ID: 925180118

View in Genome Browser
Species Human (GRCh38)
Location 2:1812049-1812071
Sequence CAGTGTGTCCAGTGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925180118_925180122 4 Left 925180118 2:1812049-1812071 CCTTCCTGCCACTGGACACACTG 0: 1
1: 0
2: 1
3: 27
4: 292
Right 925180122 2:1812076-1812098 TGTCACACACATCTTCCTGCAGG 0: 1
1: 0
2: 3
3: 13
4: 184
925180118_925180124 20 Left 925180118 2:1812049-1812071 CCTTCCTGCCACTGGACACACTG 0: 1
1: 0
2: 1
3: 27
4: 292
Right 925180124 2:1812092-1812114 CTGCAGGTGTGTCTGCGCTTTGG 0: 1
1: 0
2: 1
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925180118 Original CRISPR CAGTGTGTCCAGTGGCAGGA AGG (reversed) Intronic
900134912 1:1112456-1112478 CCGTGTGTTCACTGGAAGGAGGG - Intronic
900218734 1:1495843-1495865 GAGTGTCTCGAGGGGCAGGAAGG - Exonic
900226091 1:1534284-1534306 GAGTGTCTCGAGGGGCAGGAAGG - Exonic
901000063 1:6144513-6144535 AACTGAGTCCATTGGCAGGAAGG - Intronic
902697283 1:18148895-18148917 TTGTGTGTGCAGGGGCAGGAGGG - Intronic
902892241 1:19452725-19452747 GTGAGGGTCCAGTGGCAGGAGGG - Intronic
903323631 1:22556828-22556850 CAGTGTGGCTAGCGGCTGGAAGG + Intergenic
904409808 1:30318736-30318758 CAGCTTGTTAAGTGGCAGGAGGG + Intergenic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
906157792 1:43624106-43624128 CTGTGTGTCCAGGGGCCAGATGG - Intergenic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
907152241 1:52299817-52299839 CAGTGGGTCCAGTTTCAAGATGG + Intronic
908265715 1:62377418-62377440 CAAGGTCTACAGTGGCAGGAGGG - Intergenic
908420382 1:63953147-63953169 CAATGTGCCAAGTGGCAGAATGG + Intronic
908494350 1:64679634-64679656 CTGTGGGTCCTGTGGCTGGAGGG + Exonic
908506258 1:64804001-64804023 CAGTGAGTTGAGAGGCAGGAGGG - Intronic
911666589 1:100559931-100559953 CAGTGTGTCACACGGCAGGAGGG + Intergenic
916533460 1:165680486-165680508 AAGTGTGCCCACTGGCATGAAGG - Exonic
919836146 1:201574818-201574840 CAGTGTCTCAGGTGGAAGGAAGG + Intergenic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920804024 1:209216377-209216399 CACTCTCTCCAGTGGCAGGGAGG + Intergenic
922749065 1:228062356-228062378 CAGTGTGCCCCATGGTAGGAAGG + Intergenic
922896939 1:229108047-229108069 CCCTGAGTCCAGTAGCAGGAAGG - Intergenic
923247662 1:232148363-232148385 CAGGATCTCCAGTGGCAGCATGG - Intergenic
923341284 1:233009033-233009055 CAGTGTGGCCAGTAGGAGCAAGG + Intronic
923704451 1:236332728-236332750 CAGTGTGTAGGGTGGCAGGGGGG - Intergenic
1062867170 10:865512-865534 CAGTGTGCCCAGAGACAGCAAGG - Intronic
1063678237 10:8161078-8161100 CAGTGTTTCCAGTTTCAAGATGG + Intergenic
1065476342 10:26141951-26141973 CAATGTAGCCAGTGGCAGGTGGG - Intronic
1065969603 10:30795968-30795990 CAGTGAGGCCAGAGGCAGGCAGG + Intergenic
1066347047 10:34597816-34597838 CACTGTCTCCAGAAGCAGGAGGG + Intronic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1067207917 10:44235461-44235483 CAGTCCGTCCAGGGGCAGGTAGG - Intergenic
