ID: 925173436

View in Genome Browser
Species Human (GRCh38)
Location 2:1766765-1766787
Sequence GCTCCCAGAGGAGCAGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925173425_925173436 27 Left 925173425 2:1766715-1766737 CCTGTCTGGAAGTCAGCTCTTCC No data
Right 925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG No data
925173429_925173436 6 Left 925173429 2:1766736-1766758 CCCACAGGGTGTTCAAGGTCAGG No data
Right 925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG No data
925173431_925173436 5 Left 925173431 2:1766737-1766759 CCACAGGGTGTTCAAGGTCAGGT No data
Right 925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925173436 Original CRISPR GCTCCCAGAGGAGCAGGTGC AGG Intergenic
No off target data available for this crispr