ID: 925171677

View in Genome Browser
Species Human (GRCh38)
Location 2:1754076-1754098
Sequence CCAGGCCACGCCCCCTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925171666_925171677 22 Left 925171666 2:1754031-1754053 CCCACGACGGCAGCAGGGGAGTG No data
Right 925171677 2:1754076-1754098 CCAGGCCACGCCCCCTCCCCGGG No data
925171667_925171677 21 Left 925171667 2:1754032-1754054 CCACGACGGCAGCAGGGGAGTGA No data
Right 925171677 2:1754076-1754098 CCAGGCCACGCCCCCTCCCCGGG No data
925171664_925171677 24 Left 925171664 2:1754029-1754051 CCCCCACGACGGCAGCAGGGGAG No data
Right 925171677 2:1754076-1754098 CCAGGCCACGCCCCCTCCCCGGG No data
925171672_925171677 -9 Left 925171672 2:1754062-1754084 CCAGGGTCTCCAGCCCAGGCCAC No data
Right 925171677 2:1754076-1754098 CCAGGCCACGCCCCCTCCCCGGG No data
925171665_925171677 23 Left 925171665 2:1754030-1754052 CCCCACGACGGCAGCAGGGGAGT No data
Right 925171677 2:1754076-1754098 CCAGGCCACGCCCCCTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925171677 Original CRISPR CCAGGCCACGCCCCCTCCCC GGG Intergenic