1068340776 10:55699478-55699500 CAGTGTGTCACATGGCAAGAGGG - Intergenic
1069157284 10:65046796-65046818 AAGTGTGTAGAGTGGGAGGAGGG + Intergenic
1070818792 10:79342731-79342753 CTGTGTCTCCAGGGGCAGGTGGG - Intergenic
1071212146 10:83355646-83355668 CACTGAGTCCAGAGGCAGTAGGG + Intergenic
1072417387 10:95260541-95260563 CACTGTGTGCACTGGGAGGAAGG + Intronic
1073838607 10:107472440-107472462 CAGTGTGACCAGTTTCAGAAAGG - Intergenic
1074584767 10:114756873-114756895 CAACGTGTCCAGTGGCACGATGG - Intergenic
1074820105 10:117171896-117171918 CACTGTGTCAAGTGCCAGGCAGG + Intergenic
1075099506 10:119496243-119496265 CAGTCTCTCCAGTGTCAGCAAGG - Intergenic
1075121777 10:119669778-119669800 CAGTGTTTCCTCTGCCAGGAGGG + Intronic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1076737532 10:132465464-132465486 GAGTGTGTCCTGGGGCAGGCTGG - Intergenic
1078713555 11:13817911-13817933 CATTGGCTCCAGTGACAGGAGGG + Intergenic
1081190153 11:40094207-40094229 CAGTGTAGCCAGTGGAAGGAAGG + Intergenic
1082097091 11:48139715-48139737 CACTGTGTCCTGTGGAAAGATGG + Exonic
1083776902 11:64898446-64898468 CAGCGTGTTCAGAGGCAGGGTGG - Intronic
1084417594 11:69042408-69042430 CCCTGTGTCCAGTGGCCTGAGGG + Intergenic
1084661581 11:70549550-70549572 CAGTGTGGCCAGGGGCAGGCGGG + Intronic
1084785086 11:71437532-71437554 CAGTGCGGGCACTGGCAGGAGGG - Intronic
1086931708 11:92700457-92700479 GAGGGTGACCAGTGGCAGCAGGG + Intronic
1088513789 11:110605719-110605741 TAATCTGTCAAGTGGCAGGAAGG + Intronic
1088588528 11:111380401-111380423 CACTGGGACCAGTGGTAGGAGGG - Intronic
1089297403 11:117478321-117478343 CGGTGTGTGCAGTGCCATGAGGG + Intronic
1089566028 11:119372315-119372337 CAGTGCACCCTGTGGCAGGAGGG - Intronic
1089834043 11:121354255-121354277 GATTATGTCCAATGGCAGGAAGG - Intergenic
1090007842 11:123018531-123018553 CAGTGTGTGCGGTGGTTGGAGGG + Intergenic
1090078476 11:123594396-123594418 CAGTTGGCCCAGTGGCAGAAGGG + Intronic
1090304719 11:125681391-125681413 CAGTGTCAACTGTGGCAGGAAGG - Intergenic
1091664978 12:2412247-2412269 CGGTGTGTGCTGTGGAAGGACGG - Intronic
1093505254 12:19857787-19857809 AAGTGTGGCCAGTGTCAGGTGGG + Intergenic
1094365834 12:29680115-29680137 CAGAGTTTTCAGTGGCAGCAAGG + Intronic
1094598696 12:31889083-31889105 CAGTGTGTCCAATGGCGTGATGG + Intergenic
1096862882 12:54542591-54542613 CAGCATGTCCAGGGTCAGGAAGG - Exonic
1097022142 12:56027952-56027974 GTGTCTGTCCAGTGGGAGGAGGG + Intronic
1097051586 12:56226385-56226407 CAGAGGGTCCAGTGGTAGGCTGG - Exonic
1097055664 12:56247757-56247779 CAGTGTGGCCAGAGGCAGCTAGG + Exonic
1097247866 12:57616473-57616495 CTGTTTATCCAGTGGCAAGAGGG - Exonic
1097690340 12:62728845-62728867 CTTTGTGTCCACTGGCAGGCTGG - Intronic
1098218639 12:68245580-68245602 CAGGCTGTGCAGTGGCTGGAAGG - Intergenic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1102704508 12:114869578-114869600 CAGGGTGTCCTGTGGCTTGAAGG - Intergenic
