ID: 925180156

View in Genome Browser
Species Human (GRCh38)
Location 2:1812387-1812409
Sequence TCCCCATGATGGGAGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925180156 Original CRISPR TCCCCATGATGGGAGAGTGC TGG Intronic
900188294 1:1343027-1343049 TCCCCATGCTGGGGGGGTGGGGG - Intronic
901810369 1:11763954-11763976 GCACCAAGATGGGAGAGAGCTGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903676928 1:25070314-25070336 TCCACCTAATAGGAGAGTGCTGG + Intergenic
904510831 1:31005926-31005948 TCCCCACGATCGGAGAGTGGGGG - Exonic
904574083 1:31491497-31491519 TCCCTATGAAGGGAGAGAGCTGG + Intergenic
904696898 1:32336027-32336049 TGCCCATGATGGGGGTCTGCTGG + Exonic
905394373 1:37657681-37657703 TCCCCGGGATGGCAGGGTGCGGG - Intergenic
906690220 1:47787664-47787686 CCCCCATGGTGGGAGACTGAGGG - Intronic
908787774 1:67752187-67752209 TCCCAGTGGTGGGAGAGTGAAGG - Intronic
911300609 1:96168505-96168527 TAGCCATGATGGGAAAGAGCAGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914358524 1:146909678-146909700 TCCCCATGGTGGGACAATTCTGG + Intergenic
914494900 1:148187329-148187351 TCCCCATGGTGGGACAATTCTGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916097656 1:161365426-161365448 CCCCCATGCTGGGATAGTGGTGG + Exonic
920813837 1:209312234-209312256 TCTCCATGAGGGGTGAGAGCTGG - Intergenic
922162107 1:223085605-223085627 TCCCAATGATGTGAGTGTGTCGG - Intergenic
922209383 1:223476021-223476043 TCCCCAGGATGACAAAGTGCTGG - Intergenic
1063163758 10:3441353-3441375 TCCCCATGATGGGGCTGAGCTGG - Intergenic
1068569229 10:58610237-58610259 TCCCCTAGATGAGAGAATGCTGG + Intronic
1068733903 10:60390372-60390394 ACCCCATGAGAGGAGAGTCCTGG - Intronic
1071839988 10:89460181-89460203 TTCCCATGATGAAAGAGTTCTGG - Intronic
1072191072 10:93076421-93076443 GCCCCATGATGGGAGAGACTGGG - Intronic
1076516532 10:131048269-131048291 TCCCCAGGGTGAGAAAGTGCTGG - Intergenic
1076551128 10:131278784-131278806 GCCCCAGCATGGGAGAGAGCAGG - Intronic
1078728988 11:13959039-13959061 TCCACAGGAGGGGAGACTGCAGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081431723 11:42983871-42983893 TCCCCAACATTGGAGAGTGTTGG - Intergenic
1083715920 11:64576904-64576926 TCCCCATGATGGGCAAGGACCGG - Intergenic
1083839509 11:65296059-65296081 GACCCATGAGGGGTGAGTGCCGG - Intronic
1084710869 11:70843063-70843085 TCCACATGCTGTGAGAGTCCAGG - Intronic
1089584087 11:119498935-119498957 CCCCCATCATGGATGAGTGCTGG - Intergenic
1090033511 11:123228411-123228433 TCCCCATGATGGCAAAGCCCTGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097630916 12:62061216-62061238 TCACCATGAATGGAGATTGCAGG - Intronic
1098372053 12:69769616-69769638 TCCCCATGATGGTAGATTAGAGG - Intronic
1099467495 12:83005535-83005557 TCCCCATGCTCTGAGAGTGACGG + Intronic
1101723905 12:107374043-107374065 TCTCCATGGTGGGAGGGTTCTGG + Intronic
1102543929 12:113641346-113641368 TCCCCAAGATGGGGGACTGGGGG - Intergenic
1103270339 12:119668229-119668251 TGCCCATGATGGGGGTCTGCGGG - Exonic
1103340051 12:120216359-120216381 GCCCCATGATGAGGGGGTGCAGG - Intronic
1104790714 12:131480482-131480504 TCACCATGAAGGGACAATGCAGG + Intergenic
1105302921 13:19151721-19151743 TCCCCAGGACTGGAGTGTGCTGG + Intergenic
