ID: 925170675

View in Genome Browser
Species Human (GRCh38)
Location 2:1748464-1748486
Sequence CCCTGGAGAGTTCAACCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925170675_925170680 -1 Left 925170675 2:1748464-1748486 CCATGGGGTTGAACTCTCCAGGG No data
Right 925170680 2:1748486-1748508 GAGGTCAGGCTGACAGCACAAGG No data
925170675_925170683 28 Left 925170675 2:1748464-1748486 CCATGGGGTTGAACTCTCCAGGG No data
Right 925170683 2:1748515-1748537 CACTTCACCCTACAATCGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925170675 Original CRISPR CCCTGGAGAGTTCAACCCCA TGG (reversed) Intergenic