1102959603 12:117084302-117084324 CAGTGTCTCCAGGGTCAGAAAGG + Intronic
1103122168 12:118389372-118389394 CAGTCTCCACAGTGGCAGGATGG - Intronic
1104012908 12:124944639-124944661 CATTGTGTCCAGTCCCTGGATGG - Intergenic
1105842009 13:24261738-24261760 CACTGGATCCAGTGGCAGGGAGG + Intronic
1106158966 13:27183680-27183702 AAGTGTGGCCTGTGGGAGGAGGG - Intergenic
1107064178 13:36195139-36195161 AAATGTGTCCAATGCCAGGAAGG + Intronic
1107609866 13:42102409-42102431 CACATTGTCCATTGGCAGGAAGG - Intronic
1108058564 13:46509689-46509711 CAGTGTGTCACATGGCAGGATGG - Intergenic
1109048924 13:57452401-57452423 GAGTTTGTCCAGTTACAGGAGGG + Intergenic
1109519313 13:63487020-63487042 GTGTGTTTCCAGTGGTAGGAAGG + Intergenic
1111393799 13:87635780-87635802 GAGTGTGGCGAGTGGAAGGAGGG + Intergenic
1113539560 13:111095563-111095585 AAGTGTTTCCCATGGCAGGACGG - Intergenic
1113808196 13:113122125-113122147 CAGTGTGGCCAGTGGTGGGCAGG + Intergenic
1114115182 14:19614313-19614335 CAGGTTGTCCATTGGCAGGCAGG + Intergenic
1115961025 14:38836276-38836298 CTGTGTGTCCTGAGGCTGGACGG + Intergenic
1120129457 14:80787879-80787901 CAGTAAGTCCAGAGACAGGATGG + Intronic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121107122 14:91288313-91288335 CAGTGTGTCCTGTGGCTGGTGGG + Intronic
1121599431 14:95191988-95192010 CAGTGTGTCCATCTGCAGAATGG - Intronic
1123112424 14:105879634-105879656 CAGGGTGCCCAGGGGCAGGCAGG - Intergenic
1123435149 15:20248917-20248939 GGGTGTGTCCAGGGGCAGAAAGG - Intergenic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1125015716 15:34932543-34932565 CAGTGTGTCTATTGGAAGGTTGG - Intronic
1125521896 15:40352722-40352744 CAGTGTGCCCAGTGCAGGGACGG - Intronic
1125717576 15:41827931-41827953 GTGTGTGTCCAGGGGCAGGACGG + Intergenic
1126377135 15:48007735-48007757 GCCTGTGTCCAGGGGCAGGAAGG + Intergenic
1126878770 15:53072195-53072217 GAGAGTGGCCAGTGGCAAGAAGG + Intergenic
1128866652 15:71119619-71119641 CAGTGAGTCTGGTGGCAGGTGGG - Intronic
1129675330 15:77630206-77630228 CAGCGTGTCCAGTGGAGGGTAGG - Intronic
1130325979 15:82880644-82880666 CAGTGTCTCCATGGGCGGGAAGG - Intronic
1131830350 15:96351007-96351029 AAGTGTGTGCAGGGACAGGAGGG + Intergenic
1134008226 16:10832680-10832702 CAGAGTCTCCAGTGGGAGGGGGG + Intergenic
1134033650 16:11012989-11013011 GAGTTTGTCCTGTGACAGGATGG - Intronic
1134541668 16:15071960-15071982 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1135359652 16:21801552-21801574 CAGTGTGTCCAGAGACCGGAAGG - Intergenic
1135437118 16:22436527-22436549 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1136263144 16:29095400-29095422 CAGTGTGTCCAGAGACCGGAAGG + Intergenic
1136286606 16:29247866-29247888 CAGTGTGACCCATGACAGGAAGG + Intergenic
1136464910 16:30436038-30436060 AAGTGTGTACAGGGACAGGATGG - Intergenic
