ID: 925180709

View in Genome Browser
Species Human (GRCh38)
Location 2:1815338-1815360
Sequence GAGGGACCCCAGCGACAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925180709_925180716 1 Left 925180709 2:1815338-1815360 CCTCTCTGTCGCTGGGGTCCCTC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 925180716 2:1815362-1815384 CTGCTCCCACTCGTCATGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 67
925180709_925180717 2 Left 925180709 2:1815338-1815360 CCTCTCTGTCGCTGGGGTCCCTC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 925180717 2:1815363-1815385 TGCTCCCACTCGTCATGAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 52
925180709_925180715 0 Left 925180709 2:1815338-1815360 CCTCTCTGTCGCTGGGGTCCCTC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 925180715 2:1815361-1815383 CCTGCTCCCACTCGTCATGAGGG 0: 1
1: 0
2: 2
3: 7
4: 98
925180709_925180720 22 Left 925180709 2:1815338-1815360 CCTCTCTGTCGCTGGGGTCCCTC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 925180720 2:1815383-1815405 GGGTGCATTTGCTTCTTCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 158
925180709_925180713 -1 Left 925180709 2:1815338-1815360 CCTCTCTGTCGCTGGGGTCCCTC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 925180713 2:1815360-1815382 CCCTGCTCCCACTCGTCATGAGG 0: 1
1: 0
2: 1
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925180709 Original CRISPR GAGGGACCCCAGCGACAGAG AGG (reversed) Intronic
900242133 1:1622127-1622149 GAGGGACCCCTGAGACTGGGTGG - Intronic
900298731 1:1965942-1965964 GAAGGACCCCAGCGCCAGATGGG + Intronic
900623080 1:3596330-3596352 GAGAGACCCCAGCTACCCAGAGG + Intronic
900950626 1:5856450-5856472 GAGTGACCCCATCGACAGGGTGG - Intergenic
901324925 1:8360374-8360396 GAGGGCCTCCAGGGACAAAGGGG + Exonic
901510888 1:9717541-9717563 CAGGGACCACAGGGACACAGAGG - Exonic
902399052 1:16147730-16147752 GAGGAAACCCAGGCACAGAGAGG + Intronic
902869860 1:19307420-19307442 GAGGGACCCCGGGGACAGGGTGG + Intronic
903836113 1:26204199-26204221 GAGGGCCCCCAGAGAAAGATGGG - Intergenic
904795942 1:33056547-33056569 GAGTGATCCAAGAGACAGAGAGG - Intronic
905272549 1:36796391-36796413 GAGCGACCTCAGAGCCAGAGGGG - Exonic
905569466 1:38991884-38991906 GAGGGGCTTCAGCGACAGGGAGG - Intronic
906151326 1:43589314-43589336 GAGGGAACCGAGGCACAGAGAGG + Intronic
906714187 1:47954883-47954905 GATGGAGCACAGAGACAGAGAGG - Intronic
907372609 1:54013017-54013039 GAGGCAGCCCAGGGACTGAGAGG - Intronic
912321425 1:108717283-108717305 GAGTGACCGCAGCCACTGAGCGG + Intronic
912413714 1:109494372-109494394 GAGGGACCCCAGCAGTAAAGGGG + Intronic
914263336 1:146018145-146018167 GAGGAACCCCAGCATCTGAGGGG + Exonic
917468752 1:175307899-175307921 CTGGGACCCAAGGGACAGAGAGG - Intergenic
918514068 1:185343095-185343117 GACGGAGCCCAGGGACAGTGAGG + Intergenic
920964194 1:210688800-210688822 CAGGGACCACACCAACAGAGAGG + Intronic
921286235 1:213611910-213611932 GAGAAACCTCAGCAACAGAGGGG + Intergenic
922766832 1:228160372-228160394 GAGGGACACCACAGAGAGAGGGG - Intergenic
924554739 1:245108741-245108763 GAGGGACCCCAGAGACGCTGAGG - Intronic
