ID: 925171672 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:1754062-1754084 |
Sequence | GTGGCCTGGGCTGGAGACCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
925171672_925171677 | -9 | Left | 925171672 | 2:1754062-1754084 | CCAGGGTCTCCAGCCCAGGCCAC | No data | ||
Right | 925171677 | 2:1754076-1754098 | CCAGGCCACGCCCCCTCCCCGGG | No data | ||||
925171672_925171675 | -10 | Left | 925171672 | 2:1754062-1754084 | CCAGGGTCTCCAGCCCAGGCCAC | No data | ||
Right | 925171675 | 2:1754075-1754097 | CCCAGGCCACGCCCCCTCCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
925171672 | Original CRISPR | GTGGCCTGGGCTGGAGACCC TGG (reversed) | Intergenic | ||