1136849450 16:33602035-33602057 GGGTGTGTCCAGGGGCAGAAAGG + Intergenic
1137734116 16:50711548-50711570 CAGTCTGCCCAGGTGCAGGAGGG - Exonic
1137933336 16:52609364-52609386 AAATGAGTCCAGTGGAAGGAAGG + Intergenic
1139598411 16:67971243-67971265 CAGGGTGTGCAGTGCCAGGGTGG - Intergenic
1139954451 16:70686427-70686449 CAGTGGGTACAGTGGCGGGATGG + Intergenic
1140978257 16:80081753-80081775 GAGTGTGACCGGTGGAAGGAGGG + Intergenic
1142158524 16:88545081-88545103 CAATGTCTGCAGTGGCTGGAGGG + Intergenic
1203111158 16_KI270728v1_random:1450685-1450707 GGGTGTGTCCAGGGGCAGAAAGG + Intergenic
1144002832 17:11071623-11071645 GAGTGTGTCCTGTGACGGGATGG + Intergenic
1146679415 17:34796334-34796356 CACTGTGCCCAGTGGAGGGATGG - Intergenic
1146927356 17:36754236-36754258 CAGAGAGACCAGTGGAAGGAGGG + Intergenic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1149775447 17:59353452-59353474 CTGTAGGTCCGGTGGCAGGAGGG - Exonic
1150189587 17:63224160-63224182 CAATGTTTCTAGTGGCAAGATGG - Intronic
1150532564 17:65999726-65999748 CACTGGGTCCTATGGCAGGATGG - Intronic
1151194926 17:72424636-72424658 CAGGGCGGCCAGTGGGAGGAGGG - Intergenic
1151553585 17:74835655-74835677 CAGTGGGGCCAGTGGCAGGGTGG - Intronic
1151779883 17:76239002-76239024 CAGTGTGTCCAGTGTCTGCCAGG - Intronic
1151827169 17:76529944-76529966 CAGTGTGGTCAGCAGCAGGAAGG + Intronic
1151928830 17:77217892-77217914 CAGTGTGTCCACAGGCAGTCAGG + Intergenic
1152486261 17:80595743-80595765 CATCGTGCCCAGTGGCAGGAGGG + Intronic
1152741938 17:82022276-82022298 CAGTTTCTCCACTGGCAGGTGGG + Intronic
1153971817 18:10234060-10234082 CAGTGTGGCCTGAGTCAGGATGG - Intergenic
1154001939 18:10489123-10489145 CAGTATGTGCAATGACAGGATGG - Exonic
1154347193 18:13551939-13551961 CAGTGTGTCACATGGCAGGATGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157913888 18:51645488-51645510 CAGTGGGTCCAGAAGCAGCATGG + Intergenic
1159678364 18:71314860-71314882 CAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1160086040 18:75778310-75778332 CTGGGTGTCCAGTGCCAGGTGGG + Intergenic
1162378949 19:10320943-10320965 CAGTGAGACCTGTGGCGGGAAGG + Exonic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1164962777 19:32449740-32449762 TAGTGTGTACAGTGAGAGGAAGG - Intronic
1165101896 19:33443803-33443825 CAGTGTGTCCTCAGGCAGGGAGG + Intronic
1165101911 19:33443993-33444015 CAGTGTGTCCTCAGGCAGGGAGG + Intronic
1166699176 19:44872272-44872294 CAGTGTAGACAATGGCAGGAAGG - Intronic
1167068290 19:47203694-47203716 CAGTGTGTGCGGTGGTTGGAGGG + Exonic
1167618643 19:50549505-50549527 CAGGGTGGGCAGTGACAGGAGGG - Intronic
1168412482 19:56148336-56148358 CTGAGTCCCCAGTGGCAGGAGGG + Intronic
925180118 2:1812049-1812071 CAGTGTGTCCAGTGGCAGGAAGG - Intronic
925429479 2:3778668-3778690 CAGTTTCTCCAGATGCAGGATGG - Intronic
926044763 2:9702497-9702519 CAATGTGTACAAAGGCAGGAAGG - Intergenic
