ID: 925172369

View in Genome Browser
Species Human (GRCh38)
Location 2:1758160-1758182
Sequence GTCCAACACCACCTCAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925172360_925172369 19 Left 925172360 2:1758118-1758140 CCAGGGCAGTGGGTGGAGAAATT No data
Right 925172369 2:1758160-1758182 GTCCAACACCACCTCAGGGTTGG No data
925172363_925172369 -10 Left 925172363 2:1758147-1758169 CCCTTCCCTCTTGGTCCAACACC No data
Right 925172369 2:1758160-1758182 GTCCAACACCACCTCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925172369 Original CRISPR GTCCAACACCACCTCAGGGT TGG Intergenic
No off target data available for this crispr