1106169771 13:27279341-27279363 TCCCATTGATATGAGAGTGCTGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1107990600 13:45815719-45815741 ACTCCATGATGTGAGAGGGCTGG + Intronic
1112440681 13:99422586-99422608 TCCTCTTGAAGGAAGAGTGCAGG - Intergenic
1118140273 14:63072756-63072778 AACCCATGCTGGGAGAGTGCTGG - Intronic
1118560046 14:67069272-67069294 TCCCCATGTTAGGAGAGTAGAGG - Intronic
1119390506 14:74288303-74288325 TCCCCATGATGGCAGGTAGCAGG - Intronic
1119471266 14:74901170-74901192 TCCCCAGGATGGCAGACTGAGGG - Exonic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122737085 14:103848915-103848937 TCTCTGTGATGGGAGAGTGTAGG + Intergenic
1122800604 14:104227634-104227656 TCCCCAGGATGGGAGGCAGCTGG + Intergenic
1127860281 15:62988269-62988291 TGCCCATGAAGGGAGATTGGAGG - Intergenic
1128292677 15:66490017-66490039 TCCCCATGAAGGGGGTGGGCTGG - Intronic
1130437079 15:83911539-83911561 TCCCCAGGATGGGGCAATGCTGG - Intronic
1132102862 15:99038690-99038712 TCCCAATGAGGAGAAAGTGCTGG + Intergenic
1133311747 16:4852475-4852497 TCCCAATGATAGGAAACTGCTGG + Exonic
1138483345 16:57318627-57318649 TCACAAAGATGGCAGAGTGCTGG - Intergenic
1139820219 16:69715155-69715177 TCCCCATGATGGCACTGTGTGGG + Intronic
1139922260 16:70467709-70467731 ACTCCATGATGGCAGAGGGCAGG - Intronic
1140036161 16:71372791-71372813 TCCCCCTGGTGGGAGACTGGGGG + Intronic
1140542872 16:75775429-75775451 TCCCCATCAAGGGAGTGTGTTGG + Intergenic
1141443714 16:84045126-84045148 TACCCAGGCTGGGAGAGGGCGGG + Intergenic
1142904470 17:3033017-3033039 GCCCCATGTGGGGAGAGGGCTGG - Intronic
1144098096 17:11919962-11919984 TCTCCATGATGGGAGAGCCCTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146259540 17:31412584-31412606 TCCCTGTGATGGGACAGGGCAGG - Intronic
1147880742 17:43651805-43651827 TCCCTAGCATGGGAGAGTGGCGG + Intronic
1151234101 17:72706020-72706042 TTCCCAAGATGGCAGAGAGCTGG - Intronic
1152164532 17:78693774-78693796 TTCCCTTGATGGGAGAGAGGTGG - Intronic
1152251144 17:79213288-79213310 TCCCCTTCCTGGGTGAGTGCAGG - Intronic
1153594317 18:6709091-6709113 TCCCCATTTTGGGAGAGTTATGG - Intergenic
1154218329 18:12431735-12431757 TCCTCATGCGGGGAGAGGGCTGG + Exonic
1154941822 18:21120904-21120926 AAGCCATGGTGGGAGAGTGCGGG - Intergenic
1156205026 18:34875936-34875958 TCCCTGTCATGGGAAAGTGCTGG - Intronic
1158692956 18:59677712-59677734 TCCCCAGGATGACAGAGTGAAGG + Intronic
1159409643 18:68054860-68054882 TGCCCTTGATGGGAGTGTGGGGG - Intergenic
1160232580 18:77058990-77059012 GCCCCAAGATGGAAGCGTGCTGG + Intronic
1160554967 18:79718964-79718986 TCCCCACGCAGGGACAGTGCTGG - Intronic
1161152030 19:2714633-2714655 ACCCCACGATGGGGGAGTGGGGG + Exonic
1162186564 19:8909700-8909722 TCCCCATGCTATGAGAATGCAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163488193 19:17601939-17601961 TCCCCAGGGTGGCAGAGTTCCGG + Exonic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164826271 19:31287107-31287129 CCCCCGTGGTTGGAGAGTGCAGG - Intronic
925180156 2:1812387-1812409 TCCCCATGATGGGAGAGTGCTGG + Intronic
925782232 2:7391979-7392001 ACCCCATGATGGGAGACACCTGG - Intergenic
928097240 2:28412247-28412269 TCACCACGATGGGGGTGTGCAGG - Exonic