929053995 2:37860422-37860444 CATTGAGTCCTGTGGGAGGAAGG + Intergenic
929601575 2:43207826-43207848 ATGAGTGTGCAGTGGCAGGAGGG + Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
931045047 2:58341604-58341626 CAGTGGGTCAAGTGGATGGAGGG - Intergenic
931382744 2:61768388-61768410 CAGTGTGTCACATGGCAAGAGGG + Intergenic
932029685 2:68170959-68170981 GAGTGTGTGCAGTGGAAGTAAGG - Intronic
933191445 2:79338362-79338384 CAGTGAGTCCAGTGTAATGAGGG + Intronic
934050922 2:88210185-88210207 CACTGTGACCTGTGGCAGCAGGG + Intergenic
935396617 2:102616823-102616845 CAGTTAGGCCAGTTGCAGGATGG - Intergenic
935743370 2:106170308-106170330 CAGTGTCTCCTGGAGCAGGAGGG - Intronic
936241837 2:110794552-110794574 CACTGTGCCCTGTGTCAGGAGGG + Intronic
939014631 2:136887591-136887613 CAGTGTGTCACATGGCAAGAGGG - Intronic
939284410 2:140110511-140110533 CAGAGTTGCCACTGGCAGGAAGG + Intergenic
941293190 2:163701593-163701615 CAGAGTATACAGTGGCATGAGGG + Intronic
941643956 2:168019631-168019653 CAGTGCCTGCAGTGGGAGGATGG + Intronic
942446233 2:176080572-176080594 GAAGGTGTCCAGTGGCCGGATGG + Exonic
943150050 2:184100153-184100175 CAGTGTGTCATGTGGCAAGGAGG - Intergenic
946456641 2:219832014-219832036 CAGAGTGTGAAGGGGCAGGAAGG + Intergenic
947590723 2:231383535-231383557 CAGTGTGTTCAGTGACAGGGAGG - Intergenic
948176653 2:235948790-235948812 CTGTGTGGCAAGTGGGAGGATGG - Intronic
948315739 2:237027075-237027097 CAGTGTGTCCAGGGACAAGAAGG + Intergenic
948375121 2:237516123-237516145 AAGGGTGTCCAGGGGCAGCAAGG + Intronic
948484114 2:238269459-238269481 GAGTGTGTTCAGTTGCAGGTTGG - Intronic
948484117 2:238269504-238269526 GAGTGTGTTCAGTTGCAGGTTGG - Intronic
948484120 2:238269549-238269571 GAGTGTGTTCAGTTGCAGGTTGG - Intronic
948594928 2:239073790-239073812 CAGTCTAGTCAGTGGCAGGATGG + Intronic
1169340915 20:4795605-4795627 CAGTGATTGCAGTGACAGGAAGG + Intronic
1169659547 20:7963245-7963267 CATTGGGTCAAGTGGCATGAAGG + Intergenic
1171305536 20:24102646-24102668 CTGTGTGGCCATGGGCAGGATGG - Intergenic
1171347931 20:24479813-24479835 CAGCCTGTCCAGTGCCAGTAGGG - Intronic
1172245277 20:33441787-33441809 CAGTGTGTCCATCTGCAGAATGG + Intronic
1172563959 20:35913579-35913601 CAGTGTGCCCTGCTGCAGGATGG + Intronic
1172564129 20:35915198-35915220 CAGTGTGTCCTGCTACAGGATGG + Intronic
1172835444 20:37870258-37870280 CTATGTCTCCAGTGGCAGGAGGG - Intronic
1172906519 20:38374124-38374146 AAGTCTGGCCAGGGGCAGGACGG + Intronic
1173048566 20:39536650-39536672 CAGAATCTCCAGTGGCTGGAGGG + Intergenic
1173158700 20:40636652-40636674 CAGTGTGTACAGTGGAACCATGG + Intergenic
1173258845 20:41415308-41415330 CAATCTGTCCAGTCACAGGATGG + Exonic
1176159902 20:63642588-63642610 CAGGGTGTGCAGTGGCGGCAGGG - Intronic
1176219453 20:63963159-63963181 CAGTGGGTGCAGGGGAAGGAGGG + Exonic
1179585436 21:42371239-42371261 GGGAGTGGCCAGTGGCAGGAAGG - Intergenic
