: 1
2: 0
3: 14
4: 114
Right 925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG No data
925170487_925170494 21 Left 925170487 2:1747313-1747335 CCTGCGGGATCCTGCGCACACTC 0: 1
1: 0
2: 2
3: 12
4: 107
Right 925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG No data
925170490_925170494 11 Left 925170490 2:1747323-1747345 CCTGCGCACACTCTCCAGTGGGT 0: 1
1: 0
2: 1
3: 14
4: 118
Right 925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG No data
925170485_925170494 23 Left 925170485 2:1747311-1747333 CCCCTGCGGGATCCTGCGCACAC 0: 2
1: 1
2: 2
3: 2
4: 91
Right 925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG No data
925170486_925170494 22 Left 925170486 2:1747312-1747334 CCCTGCGGGATCCTGCGCACACT 0: 1
1: 1
2: 1
3: 3
4: 57
Right 925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925170494 Original CRISPR TCCGGGTGCCATCGCCCCTG CGG Intergenic
No off target data available for this crispr