930857993 2:56039644-56039666 TCCTCACCATGGGAGAGTGTGGG - Intergenic
937983901 2:127630043-127630065 CCCCCATGATGGAAGAGGGAGGG - Intronic
938766170 2:134461818-134461840 TCCCCTTTGTGGGAGAGGGCCGG - Intronic
940055541 2:149509107-149509129 GCCCTATGATAGGAGAGGGCAGG + Intergenic
940289291 2:152062686-152062708 TTGCCATGATGGGAGAGGCCAGG - Intronic
940508013 2:154580268-154580290 TCCCCAGTATGGGAGAGAGAAGG + Intergenic
941011048 2:160299680-160299702 TCCCCTTGCTGGGAGAGAGCAGG + Intronic
941403842 2:165064203-165064225 TCCCCATGAGGGCAGAGAGTGGG + Intergenic
942272811 2:174294122-174294144 TCACCATAGTGGGAGAGTACTGG - Intergenic
945950599 2:216035346-216035368 TCCCCAGGATGCCAGAGGGCAGG + Intronic
946194303 2:218023963-218023985 TGCCCATGAGGACAGAGTGCAGG + Intergenic
946239475 2:218345001-218345023 TCCCCATGCGGGGAGTGGGCTGG - Exonic
946638839 2:221760871-221760893 TCTCCATGATGAGAGAGGTCTGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168788639 20:561071-561093 TCCACATAATGAGGGAGTGCTGG - Intergenic
1168797809 20:623119-623141 TCCTGAGGATGGGAGAGTGCAGG + Intergenic
1171391507 20:24804383-24804405 TTCCCAAGATGGAAAAGTGCTGG + Intergenic
1172619320 20:36308673-36308695 TCCCCATCATGTGAAACTGCTGG - Intronic
1175379815 20:58554985-58555007 TCCCCATGAAGGGGGAGAGGTGG - Intergenic
1180090812 21:45533106-45533128 TCCCCCTCCTGGGAGGGTGCAGG - Intronic
1180877508 22:19181564-19181586 TCCCTACAATGGGAGAGCGCTGG + Intronic
949745419 3:7286096-7286118 TTCCCATGAGGGGAAAGTACAGG - Intronic
949927061 3:9049742-9049764 TGCCCATCTTGGGAGAGTGGTGG + Intronic
950216336 3:11162345-11162367 TCTCCTTGGTGGGGGAGTGCGGG + Intronic
950705877 3:14781178-14781200 CCCACAAGATGGGAGAGTTCTGG + Intergenic
952041165 3:29263657-29263679 TCCCCAGGGTGAGAGAATGCTGG + Intergenic
953021210 3:39114524-39114546 TGCCCATGAAGGGAGTTTGCTGG - Intronic
954151244 3:48658293-48658315 CCTCCATAATAGGAGAGTGCAGG - Intronic
958677077 3:97278802-97278824 TGCCCATGAGGGGTGTGTGCAGG - Intronic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961659581 3:128461723-128461745 TCCCCGTCACGGGAGGGTGCCGG - Intergenic
962748105 3:138412517-138412539 TCCAGTTGATGGGATAGTGCTGG + Intergenic
965783302 3:172310712-172310734 TCCCCCTGAGGGGAGAGCACAGG + Intronic
969130912 4:4990616-4990638 CCTCCATGATAGGAGAGGGCTGG + Intergenic
975359511 4:73451546-73451568 TTCCCATGCTGGGAGGCTGCAGG + Intronic
975663759 4:76713034-76713056 TCACCATGAAGGGAGCCTGCAGG + Intronic
975723659 4:77271763-77271785 TCCCCATGATGGGTGGGTTTGGG + Intronic
976168036 4:82275943-82275965 TCTCAATGATAGGAGAGGGCTGG - Intergenic
978928007 4:114273900-114273922 TCCCCATGATGGAAGCATGAAGG + Intergenic
981635752 4:146877081-146877103 TTCACATGATAGGAGACTGCAGG + Intronic
982356243 4:154473004-154473026 TCACCAAGATGGGAGTGTCCAGG + Intronic
988811626 5:34791000-34791022 TCAGCATGATGGGAGGGTTCAGG + Intronic
992349098 5:75911211-75911233 TCCCAATGGTAGGAGAGGGCTGG - Intergenic
992625165 5:78630259-78630281 GCCCCATGCAGGGAGAGTGCCGG - Intronic
997194820 5:131971962-131971984 TGTCAATGATGGGAGAGTGACGG - Intronic
997446090 5:133941469-133941491 CACCCATGAGGGGAGAGTTCAGG - Intergenic