1179721474 21:43318689-43318711 CAGTGTGTCCAGTGAAAAGCTGG + Intergenic
1179769421 21:43603336-43603358 CTGGGTGACCAGTGGCCGGAGGG + Intronic
1179893367 21:44348987-44349009 CACTGTGTCTAGTTGCAGGGTGG + Intergenic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180467564 22:15627762-15627784 CAGGTTGTCCATTGGCAGGCAGG - Intergenic
1180913166 22:19467563-19467585 CAGTATGTCCAGTGGAAGGAGGG - Intronic
1181120503 22:20664723-20664745 CAATGTGTCCACTTCCAGGAGGG - Intergenic
1181462873 22:23095624-23095646 CAGTGTCCCCTGTGGCAAGAGGG + Exonic
1183354810 22:37352471-37352493 CAGAGTGGCCAGTGTCATGAAGG + Intergenic
1183359933 22:37378203-37378225 TTGTGTGTGCAGGGGCAGGAAGG + Intronic
1184729632 22:46365514-46365536 CAGTCTGTCCAGTGACCGAAGGG + Intronic
949904350 3:8846188-8846210 AATGGTGTCCAGTGGAAGGAGGG + Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950179809 3:10903377-10903399 CAGTGAGTTCAGTGGCAGTAGGG - Intronic
950790815 3:15470461-15470483 CAGTGTGTGGAGTGGCAGGCAGG - Intronic
952673676 3:36000796-36000818 CAGAGTGCCCAGGGGAAGGAGGG - Intergenic
953297046 3:41729448-41729470 CAGTGGCTCCAGTGTCAAGATGG - Intronic
953439973 3:42908699-42908721 CAGTGTCTTCAGGGGTAGGAGGG - Intronic
953494127 3:43371979-43372001 CAGTGAGTAGAGGGGCAGGAAGG + Intronic
954410223 3:50367358-50367380 CAGTGTGCCCAGCAGCAGGCAGG - Intronic
955476678 3:59343449-59343471 CTGGGTGTCAAATGGCAGGAAGG - Intergenic
955484007 3:59417631-59417653 CAGTGTGGCCAGTGGTATGTGGG + Intergenic
957233014 3:77545275-77545297 CAGTGTGTAATTTGGCAGGATGG - Intronic
961385679 3:126522074-126522096 AAGTGTGTCCGGTGCAAGGAGGG - Intergenic
961507819 3:127382938-127382960 TGGTGTGGCCAGTGGAAGGAGGG + Intergenic
962333664 3:134505494-134505516 CAGTGATGCCAGTGGCAGGCAGG + Intronic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
965660845 3:171040321-171040343 CCGAGGGTCCAGTGTCAGGATGG + Intergenic
967604831 3:191433066-191433088 CAGTGCTTCCAGTGGCAGTTAGG + Intergenic
967742778 3:193021514-193021536 CAGTGTATCTAGTGGAAGAAAGG + Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968511601 4:998101-998123 CAGTGTGTCCTTTGGATGGAGGG + Intronic
971118880 4:23681537-23681559 CAGTGTGTCCAGTGGGTCCAAGG - Intergenic
971331938 4:25688847-25688869 CAGAGTCCCCAGTGGCAAGAGGG + Intergenic
972645547 4:40964659-40964681 CATTGTTTCCAGTGGCTGGATGG - Intronic
972846642 4:42999442-42999464 CAGTATGTGCAGTGACAAGATGG - Intronic
975493304 4:75011971-75011993 GAGTGTGGTCACTGGCAGGAGGG - Intronic
977569559 4:98615250-98615272 CAGCCTGTCCAGTTGTAGGAAGG - Intronic
978475351 4:109122229-109122251 CAGAATGTCCAGTGCCAAGAGGG + Intronic
978634292 4:110785482-110785504 CAGTGTTCCCTGTGGCAGGCTGG + Intergenic
978772652 4:112473520-112473542 CAGTCTTTCCAGTGTCAGCAAGG - Intergenic
981265044 4:142772536-142772558 CAGTGTGGGCAGTAGCAGGAAGG + Intronic