1062764263 10:49012-49034 GGTGGACCCCAGGGACAGGGCGG - Intronic
1063569672 10:7203612-7203634 GAGGGACAACAAGGACAGAGGGG + Intronic
1066500510 10:35989133-35989155 GAGGGAACTGAGGGACAGAGAGG + Intergenic
1067776840 10:49170395-49170417 CAGGGGTCCCAGCCACAGAGAGG - Intronic
1069618388 10:69820759-69820781 GAGGGAACACAGTGACAGATGGG - Intronic
1069630528 10:69894672-69894694 TAGGGACCCCAGGGACAAAAAGG + Exonic
1069923002 10:71828803-71828825 GAGAGACCAAAGGGACAGAGAGG - Intronic
1070290260 10:75109173-75109195 GAGTGACCACAGAGGCAGAGGGG - Exonic
1070541421 10:77418036-77418058 GTGGGAACCCAGGGACATAGAGG - Intronic
1072762116 10:98065266-98065288 GAGGGAGCCCCGGCACAGAGAGG - Intergenic
1074116728 10:110461769-110461791 GAGGAAACCCAGCCACGGAGAGG - Intergenic
1075437611 10:122457239-122457261 GAGGGAATGCAGTGACAGAGAGG - Exonic
1076118321 10:127916679-127916701 GCTGGAGCCCAGGGACAGAGGGG + Intronic
1076477312 10:130761758-130761780 CAGGGACCCCAGAAAGAGAGGGG - Intergenic
1076705051 10:132296955-132296977 GAGGCAGCCCAGAGACAGGGAGG + Intronic
1076823952 10:132957971-132957993 GAGGGACCCCCACTTCAGAGTGG - Intergenic
1077205020 11:1337755-1337777 GAGGGACCCCAGGGCCTGGGGGG + Intergenic
1077439060 11:2559850-2559872 ATGGGACCCCAGAGACAGAGAGG - Intronic
1077490495 11:2858771-2858793 GAGGGACCCCTGAGTCAGCGAGG - Intergenic
1079327258 11:19504924-19504946 GAGGAACCTCAGGCACAGAGAGG + Intronic
1080807001 11:35662881-35662903 GAGGAAGCGCAGGGACAGAGCGG + Exonic
1084006473 11:66326084-66326106 CAGAGACTCCAGAGACAGAGAGG - Intergenic
1085080240 11:73627927-73627949 GAGAGACCACAGGGAGAGAGGGG - Intergenic
1086701134 11:89901265-89901287 GAGCGATCCCAGAGACAGACAGG + Intergenic
1086705033 11:89943262-89943284 GAGCGATCCCAGAGACAGACAGG - Intergenic
1088250722 11:107858858-107858880 GAGGGAGCGCAGGGCCAGAGCGG - Exonic
1089628897 11:119771160-119771182 GAGGACCCCCAGCTCCAGAGAGG - Intergenic
1089832252 11:121338866-121338888 GAGGGACAGCATCGTCAGAGAGG - Intergenic
1092526318 12:9312326-9312348 GAGTGACCCCAGTGTCACAGAGG + Intergenic
1092540954 12:9419464-9419486 GAGTGACCCCAGTGTCACAGAGG - Intergenic
1094512089 12:31103023-31103045 GAGTGACCCCAGTGTCACAGAGG + Intronic
1096147438 12:49288977-49288999 CAGGGTCCCCACTGACAGAGTGG - Intergenic
1099537191 12:83858613-83858635 GAGGCACCCCAGTGTCAGGGAGG - Intergenic
1100878575 12:98991051-98991073 GAGGGACCTCAGGAAGAGAGAGG + Intronic
1101409441 12:104456872-104456894 GAGGGACCCTAGCGCCGGGGCGG - Intronic
1103951464 12:124553900-124553922 GAGGGACACCAGCTGCGGAGTGG - Intronic
1104797494 12:131529705-131529727 GAGGACCCCCAGGGACAGTGAGG - Intergenic
1104940288 12:132391990-132392012 GAGGGTCCCCAGGGAGAGCGGGG - Intergenic
1106182322 13:27380387-27380409 GGGGGACCCTAGAGACAGTGGGG - Intergenic
1107882419 13:44844157-44844179 TGGGAAACCCAGCGACAGAGTGG + Intergenic
1113504168 13:110801727-110801749 GAAGGTCCCCAGCCAGAGAGGGG + Intergenic
1119425319 14:74531261-74531283 GAGTAACACCAGGGACAGAGAGG + Intronic
1121530655 14:94650330-94650352 GAGGAAACTCAGGGACAGAGAGG + Intergenic
