ID: 925177662

View in Genome Browser
Species Human (GRCh38)
Location 2:1796704-1796726
Sequence CAGCAGGAGCAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2320
Summary {0: 1, 1: 1, 2: 12, 3: 282, 4: 2024}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925177662_925177673 29 Left 925177662 2:1796704-1796726 CCATCCTCCTTCTGCTCCTGCTG 0: 1
1: 1
2: 12
3: 282
4: 2024
Right 925177673 2:1796756-1796778 CCTCCACCTCCCGTGTCTGCAGG 0: 1
1: 0
2: 0
3: 30
4: 336
925177662_925177665 -9 Left 925177662 2:1796704-1796726 CCATCCTCCTTCTGCTCCTGCTG 0: 1
1: 1
2: 12
3: 282
4: 2024
Right 925177665 2:1796718-1796740 CTCCTGCTGTTTCCTGTGCCTGG 0: 1
1: 1
2: 28
3: 180
4: 1095

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925177662 Original CRISPR CAGCAGGAGCAGAAGGAGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr