ID: 925180741

View in Genome Browser
Species Human (GRCh38)
Location 2:1815493-1815515
Sequence TCTAGGGCCCGTGGTTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925180741_925180748 9 Left 925180741 2:1815493-1815515 CCTGGGAAACCACGGGCCCTAGA 0: 1
1: 1
2: 0
3: 5
4: 93
Right 925180748 2:1815525-1815547 GTTGCGTGAATAAAATAGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 101
925180741_925180747 5 Left 925180741 2:1815493-1815515 CCTGGGAAACCACGGGCCCTAGA 0: 1
1: 1
2: 0
3: 5
4: 93
Right 925180747 2:1815521-1815543 GTCTGTTGCGTGAATAAAATAGG 0: 1
1: 0
2: 3
3: 13
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925180741 Original CRISPR TCTAGGGCCCGTGGTTTCCC AGG (reversed) Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
905651757 1:39661467-39661489 TCTAGGGCCCTTGCCTTGCCAGG + Intronic
907429096 1:54400907-54400929 CCAAGGACCCATGGTTTCCCAGG + Intronic
910241598 1:85092608-85092630 TCTAGGGACCTTGGTTTGACAGG - Intronic
915670167 1:157482404-157482426 CCTAGGGCTCCTTGTTTCCCAGG - Intergenic
917423756 1:174892107-174892129 CCTGGAGCCCGTGGCTTCCCTGG + Intronic
923518004 1:234713656-234713678 TCTGGGGCCTGTCGTTTGCCTGG + Intergenic
1063029515 10:2219181-2219203 TCATGGGCTCGTGATTTCCCAGG - Intergenic
1064331964 10:14402428-14402450 TCGAGAGCCTGTGGTGTCCCTGG - Intronic
1066531154 10:36340848-36340870 TCTCTGGCCCCTCGTTTCCCAGG - Intergenic
1066726657 10:38402518-38402540 GCCAGGGCCCGTGGATCCCCGGG - Intergenic
1068045138 10:51876847-51876869 TCTAGGGCCTGGGTTTTACCTGG + Intronic
1069703400 10:70441892-70441914 TCTAGGGCTCCTGGTTTGCCCGG + Intronic
1072805422 10:98420973-98420995 GCTAAGGCACGTGGTTTCTCAGG - Intronic
1074872875 10:117590857-117590879 TCTTGGACCAGTGGTTTGCCAGG - Intergenic
1075062325 10:119265782-119265804 TGCAGGGCCCAGGGTTTCCCTGG - Intronic
1076079472 10:127565786-127565808 TCTTGGCCCTGTGGTTTCTCTGG + Intergenic
1077406641 11:2385358-2385380 GCGACGGCCCGTGGTTGCCCTGG - Intronic
1077905612 11:6530566-6530588 TGTTGGACCCGTGGCTTCCCAGG + Intronic
1078083835 11:8221991-8222013 TCTGGGGCCCGTGGCTGACCTGG + Intergenic
1081641938 11:44761920-44761942 TCCAGGGCCCTTGGCTTACCAGG + Intronic
1081703521 11:45166526-45166548 TCCAGGCCCCCTGGTGTCCCTGG - Intronic
1090081647 11:123617567-123617589 TGTAGGGCCTGTGGTGTGCCGGG + Intronic
1090669973 11:128939251-128939273 TCCAGGGCCTGTGGTCTCCTGGG - Intronic
1091174267 11:133545708-133545730 TCAAGAGCCCTTGGTTTCCGTGG + Intergenic
1091340491 11:134808860-134808882 TCTAGACCCCTCGGTTTCCCGGG - Intergenic
1091504570 12:1054281-1054303 TCTAAGGCCAGTGCTTTCCCAGG + Intronic
1092524292 12:9300248-9300270 GCCAGGCCCCATGGTTTCCCAGG + Intergenic
1093946031 12:25110524-25110546 TCCAGGCCCCATGGTTTCCATGG + Intronic
1098024188 12:66185482-66185504 TCAAGGGCACATGCTTTCCCTGG - Intergenic
1101986181 12:109449103-109449125 TCTTGGGCCAGTGTTTTACCTGG + Exonic
1102785598 12:115601758-115601780 TCTAGGCACTGTGGTTTCACTGG - Intergenic
1102793330 12:115666739-115666761 TCAAGGGACTGTCGTTTCCCAGG + Intergenic
1104978417 12:132562248-132562270 TCCAGGCCCCCTGGCTTCCCAGG + Intronic
1108478465 13:50843516-50843538 TCTGGGTCCCGCGGGTTCCCGGG + Exonic
1117227448 14:53677348-53677370 TCTAGCTCCCTTGGTCTCCCTGG + Intergenic