981985095 4:150844760-150844782 CAGTTTGTGCAGTCGCAGTAAGG - Exonic
984545457 4:181096189-181096211 CAGTGTCTACAGTGGCTGGAGGG + Intergenic
985045150 4:185933168-185933190 CAGTGTCTCCAAAGGCAGTACGG + Intronic
985565879 5:616994-617016 CAGTGTGTGTGGTTGCAGGAGGG + Intronic
987739474 5:21887524-21887546 CAGTGTCTCCAGAGGAAGAATGG - Intronic
988207750 5:28162315-28162337 CAGTGTCTCCTGTGGAGGGATGG - Intergenic
990368834 5:55096364-55096386 CCGAGTGTCATGTGGCAGGATGG + Intergenic
990486807 5:56267363-56267385 AAGGGTGTGCAGTGGCAGCAGGG + Intergenic
991202289 5:64008475-64008497 CAGTTTGTGCACTGGGAGGATGG + Intergenic
992494266 5:77276958-77276980 CCCTGTGTCTAGAGGCAGGAAGG - Intronic
995578061 5:113562545-113562567 CTGTGTCTCCAGTCACAGGAAGG + Intronic
996262269 5:121486932-121486954 TACTGTGTTCAATGGCAGGATGG + Intergenic
997410512 5:133687296-133687318 CAGTGAGCCCAGCGGCAGGGAGG + Intergenic
999154603 5:149449625-149449647 CAGTTCGTCCAGTGGAATGAGGG - Intergenic
999959530 5:156739453-156739475 AATTGCGTCCAGTGGCATGAAGG + Intronic
1002086798 5:176780978-176781000 CAGTGTCTCCATGAGCAGGAAGG + Intergenic
1002963117 6:1936257-1936279 CAATGTGAGCAGTGGCAAGAGGG + Intronic
1003977935 6:11361454-11361476 CAGAGTGTCAAGGGGCAGGGGGG + Intronic
1005391121 6:25334233-25334255 CTGTGTGTCCAGAATCAGGAAGG - Intronic
1006293786 6:33160818-33160840 CAGTGTCTCCATTGGCTGGTGGG - Intergenic
1010405921 6:75505681-75505703 CAGTCTGATCAGTTGCAGGAGGG + Intergenic
1010680399 6:78792470-78792492 GAGTGTGGACAGTGGGAGGAGGG + Intergenic
1014072896 6:117203920-117203942 CAGTGGCTGCAGTGGCAGCAGGG - Intergenic
1014459024 6:121673092-121673114 TGGTGTCCCCAGTGGCAGGACGG - Intergenic
1015355652 6:132274706-132274728 CAGTTAGTGCCGTGGCAGGAGGG + Intergenic
1016948835 6:149560946-149560968 CAGTGTCTCCAGGGCCAGCAAGG + Intergenic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1018236782 6:161734100-161734122 CTGTGTGTTCACTGGCTGGAAGG - Intronic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1019293126 7:260061-260083 CAGTGAATTCAGAGGCAGGACGG + Exonic
1019420343 7:947904-947926 CAGTGTGCCCAGAGCCAGGGCGG - Intronic
1019848736 7:3532891-3532913 CAATGAGTCCAGAGGCAGGGAGG - Intronic
1020869083 7:13605243-13605265 CACTTTGACCAGTGGCAGAAAGG + Intergenic
1022123093 7:27329021-27329043 CAGTGTGGCCACTCCCAGGATGG + Intergenic
1022579401 7:31534160-31534182 CAGTTTTTCCACTGGAAGGAGGG - Intronic
1023269807 7:38450323-38450345 CTTTGTGTCCAGTGGCAGAGAGG - Intronic
1023888178 7:44375417-44375439 CAGTGTGTCTGGTGGCCGGGAGG - Intergenic
1023909023 7:44540936-44540958 CAGTAGGGCCAGTGACAGGAGGG + Intronic
1028533183 7:91861817-91861839 TGGTGTGTCCAGTGGCATGCCGG - Intronic
1029133522 7:98351548-98351570 CATTGTCTCCAAAGGCAGGAAGG - Intronic
1029147475 7:98457206-98457228 TAGTGAGTCCAGTGTCATGAGGG + Intergenic
1030860653 7:114621772-114621794 CAGTGTACCCAGCGGCAGGAGGG + Intronic