1122186249 14:99999363-99999385 GAGGAACCTGAGGGACAGAGAGG - Intronic
1125502571 15:40248617-40248639 CAGGGAACTCAGTGACAGAGTGG + Intronic
1126545737 15:49871992-49872014 AAGTGATCCCAGCCACAGAGGGG + Intronic
1127470887 15:59289079-59289101 GAGGGACCTGAGGGCCAGAGAGG + Intronic
1129206185 15:74038268-74038290 GAGGGACCCCAGCAATATTGGGG + Intronic
1129503392 15:76060519-76060541 GAGGTGCCCCAGCGGCAGAATGG + Intronic
1130550858 15:84889165-84889187 GAGGTACCCCAGAGACTGAATGG - Intronic
1132690191 16:1178675-1178697 GAGGGACCCGAGGGACAGTGTGG - Intronic
1136924702 16:34361346-34361368 GAGGAACCCCAGGGATACAGAGG - Intergenic
1136979871 16:35050460-35050482 GAGGAACCCCAGGGATACAGAGG + Intergenic
1137405060 16:48182879-48182901 GAGGAATCCCAGGCACAGAGAGG - Intronic
1138054114 16:53814489-53814511 GAGGAAACCGAGGGACAGAGAGG + Intronic
1142165730 16:88586626-88586648 GAAGGACCCCAGTGACAGGAAGG + Exonic
1142396113 16:89832611-89832633 GAGGGTGCCCAGGGACAGTGAGG - Intronic
1142440387 16:90094227-90094249 GGTGGACCCCAGGGACAGGGCGG + Intergenic
1142567450 17:849862-849884 GAGAGACACCAGAGTCAGAGAGG + Intronic
1144872510 17:18379897-18379919 GAGGAACCTCAGGCACAGAGAGG + Intronic
1145826814 17:27883087-27883109 GAGGGCACCAAGCCACAGAGGGG + Exonic
1146298766 17:31672066-31672088 GAGGGACCCTAGGGAAATAGTGG - Intergenic
1147370891 17:39992298-39992320 GAGGGAGCGCAGGGAGAGAGAGG + Intronic
1148811770 17:50297578-50297600 GAGGGACTGCAGGGACACAGAGG + Intergenic
1148865047 17:50624027-50624049 GAGGGGCCCCTGGGACACAGGGG + Exonic
1151376402 17:73691724-73691746 CAGTGACCCCAGCGGCAGAAGGG + Intergenic
1151748743 17:76025129-76025151 GAGGAACCTCAGGCACAGAGAGG - Intronic
1152099244 17:78291548-78291570 GAGGGTCCCTGGAGACAGAGCGG + Intergenic
1152118822 17:78405680-78405702 GGGGGTCCCCAGCGTCAGAAAGG - Intronic
1152651978 17:81499088-81499110 GCGGTGCCGCAGCGACAGAGGGG + Intergenic
1152957175 18:49331-49353 GGTGGACCCCAGGGACAGGGCGG - Intronic
1154356743 18:13627414-13627436 AAGGGTCCCCAGCGAGAGACAGG - Intronic
1155497219 18:26454496-26454518 GAGGGGCCCAAGCCACATAGAGG + Intergenic
1157190391 18:45576656-45576678 GAGAGACCACAGAGACAGGGAGG - Intronic
1158401524 18:57125780-57125802 GAGGAACCCCAGGTAGAGAGAGG + Intergenic
1160739200 19:678101-678123 GGGGGATCCCAGCCTCAGAGAGG + Intronic
1161021988 19:2015057-2015079 CAGGGGTCCCAGGGACAGAGGGG + Intronic
1161206272 19:3042613-3042635 CAGAGACCCCCGAGACAGAGGGG + Intronic
1161263017 19:3347987-3348009 GAGGGGCCCCAGGCACAGTGGGG + Intergenic
1162745252 19:12794100-12794122 GAGGGAGCCCAGCGCGAGGGCGG - Intronic
1163274798 19:16276823-16276845 GAGGGAGCCCTGAGACAGAATGG - Intergenic
1163561345 19:18021227-18021249 CCTGGAGCCCAGCGACAGAGAGG - Intergenic
1163790593 19:19303914-19303936 TATGGACCACAACGACAGAGGGG + Intronic
1165829400 19:38723086-38723108 GAGGGAACCGAGGCACAGAGAGG + Intronic
1165937105 19:39395999-39396021 GGGGGAGGCCAGCGACAGTGTGG + Intronic
1167486910 19:49767908-49767930 GAGGGACCCAAGGAACACAGAGG + Intronic
925180709 2:1815338-1815360 GAGGGACCCCAGCGACAGAGAGG - Intronic
926330689 2:11822807-11822829 GAGGGACTCCAGCATCTGAGAGG + Intronic
