ID: 925171672

View in Genome Browser
Species Human (GRCh38)
Location 2:1754062-1754084
Sequence GTGGCCTGGGCTGGAGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925171672_925171677 -9 Left 925171672 2:1754062-1754084 CCAGGGTCTCCAGCCCAGGCCAC No data
Right 925171677 2:1754076-1754098 CCAGGCCACGCCCCCTCCCCGGG No data
925171672_925171675 -10 Left 925171672 2:1754062-1754084 CCAGGGTCTCCAGCCCAGGCCAC No data
Right 925171675 2:1754075-1754097 CCCAGGCCACGCCCCCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925171672 Original CRISPR GTGGCCTGGGCTGGAGACCC TGG (reversed) Intergenic