ID: 925171671

View in Genome Browser
Species Human (GRCh38)
Location 2:1754058-1754080
Sequence GGAACCAGGGTCTCCAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925171667_925171671 3 Left 925171667 2:1754032-1754054 CCACGACGGCAGCAGGGGAGTGA No data
Right 925171671 2:1754058-1754080 GGAACCAGGGTCTCCAGCCCAGG No data
925171665_925171671 5 Left 925171665 2:1754030-1754052 CCCCACGACGGCAGCAGGGGAGT No data
Right 925171671 2:1754058-1754080 GGAACCAGGGTCTCCAGCCCAGG No data
925171664_925171671 6 Left 925171664 2:1754029-1754051 CCCCCACGACGGCAGCAGGGGAG No data
Right 925171671 2:1754058-1754080 GGAACCAGGGTCTCCAGCCCAGG No data
925171666_925171671 4 Left 925171666 2:1754031-1754053 CCCACGACGGCAGCAGGGGAGTG No data
Right 925171671 2:1754058-1754080 GGAACCAGGGTCTCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925171671 Original CRISPR GGAACCAGGGTCTCCAGCCC AGG Intergenic