1032205917 7:129865288-129865310 CTCTGTGTCCAGTCCCAGGAAGG + Intronic
1034545328 7:151785376-151785398 CAGAGAGTGGAGTGGCAGGAAGG - Intronic
1035126082 7:156608310-156608332 CCGTGTGTTCAGGGCCAGGAAGG - Intergenic
1035294192 7:157858448-157858470 GAGTGTGTACAGTGGCTGGGGGG - Intronic
1035294438 7:157859297-157859319 GAGTGTGTACAGTGGCTGGGGGG - Intronic
1035294629 7:157859945-157859967 GAGTGTGTACAGTGGCTGGGGGG - Intronic
1035391285 7:158506671-158506693 GAGTGTGGCTACTGGCAGGAAGG + Intronic
1035771736 8:2153076-2153098 CAGTGTGGCCTGGGGCAGGTGGG + Intronic
1038334363 8:26634568-26634590 CACTGTGTCCAGCCACAGGAGGG + Intronic
1038583697 8:28771299-28771321 CCAGGTGACCAGTGGCAGGAAGG + Intronic
1039549312 8:38431319-38431341 CAGTGTGACAGGTGCCAGGAGGG - Intronic
1041011602 8:53549337-53549359 CAGTGTCTCCAGGGTCAGCAAGG - Intergenic
1044716290 8:95102749-95102771 CAGTGTGTTCACTGGGAGCATGG - Intronic
1045897270 8:107234414-107234436 GAGTGTGTCCATTAGAAGGATGG - Intergenic
1047484066 8:125312766-125312788 CCTTTTGTCCAGTGGCAGGATGG + Intronic
1047495658 8:125406910-125406932 AGGTGTGTGCAGTGGCGGGATGG - Intergenic
1048340511 8:133534989-133535011 CAGTGTGGTCAGTGAAAGGAAGG + Intronic
1048890400 8:138941877-138941899 TAGAGTGTCCTGTGGCAGGTAGG + Intergenic
1049018604 8:139939025-139939047 CTGTCTGTCAAGTGGCAGGGAGG - Intronic
1049133578 8:140872525-140872547 CAGTCAGTCCAGGGGCAGGTGGG - Intronic
1049137697 8:140919060-140919082 CAGTGTGTGCAGCACCAGGAAGG + Intronic
1049148946 8:141022007-141022029 CAGGGTGACCACCGGCAGGACGG + Intergenic
1051431044 9:16980852-16980874 CAGTGTCTACGGTGGCAGCAGGG - Intergenic
1052561301 9:30087985-30088007 CCGTGTGACCAGTTGCAGAAAGG - Intergenic
1052935527 9:34089778-34089800 CAGTGTGTGGATAGGCAGGATGG - Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1054085995 9:60744681-60744703 TTGTGTGTCCAGTGACAGGTAGG + Intergenic
1054733610 9:68727794-68727816 CAGTGTGTCTCATGGAAGGAAGG + Intronic
1054927855 9:70606014-70606036 TAATGTGTTCAGTGGAAGGAAGG + Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056779515 9:89538858-89538880 CAGTGTGTGCAGTGGGGTGATGG + Intergenic
1058743637 9:107968446-107968468 CTGTGTGTCCAGTTGGAGGGAGG + Intergenic
1061264669 9:129497963-129497985 CACTATGGCCAGTGGCAGGGAGG + Intergenic
1061451018 9:130667009-130667031 CAGGGTGTCCGGGGGAAGGAGGG - Intronic
1186670260 X:11759433-11759455 CCCTATGTCCAGTGCCAGGATGG - Intronic
1193794017 X:85851369-85851391 CAGTGTGTCCACAGGCAGACAGG + Intergenic
1193986410 X:88246172-88246194 CAGTGGGTCTAGTGGGAGGGTGG - Intergenic
1196570414 X:117260378-117260400 CAGTGTGTCTTGAGGCAGCATGG - Intergenic
1197755128 X:129988085-129988107 CAGAGTGTTTAGTGTCAGGATGG + Intronic
1199169352 X:144717891-144717913 AAGGGTGCCCAGTGGCAGGCTGG + Intergenic
1200018390 X:153182054-153182076 CTATGTGTCCTGTGGCAGGTGGG - Intronic