ID: 925171666

View in Genome Browser
Species Human (GRCh38)
Location 2:1754031-1754053
Sequence CACTCCCCTGCTGCCGTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925171666_925171669 -10 Left 925171666 2:1754031-1754053 CCCACGACGGCAGCAGGGGAGTG No data
Right 925171669 2:1754044-1754066 CAGGGGAGTGAAATGGAACCAGG No data
925171666_925171671 4 Left 925171666 2:1754031-1754053 CCCACGACGGCAGCAGGGGAGTG No data
Right 925171671 2:1754058-1754080 GGAACCAGGGTCTCCAGCCCAGG No data
925171666_925171675 21 Left 925171666 2:1754031-1754053 CCCACGACGGCAGCAGGGGAGTG No data
Right 925171675 2:1754075-1754097 CCCAGGCCACGCCCCCTCCCCGG No data
925171666_925171677 22 Left 925171666 2:1754031-1754053 CCCACGACGGCAGCAGGGGAGTG No data
Right 925171677 2:1754076-1754098 CCAGGCCACGCCCCCTCCCCGGG No data
925171666_925171670 -9 Left 925171666 2:1754031-1754053 CCCACGACGGCAGCAGGGGAGTG No data
Right 925171670 2:1754045-1754067 AGGGGAGTGAAATGGAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925171666 Original CRISPR CACTCCCCTGCTGCCGTCGT GGG (reversed) Intergenic