999134261 5:149307356-149307378 TCCCCAGGATGGCACAGTGATGG + Intronic
1001679986 5:173549424-173549446 TCCCCATGAAAGGAGAGTCAAGG - Intergenic
1002761820 6:208393-208415 TCCCCATGTTGTGTGAGAGCAGG - Intergenic
1003111505 6:3255288-3255310 TGCCCATCCTGGGAGAGTGGTGG + Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003724957 6:8750766-8750788 TCCCCATGATGGCAGATGGCTGG + Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1006907680 6:37544136-37544158 ACCCAATGATGGGAGACTGGAGG + Intergenic
1006911651 6:37567100-37567122 TAACCCTGATGGCAGAGTGCAGG - Intergenic
1007410820 6:41660302-41660324 TCCCCTTGGTGGGTGAGGGCAGG - Intergenic
1009850435 6:69190736-69190758 TCACCATGAAGGGAGCTTGCAGG - Intronic
1011556398 6:88574643-88574665 TCCCCATGACTGCAGAGGGCAGG + Intergenic
1013219721 6:108067461-108067483 TGTCCAAGATGGGAGAGAGCTGG - Intronic
1019062216 6:169264772-169264794 TCAGCATGGTGGGAGAGAGCAGG + Intergenic
1020139252 7:5603739-5603761 TCCCCAGGGTAGGACAGTGCGGG - Intronic
1029099523 7:98117116-98117138 TCCCCATGGTGTACGAGTGCAGG + Intronic
1031232495 7:119126596-119126618 TCACCATGATGGATGAGTCCTGG + Intergenic
1031567380 7:123317673-123317695 TCCCCATGATAGGGGATTGTAGG - Intergenic
1032352150 7:131174592-131174614 TCCACATGTTGGGAGAAGGCAGG + Intronic
1032547021 7:132752236-132752258 GCCCCATGATTGGAGAGGGAAGG - Intergenic
1032711116 7:134461090-134461112 TTCCCATGATGGGAGATTACTGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1035075988 7:156177913-156177935 TCCCCACTTTGGGAGAGGGCTGG + Intergenic
1035728317 8:1838434-1838456 TCCCCAGGCTGGGCGGGTGCCGG - Intronic
1035817639 8:2558051-2558073 TCCCCAAAATGGGAGAGAGAGGG + Intergenic
1036591487 8:10172688-10172710 TCCCCATCATGGGAGACTTTGGG - Intronic
1038003407 8:23409670-23409692 TTCCCATGAAGGGAGCTTGCAGG - Intronic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041410233 8:57545693-57545715 TGCCCATGATGGGAGAGGAAAGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1047752148 8:127889992-127890014 CCCTCCTGATGGGAGAGTGCTGG + Intergenic
1051231390 9:14958941-14958963 ACCCCATGAAGCCAGAGTGCAGG - Intergenic
1053642897 9:40105653-40105675 TCTCCATGAGGGCAGAGGGCAGG + Intergenic
1053763256 9:41359837-41359859 TCTCCATGAGGGCAGAGGGCAGG - Intergenic
1054541865 9:66271004-66271026 TCTCCATGAGGGCAGAGGGCAGG - Intergenic
1057250825 9:93500269-93500291 TCCCCATCATCTGAGACTGCTGG + Intronic
1057555402 9:96083804-96083826 TCCCCATCACGGGCGAATGCAGG + Intergenic
1061004428 9:127920577-127920599 CCCCCAGGATTGGACAGTGCAGG - Intergenic
1061777593 9:132975974-132975996 TCCCCTTGATGGGAGAGCAGTGG - Intronic
1185547986 X:961142-961164 TCCCCAAGTTGGGAGAGTTCAGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1196778117 X:119359698-119359720 TCCCCAGGATGGGAGGGTTCAGG - Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1199241479 X:145553110-145553132 TCCCCAAGATGGCAGATTGGAGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201146783 Y:11069081-11069103 TTCCCATGCTGGAAGAGTGCTGG - Intergenic
1202080172 Y:21075974-21075996 ACCCCATGAAGGGAGAATCCAGG - Intergenic
1202143400 Y:21752427-21752449 TCACCATGGTTGGAGAATGCTGG + Intergenic