926700352 2:15799389-15799411 GAGGGACCACAGGGTCAGAGAGG - Intergenic
928118219 2:28563354-28563376 GAGGGACCCCAGAGGGAGTGTGG + Intronic
929061656 2:37930756-37930778 GGTGGACTCCAGAGACAGAGGGG + Intronic
930109281 2:47664877-47664899 GAGGAACCCGAGGCACAGAGAGG + Intergenic
931484223 2:62673902-62673924 GAGAGACTCCAGCGAGAGACTGG + Intronic
936373536 2:111922194-111922216 GAGGGACTCCAGGGCCAGGGAGG + Intronic
938230599 2:129655323-129655345 GAGTGACCCCAGAGACATTGTGG + Intergenic
947588366 2:231370662-231370684 GAGAGGCCCCAGGGAGAGAGTGG - Intronic
948062624 2:235052783-235052805 CACGGAACCCAGGGACAGAGGGG - Intronic
948655439 2:239473972-239473994 GAGTGACCACAGAGACAGAAAGG - Intergenic
1168826866 20:819835-819857 GAGGGGACACAGCTACAGAGGGG + Intergenic
1171394077 20:24819764-24819786 GAGGAAGCCCAGCCACACAGAGG + Intergenic
1172778378 20:37421339-37421361 GAAGGCGCCCAGAGACAGAGGGG - Intergenic
1173887260 20:46470541-46470563 GAGGAACGCGAGGGACAGAGTGG + Intergenic
1174292385 20:49518267-49518289 GAGGGACACCAGCGATGGAGAGG + Intronic
1175263152 20:57687357-57687379 GAGGGACCCCAAGGCCAGAGGGG + Intronic
1175394569 20:58649966-58649988 CAGGGACCCCAGCCAGACAGCGG - Intergenic
1175696844 20:61109044-61109066 CAGGGACCCCAGCGAATGTGGGG - Intergenic
1179896285 21:44365502-44365524 CCGTGACCACAGCGACAGAGGGG - Intronic
1180072816 21:45445155-45445177 GACGGAACCCAGGGACAGAAAGG - Intronic
1180174899 21:46082698-46082720 GTGGCACCCCAGGGACACAGAGG - Intergenic
1183741087 22:39669034-39669056 GAGGGACCCCTGCTACTCAGGGG - Intronic
1184468328 22:44681893-44681915 GAGGAAGCCCAGCCACAGGGAGG + Intronic
950440542 3:13007826-13007848 GTGGGGCCCCAGAGACAGGGAGG - Intronic
953391954 3:42539120-42539142 GAGGGAAACCAGAGAGAGAGAGG - Intergenic
953530475 3:43735820-43735842 GAGGGGCCCCATGGGCAGAGAGG + Intergenic
954808901 3:53235973-53235995 GAGGGACGGCAGCAACAGACAGG + Intronic
960157070 3:114306971-114306993 GAGGGAGTCCAGAGACAGTGAGG + Intronic
961463643 3:127068605-127068627 GAGGGACCCCAGCTGCCGTGGGG + Intergenic
962403465 3:135080738-135080760 GCAGGACCCAAGCTACAGAGAGG - Intronic
966207920 3:177423640-177423662 CAAGGACCCCAGCCTCAGAGGGG - Intergenic
966815940 3:183889932-183889954 GAGGGAGCTCAGAAACAGAGAGG + Intergenic
969229801 4:5822032-5822054 GGGGGAGCCCAGGGACTGAGGGG - Intronic
970602022 4:17648042-17648064 GAGGGACCTGAGCATCAGAGAGG + Intronic
975119936 4:70717294-70717316 GAGGGAACTCAGAGACAGAGTGG + Intronic
979328284 4:119403631-119403653 GAGGGACCACAATGACTGAGGGG - Intergenic
985441445 4:189984645-189984667 GGTGGACCCCAGGGACAGGGCGG - Intergenic
991603983 5:68381916-68381938 GAGTGCCCCCAAAGACAGAGAGG + Intergenic
993272041 5:85809031-85809053 GAGGGGTCCCACCGACAGACAGG - Intergenic
997359868 5:133288313-133288335 GGGGGACCCCCGGGACAGAGGGG - Intronic
998149128 5:139747040-139747062 GAGGAACCTCAGAGCCAGAGAGG - Intergenic
1001636721 5:173215421-173215443 GAGGAAACCCAGGCACAGAGAGG + Intergenic
1002969008 6:1995245-1995267 GGAGGACCACAGTGACAGAGAGG + Intronic
1003015294 6:2462917-2462939 CAGGTACCCTAGGGACAGAGGGG + Intergenic
