ID: 925171669

View in Genome Browser
Species Human (GRCh38)
Location 2:1754044-1754066
Sequence CAGGGGAGTGAAATGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925171666_925171669 -10 Left 925171666 2:1754031-1754053 CCCACGACGGCAGCAGGGGAGTG No data
Right 925171669 2:1754044-1754066 CAGGGGAGTGAAATGGAACCAGG No data
925171664_925171669 -8 Left 925171664 2:1754029-1754051 CCCCCACGACGGCAGCAGGGGAG No data
Right 925171669 2:1754044-1754066 CAGGGGAGTGAAATGGAACCAGG No data
925171665_925171669 -9 Left 925171665 2:1754030-1754052 CCCCACGACGGCAGCAGGGGAGT No data
Right 925171669 2:1754044-1754066 CAGGGGAGTGAAATGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925171669 Original CRISPR CAGGGGAGTGAAATGGAACC AGG Intergenic