ID: 925179754

View in Genome Browser
Species Human (GRCh38)
Location 2:1809462-1809484
Sequence CTCTGAAAGTTATACAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925179754_925179756 29 Left 925179754 2:1809462-1809484 CCTTCATTGTATAACTTTCAGAG 0: 1
1: 0
2: 1
3: 26
4: 175
Right 925179756 2:1809514-1809536 TTGCTTAAAAATCTTTATTATGG 0: 1
1: 1
2: 3
3: 55
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925179754 Original CRISPR CTCTGAAAGTTATACAATGA AGG (reversed) Intronic
904287974 1:29465419-29465441 CACTGAACATTAGACAATGAAGG - Intergenic
908918437 1:69160632-69160654 CTCTGAAAGCTATGCAATCCTGG + Intergenic
912596962 1:110888485-110888507 CACTGAATGTGAGACAATGAAGG - Intronic
913500836 1:119471306-119471328 ATCAGAAAGATAAACAATGAAGG + Intergenic
916648039 1:166807493-166807515 CTCTGAAGGTTGCAGAATGAAGG - Intergenic
918171274 1:181999653-181999675 TTCTCATGGTTATACAATGAAGG + Intergenic
921878813 1:220230261-220230283 CTCTGAATGTGAAACAAAGAAGG + Intronic
922108063 1:222529716-222529738 TTCTGAAAGTTAGTCACTGAAGG - Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1067830196 10:49607296-49607318 ATCTGAAAGTTAGAGAATGAGGG + Intergenic
1069517162 10:69086857-69086879 ATATTAAAGTTATACAATAAAGG - Intergenic
1070002446 10:72390316-72390338 CTCTGTAAGTTATTAAAAGATGG + Intronic
1073959123 10:108905680-108905702 TTCTGAAAGAAATACAAGGAAGG - Intergenic
1074294609 10:112172461-112172483 CTCAGAAAGTATTACATTGAAGG - Intronic
1075287231 10:121197421-121197443 CTCTGAAAGTCATACATGAAGGG + Intergenic
1075457024 10:122591576-122591598 CTCTGAAAATGATAGGATGAGGG + Intronic
1079014493 11:16857052-16857074 CTTTTAGAGTGATACAATGAGGG + Intronic
1080320275 11:31000448-31000470 CTCTGAAATTTAGAAAATGAAGG - Intronic
1082165701 11:48948048-48948070 CTATGACAGTTATATAAAGATGG - Intergenic
1086644006 11:89196560-89196582 ATATGTAAGTTTTACAATGAAGG - Intronic
1086657068 11:89371749-89371771 CTCTGATAGGTATACACTGGTGG - Intronic
1088196717 11:107281975-107281997 TTCTTAAAATTATGCAATGAAGG - Intergenic
1088459956 11:110072229-110072251 CTGTGTAAGTGATACTATGAAGG + Intergenic
1094008585 12:25782598-25782620 TTCTCAAAGTTAGACAGTGAGGG + Intergenic
1094657312 12:32432638-32432660 CTCTCAACTTTATAAAATGAAGG - Intronic
1094766623 12:33603268-33603290 CACTGGATGTTAAACAATGATGG + Intergenic
1095528815 12:43160453-43160475 GTCTAAAACTAATACAATGATGG + Intergenic
1097184886 12:57191217-57191239 CTCTGACAGCTACAGAATGAGGG - Intronic
1097403995 12:59166061-59166083 CTCTGAATTTTCTGCAATGATGG - Intergenic
1100081423 12:90855963-90855985 CTCTTAAATGTATACAATAAAGG - Intergenic
1101305932 12:103527879-103527901 CTTTTAAATTTATACAATGAAGG + Intergenic
1102921336 12:116793814-116793836 CTAGGAAAGATATAAAATGATGG - Intronic
1105635605 13:22212623-22212645 CTCTAAAAGCTATGCCATGAGGG + Intergenic
1106703544 13:32255899-32255921 CTCTGGAAGTTATACAAGGGAGG + Intronic
1107024912 13:35790942-35790964 TTCTGAAAGTATCACAATGAAGG + Intronic
1107271896 13:38629051-38629073 CTGTGATAATTATAAAATGATGG - Intergenic
1109283246 13:60381240-60381262 CTTTGAAAGTAATATATTGAGGG - Intergenic
1109863350 13:68228636-68228658 CTAAGAAGGTTATACAATAAAGG + Intergenic
1110436775 13:75484638-75484660 CTCTGCAAGTGATACAATGGTGG - Intergenic
1111409083 13:87851036-87851058 TTATGAAAGTTATTTAATGAGGG + Intergenic
1111596232 13:90414884-90414906 CTCTCAAATTTATACAATCATGG + Intergenic
1114027945 14:18545658-18545680 ATTTGAAAGTTATACGATCATGG + Intergenic
1114938551 14:27575788-27575810 CTCTCAAAGTCATAAAATTATGG + Intergenic
1116888133 14:50240417-50240439 CTATGAAAGTCATATAGTGATGG - Intronic
1117267862 14:54109077-54109099 CTTGCAAAGTTCTACAATGAGGG + Intergenic
1118108372 14:62687582-62687604 TTCTGAAAATGATACACTGATGG + Intergenic
1119522753 14:75298116-75298138 ATCTCATAGTGATACAATGAGGG + Intergenic
1119960255 14:78847885-78847907 CTCTGACAGTTTTACAAGTAGGG - Intronic
1120363573 14:83537393-83537415 CTCAGAGAGTTATAAAAAGAGGG + Intergenic
1202928633 14_KI270725v1_random:18306-18328 CTCTGAAAGTTCTACAATTTGGG - Intergenic
1124882316 15:33653861-33653883 CTCTTGAAGTTTTATAATGAAGG + Intronic
1125027370 15:35044377-35044399 CTCTAAAAATTATAAAATGTGGG - Intergenic
1125805672 15:42491464-42491486 TTCAGAAAGTTTTACAAGGAAGG - Intronic
1126335135 15:47579091-47579113 CTCTGAAAGTTACACTCTGTAGG + Intronic
1126920973 15:53523863-53523885 CACTGAAAGTTATAATAAGAAGG + Intronic
1127642600 15:60929973-60929995 CTCTGAACTTTCTGCAATGATGG + Intronic
1128121274 15:65149219-65149241 CTCTGAAAGTGCTAGAATTACGG - Exonic
1129525771 15:76213288-76213310 CTGTGAAAGTTATACCATACAGG - Intronic
1130019598 15:80216870-80216892 CTCTGAAATTTCTAGAATTACGG + Intergenic
1131443040 15:92473102-92473124 CTCTGAGAGGTACACAGTGAAGG + Intronic
1133660836 16:7915850-7915872 CAATGAAAGTTTTACAATGTAGG + Intergenic
1135094277 16:19551698-19551720 TTTTTAAAGTTATAAAATGAGGG - Exonic
1138252352 16:55510986-55511008 CTCTGAGAGTTATAGTATAATGG + Intronic
1138827928 16:60343211-60343233 TTCTGCAAGTGATACAATGAGGG + Intergenic
1139147543 16:64342190-64342212 CTCTTAAAGGTATAGGATGAGGG - Intergenic
1139162222 16:64524472-64524494 TTCTGAAACTTATACATTGTTGG + Intergenic
1139414094 16:66793097-66793119 TTCTGAAAGATATAGGATGAAGG + Intronic
1142107570 16:88313563-88313585 CTCTGTAATTAAGACAATGATGG + Intergenic
1143075751 17:4341654-4341676 CTCTTAAAGTTGTACCGTGAAGG - Intronic
1144715749 17:17434669-17434691 CTTTGAAAGTTGCACAATAATGG - Intergenic
1146703145 17:34980043-34980065 CTTTGAATGATATACAATCAAGG + Intronic
1147250516 17:39150550-39150572 CTATGAAAATTATACCATGAGGG + Intronic
1148601537 17:48898180-48898202 GTCTGACATTTATACAATCATGG + Intergenic
1149333836 17:55613717-55613739 CTCTGAAAGTTAGGCAAGAAGGG - Intergenic
1149653247 17:58292191-58292213 CTCTGAAAGTAAATCAATGCAGG + Intergenic
1151773528 17:76181222-76181244 GTCTGAAAGTTATACCATCATGG + Intronic
1156020742 18:32597018-32597040 CTCACAAAGTGATGCAATGAGGG - Intergenic
1157319473 18:46623389-46623411 ATCTGAAGAATATACAATGAGGG + Intronic
1157909098 18:51598269-51598291 CATTGAAAGTTATACAAGGGAGG + Intergenic
1159135833 18:64335794-64335816 CTCTAAAAGTCTTACTATGATGG - Intergenic
1159161510 18:64648010-64648032 CTTTAAAAGTTATGCAATAATGG + Intergenic
1162247694 19:9416255-9416277 CTATGAAAATTATAAACTGATGG + Intronic
925179754 2:1809462-1809484 CTCTGAAAGTTATACAATGAAGG - Intronic
926344319 2:11931304-11931326 CTCTGAAAATTATTCGATCATGG + Intergenic
927118778 2:19933188-19933210 CTCTTAAAGTGCTACCATGAGGG - Intronic
928887174 2:36163115-36163137 TTCAGAAAGTTTTAAAATGATGG - Intergenic
931099784 2:58984167-58984189 CCCTGAAATGTATACAATGTGGG + Intergenic
934086939 2:88517687-88517709 CTCTGAAAATTAAAAAGTGATGG - Intergenic
935005428 2:99071109-99071131 CACTGAAAGTGATACAAAGTGGG + Intronic
935023990 2:99258623-99258645 CTCTGAAACCTATAAAATGGGGG + Intronic
940684828 2:156834473-156834495 CTCATAAGGTTACACAATGAAGG + Intergenic
943231461 2:185258089-185258111 CCCTGAAAGGAATACAATGAGGG - Intergenic
943532803 2:189107071-189107093 CTTTCAAAGTTTTACTATGAAGG - Intronic
943971112 2:194407786-194407808 TTCTGAAAGTTTTAAAATTAGGG - Intergenic
944816483 2:203381901-203381923 CACTGAAAGTCAAAAAATGAAGG - Intronic
945787783 2:214264710-214264732 TTCTGTATGTTATATAATGATGG - Intronic
945867162 2:215189294-215189316 CTCTGAAAGTTACATAAGGCTGG - Intergenic
947012824 2:225584281-225584303 TTCTGTAAGTTATATATTGATGG - Intronic
1170583743 20:17718473-17718495 CTCTAAAAATTCTACAATGCAGG - Intronic
1172487460 20:35306966-35306988 CTCTGTATGTAATAAAATGAAGG - Intronic
1174732753 20:52934111-52934133 CTCTGAAAGCCATTTAATGAAGG - Intergenic
1176590655 21:8646889-8646911 CTCTGAAAGTTCTACAATTTGGG - Intergenic
1177322533 21:19541790-19541812 CTTTGAAAATTATACCATGCTGG + Intergenic
1179286450 21:39981622-39981644 TTCTGAGAGTTATTCATTGAGGG + Intergenic
1180273484 22:10623923-10623945 CTCTGAAAGTTCTACAATTTGGG - Intergenic
1180452070 22:15472713-15472735 ATTTGAAAGTTATACGATCATGG + Intergenic
949136616 3:574791-574813 CTCTGAAAGTTCTACAATTTGGG + Intergenic
951252144 3:20406255-20406277 CTCTGAAAGATATTGTATGATGG + Intergenic
951937293 3:28035715-28035737 TTCTGCAAGTTATAGATTGATGG - Intergenic
953512866 3:43560469-43560491 CTATGAAAGTTTCACAATAATGG + Intronic
955116400 3:56009066-56009088 ATCTGAAAGTCATACAATGTTGG + Intronic
955480486 3:59384911-59384933 CTCTGAAATTTGCACAATGAAGG + Intergenic
956387056 3:68730754-68730776 TACTGGAAATTATACAATGAGGG - Intergenic
957773089 3:84719659-84719681 ATCTGAACGTTACACAATGGAGG - Intergenic
959525853 3:107375692-107375714 CTCTGTAAGTGTGACAATGAGGG + Intergenic
960263243 3:115591792-115591814 CTCTGAAAGTTTTACAAAGTAGG - Intergenic
960445988 3:117749232-117749254 CTCTGAAAGTAATTAATTGAAGG + Intergenic
962359411 3:134725322-134725344 CTCTGAAACCTATACAATTTGGG - Intronic
963467664 3:145702965-145702987 GTCTGAAAAGTATATAATGAGGG - Intergenic
964987909 3:162767285-162767307 TTCTCATAGTTATGCAATGAGGG + Intergenic
965152416 3:164995700-164995722 CTCAGAAAGGTATTAAATGAAGG - Intronic
965927529 3:174000662-174000684 ATGTGAAAGTCACACAATGAGGG + Intronic
966296778 3:178432830-178432852 CTCTGCAAGCTATACAAGCATGG - Intronic
975956705 4:79849215-79849237 CCCTTAAAGTGATACACTGATGG - Intergenic
977177730 4:93836590-93836612 CTCTGAAAGAAATAGAAAGATGG + Intergenic
978825797 4:113021964-113021986 CTCTGAAGGTTTTAAAAAGAGGG - Intronic
979430639 4:120625204-120625226 CTCTAAAAGAAATACAAAGACGG - Intergenic
980035267 4:127876477-127876499 AACTAAAAGTTATACAAAGAGGG + Intergenic
981890765 4:149733879-149733901 ATCTGAAAGTTCTTCAAAGATGG - Intergenic
983743730 4:171168229-171168251 CTCTGAAGGTCAAACATTGAGGG + Intergenic
984119218 4:175722027-175722049 CTCTCAAAGTTCTAGAATTATGG - Intronic
984797271 4:183673895-183673917 CTATGTAAGTTATAGAATGATGG + Intronic
985119461 4:186625720-186625742 CTCTGAAAGTGATGAAATGTTGG - Intronic
987531453 5:19126316-19126338 CACTGAAAGTGAGACAATAAAGG + Intergenic
987841862 5:23232591-23232613 CTCTGATAGTTAAAAGATGAAGG - Intergenic
988436679 5:31183488-31183510 CTCTGACAGTTTGTCAATGAGGG - Intergenic
989826778 5:45866021-45866043 GTATGAAAGTTATATAATGATGG + Intergenic
991073290 5:62510697-62510719 CTGTGAAAGATATAAAAGGAAGG - Intronic
992109226 5:73476857-73476879 CTCTGACAGTTGTGGAATGAGGG - Intergenic
992258681 5:74948339-74948361 CTCTGAAAGTGACCCTATGAAGG + Intergenic
993392286 5:87334581-87334603 CACTGTAAATTTTACAATGATGG + Intronic
994007700 5:94859142-94859164 CTCTGAGAATTAAAAAATGAAGG + Intronic
995445716 5:112241188-112241210 CCCTGAAAGTAATACACTTAAGG - Intronic
995562763 5:113401004-113401026 GTCTGAAAGATATAGAAAGAGGG + Intronic
997058558 5:130473921-130473943 TTCTGAAAGATAGACAAAGAGGG - Intergenic
998660635 5:144233354-144233376 CTCTGAAATCTATACTGTGAGGG + Intronic
1003908930 6:10726141-10726163 CTCAGAAAGTTTTAAAATGAGGG + Intronic
1010428685 6:75753760-75753782 CTCTGAACATTATATAATGCCGG - Intronic
1011336337 6:86265168-86265190 CTCTGAAAGTTAGAGACCGAAGG + Intergenic
1013634697 6:112017918-112017940 TTTTGAAAGTGAAACAATGAGGG + Intergenic
1014393777 6:120898239-120898261 TTCTGAAAGATATAAAGTGAAGG + Intergenic
1015596101 6:134868705-134868727 CTCTGCAAGTTATATTGTGAAGG + Intergenic
1015806751 6:137117775-137117797 TTCAGAAATTTATACAAAGAGGG + Intergenic
1015810392 6:137156672-137156694 GTCTGAAATTTATACAATCTTGG + Intronic
1017339824 6:153307919-153307941 CTCAGTATGTTATTCAATGACGG + Intergenic
1021421736 7:20453194-20453216 CTCTGAAATTTTTACAGTAATGG + Intergenic
1022389834 7:29934088-29934110 CTATGAAAGTTCTACAGTCATGG + Intronic
1022825420 7:34006984-34007006 CTCAGAAAATTATACTAGGAAGG - Intronic
1024469428 7:49752004-49752026 CTCTGAAAGTGATTAAATGCAGG + Intergenic
1028490293 7:91403889-91403911 CACTGAAAGTTACAAAATGAGGG + Intergenic
1030672125 7:112349422-112349444 CTCTGATGTTTATACAATGGTGG - Intergenic
1030787719 7:113683641-113683663 CTCTGACAGTTTGACAGTGAGGG - Intergenic
1035717606 8:1765519-1765541 TTTTGAAAATTATACATTGATGG - Intronic
1036595641 8:10209624-10209646 CGCTGAAAGTGAAACAATGAGGG - Intronic
1038104843 8:24421481-24421503 GTATGAAAGTAATTCAATGAGGG - Intergenic
1038571569 8:28667105-28667127 CTCTGACAGGTAAACAATGAGGG - Intronic
1039020955 8:33205918-33205940 CACTGAACATTATACATTGAAGG + Intergenic
1039926492 8:41938217-41938239 CTCTGACATCTATAGAATGAAGG - Intronic
1040122611 8:43699848-43699870 CTCTGGGACTTATACAAGGAAGG - Intergenic
1041943791 8:63419265-63419287 CTCTGAAAGGTAAAAATTGAGGG + Intergenic
1043935375 8:86136691-86136713 CTCTAGAAGTTCCACAATGAAGG + Intronic
1044054491 8:87551719-87551741 GTCTGAAAGTCATAAAATGTGGG + Intronic
1044667496 8:94645391-94645413 CTTTAAAAGTTATCCAATGCTGG + Intronic
1046977208 8:120293675-120293697 CTCTGATAATTATAGAATAAAGG + Intronic
1047664175 8:127072239-127072261 ATCTGTAAGTTTTACACTGAGGG - Intergenic
1047990886 8:130285245-130285267 TTCTGAAAGTTCTGCAAGGAAGG - Intronic
1048505162 8:135014302-135014324 CTATGAAAGTTAAACAAAGATGG - Intergenic
1048825075 8:138416524-138416546 CTCTGGAACTTATACAGAGAAGG - Intronic
1050043758 9:1522239-1522261 GCCTGAAAATTTTACAATGATGG - Intergenic
1051994436 9:23197853-23197875 CTTGCAAAGTTATAAAATGAAGG - Intergenic
1052034850 9:23668985-23669007 CTCTGAAAAAAATACATTGAGGG - Intergenic
1055401784 9:75931967-75931989 CTCTGAGAAATGTACAATGAAGG - Intronic
1055820344 9:80254377-80254399 CTTTAAAGGTTATATAATGAAGG - Intergenic
1055959286 9:81804753-81804775 CACTGAAATATATAAAATGATGG - Intergenic
1058758948 9:108110797-108110819 CACAGAAATTTCTACAATGATGG + Intergenic
1061522561 9:131128163-131128185 TTCTTAAAGATATATAATGATGG - Intronic
1203620668 Un_KI270749v1:125614-125636 CTCTGAAAGTTCTACAATTTGGG - Intergenic
1186535848 X:10347391-10347413 CCCTCAAAGTCATCCAATGAGGG - Intergenic
1187622846 X:21077867-21077889 CTCTGAAGGGTAGACACTGAGGG + Intergenic
1187704510 X:21996168-21996190 CTGTGTAAGATATAAAATGATGG + Intergenic
1188571840 X:31596261-31596283 CTCTAAGATTTATACAAAGAAGG + Intronic
1189740320 X:44111067-44111089 CTCTGAAAGGTAAACAATAGTGG - Intergenic
1189907018 X:45771585-45771607 CACTGAAATTTTTACAATGGAGG + Intergenic
1192601919 X:72473811-72473833 CACTGAAGGTTTTAGAATGAGGG - Intronic
1194151848 X:90335536-90335558 CTTTGAAAATTAAACAGTGAAGG - Intergenic
1194532177 X:95063961-95063983 CAGTGAATGTTATACATTGAAGG + Intergenic
1195113075 X:101666613-101666635 TTCTGAAATGTATACATTGAAGG - Intergenic
1197269742 X:124412713-124412735 CTCTGATATTTATTGAATGAAGG - Intronic
1197443952 X:126525387-126525409 ATCTCAAATTTAAACAATGATGG + Intergenic
1198973896 X:142313060-142313082 CTCTGAAAGATAAAAAATCAAGG + Intergenic
1199899281 X:152157263-152157285 CTGTGACAGTTATAGCATGATGG + Intergenic
1200967517 Y:9110748-9110770 CTCTGAAAGTCATACGCTGAGGG - Intergenic
1202143353 Y:21752114-21752136 CTCTGAAAGTCATACACTGAGGG - Intergenic