1005959977 6:30687439-30687461 GAGGGCCCCTGGGGACAGAGCGG - Exonic
1005989561 6:30894544-30894566 TAGTGTCCCCAGGGACAGAGAGG - Exonic
1006717239 6:36128388-36128410 GAGGAACCCGAGGTACAGAGAGG - Intronic
1011643014 6:89433043-89433065 CAGGGACCCTCGCGAGAGAGAGG - Intergenic
1013209552 6:107974381-107974403 GAGGGCCCCAAGCCCCAGAGTGG - Intergenic
1016872157 6:148829098-148829120 GAGGGTACCCAGGGACAAAGTGG + Intronic
1019156060 6:170039671-170039693 GAGGGACAGCAGGGACACAGTGG - Intergenic
1019156113 6:170039880-170039902 GAGGGACAGCAGGGACACAGAGG - Intergenic
1019215802 6:170443172-170443194 CAGGGACCCCATTGTCAGAGTGG + Intergenic
1019742205 7:2680529-2680551 CAGCAACCCCAGCCACAGAGGGG - Intronic
1021692371 7:23243055-23243077 GAGGGCTGCCAGAGACAGAGGGG + Intronic
1023876865 7:44291190-44291212 GCGGAACCCCAGGGCCAGAGAGG - Intronic
1024290623 7:47801090-47801112 GAGGGAGACCAGCCACAGTGTGG - Intronic
1024615110 7:51105383-51105405 GAGGGAACCAAGGCACAGAGAGG - Intronic
1028845301 7:95473368-95473390 GAAGGACCCAAGGCACAGAGAGG + Intergenic
1029169481 7:98620625-98620647 GAGGCCACCCAGCAACAGAGGGG - Intronic
1029711682 7:102303403-102303425 GAGAGCACCCAGGGACAGAGTGG - Intronic
1034451234 7:151138346-151138368 CTGGGGCCCCAGTGACAGAGAGG + Intronic
1035727902 8:1835835-1835857 GAGGGAGCCCAGAGACACCGAGG - Intronic
1035750333 8:1991721-1991743 GAGGGAACCCAGTGATGGAGTGG + Intronic
1037834436 8:22207745-22207767 GAGGGAACTCAGGGACAGAGAGG + Intronic
1037968799 8:23156453-23156475 GAGGGACCCCAGCTCTAGAAGGG - Intronic
1038782025 8:30576104-30576126 GTGGGACCCAGGGGACAGAGTGG - Intergenic
1044763787 8:95549946-95549968 GAGTGACCCCTGCTCCAGAGAGG - Intergenic
1046016790 8:108615181-108615203 GAGGGACGGAAGCTACAGAGAGG + Intronic
1048856232 8:138688932-138688954 GAGGCACCCCAGGGAAAGATGGG - Exonic
1049280408 8:141741283-141741305 GGGGGACCCCAGCCACAGGGAGG - Intergenic
1049576785 8:143393366-143393388 GAGGGTCCCCAGCAACAGAGAGG - Intergenic
1050412990 9:5385672-5385694 GAGGAACCCCCAAGACAGAGAGG + Intronic
1053281832 9:36825488-36825510 CAGGGACCCCAGGGACAAAGAGG - Intergenic
1056104640 9:83334862-83334884 GAGGGAACCGAGGCACAGAGAGG - Intronic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1060238381 9:121882685-121882707 GAGGCATCCCAGACACAGAGAGG - Intronic
1060736182 9:126067794-126067816 GATGGACCCCAGGGACAAACAGG + Intergenic
1061865926 9:133491747-133491769 GTGGGACCCCAGGAGCAGAGCGG - Intergenic
1062016087 9:134292067-134292089 GAGGAACCCCAGGCCCAGAGTGG - Intergenic
1062043412 9:134414488-134414510 GAGGGAGCCGAGGCACAGAGAGG + Intronic
1062162268 9:135087162-135087184 GAGGGCCTCCAGCGCCAGGGGGG - Intronic
1062740975 9:138175247-138175269 GGTGGACCCCAGGGACAGGGCGG + Intergenic
1203787470 EBV:135975-135997 GAGGGAGGCCAGTGACAGTGAGG - Intergenic
1187412590 X:19063860-19063882 GAGGGTCCCCAGAAGCAGAGTGG + Intronic
1189175992 X:38957751-38957773 GAGGTACCCCACTCACAGAGAGG + Intergenic
1198395093 X:136212362-136212384 GTGGGGCCCCAGGGACAGTGAGG + Intergenic
1198531378 X:137551732-137551754 GAGGCACCCCAGCCACATGGTGG - Intergenic