1117404185 14:55385747-55385769 TCTAGGGTCATTGGTTTTCCTGG - Intronic
1127661829 15:61106770-61106792 TCAAGGGCCCTTGGCCTCCCAGG - Intronic
1128127754 15:65205417-65205439 TCTGGAGCCCATGGTCTCCCTGG - Exonic
1128710075 15:69865242-69865264 GCTAGGGCCCAAGGTTTCACAGG - Intergenic
1129725070 15:77897545-77897567 ACTGGGGCCCGAGGTTTTCCAGG + Intergenic
1130650016 15:85757122-85757144 TCTTGGGACCGAGGTTTCCAGGG + Intergenic
1132746270 16:1437653-1437675 TCTGGGGCTCGGGGTCTCCCAGG + Intronic
1132892636 16:2211783-2211805 TCCAGGGCCCTTTGCTTCCCTGG + Exonic
1133450213 16:5897612-5897634 TTGAGGGGCCTTGGTTTCCCAGG - Intergenic
1143464067 17:7123894-7123916 TCTTGGACCAGTGGTTTGCCAGG + Intergenic
1150673295 17:67221396-67221418 TCTAGGGCCTCTGGTATCCATGG - Intronic
1151808259 17:76420279-76420301 TCCAAGGCCAGTTGTTTCCCCGG + Intronic
1156916709 18:42470485-42470507 TTTAAGGCCAGTGGTCTCCCTGG - Intergenic
1158876938 18:61742992-61743014 TCCAGGGCCCTTCCTTTCCCTGG - Intergenic
1161991896 19:7689037-7689059 TCTATGGCCCCTGCCTTCCCAGG - Exonic
1162719133 19:12651681-12651703 GCTAGGAACAGTGGTTTCCCAGG - Intronic
1162898839 19:13781867-13781889 TCTAGGGAACCTGGTTTCTCTGG + Intergenic
1163787014 19:19279943-19279965 CCAAGGGCCAGTGGTCTCCCAGG + Intronic
1166278691 19:41774851-41774873 TCTAGGCCTCATGTTTTCCCAGG - Intergenic
925180741 2:1815493-1815515 TCTAGGGCCCGTGGTTTCCCAGG - Intronic
926220332 2:10931961-10931983 TCTGAGACCTGTGGTTTCCCTGG + Intergenic
936676149 2:114717227-114717249 TCTATGGCCTTTGTTTTCCCTGG - Intronic
939730704 2:145781442-145781464 TCTAATGGCCTTGGTTTCCCTGG + Intergenic
940883194 2:158967997-158968019 TCTGGGGCCGGTGATTTCCCGGG - Intergenic
940995213 2:160142291-160142313 TCTAGGGTCTGTGGTTGCCATGG + Intronic
944769797 2:202902628-202902650 TCTTGGACCAGTGGTTTGCCAGG + Intronic
1173142823 20:40499163-40499185 TCTGGGGCTTGTGGTCTCCCTGG - Intergenic
1182413164 22:30204222-30204244 TCTGGGGCCCGTGGGTGACCTGG - Intergenic
1183365339 22:37403815-37403837 TCTGGGGCCTGTGGTCTCCTCGG - Intronic
1184469910 22:44690534-44690556 TTTAGAGCCTGTGGTTACCCAGG + Intronic
950549706 3:13658805-13658827 TCTAGGGCAGGTGGTTTCTCAGG + Intergenic
960837964 3:121926769-121926791 TTGAGTGCCCGTGGTTTTCCAGG - Intronic
968656527 4:1780707-1780729 TCTAGGGCCCATGGAAACCCGGG - Intergenic
969425497 4:7121732-7121754 TCCAGAGGCTGTGGTTTCCCTGG - Intergenic
969675810 4:8613793-8613815 GCCTGGGCCCGTGGTCTCCCTGG + Intronic
986736903 5:10674728-10674750 TCTAGAGCCTGTGCTTGCCCCGG + Intergenic
991239965 5:64446315-64446337 CCTATGGCCTGTGGATTCCCAGG - Intergenic
994372854 5:98986926-98986948 TCTAGGGCACGTGTTTTCTATGG - Intergenic
1000021140 5:157320564-157320586 TCTAGGGCCCGTGGTGTCCCAGG - Intronic
1001021629 5:168187809-168187831 TCTAGGGTCTGAGGTTTGCCAGG + Intronic
1001136082 5:169103859-169103881 TCAAGGGCTCGTTCTTTCCCTGG - Intronic
1001431315 5:171664894-171664916 TCTAAGCCAAGTGGTTTCCCTGG + Intergenic
1003157019 6:3605377-3605399 TGTAGGGCCTCTGCTTTCCCAGG - Intergenic
1003303612 6:4907187-4907209 TGTAGGGCCAGTGGGTTACCAGG + Intronic
1006058692 6:31403988-31404010 TCTGAGGCCCATGGGTTCCCGGG + Intronic
1006071178 6:31498885-31498907 TCTGAGGCCCCTGGGTTCCCGGG + Intronic
1013694657 6:112688757-112688779 TCTGGGGCTCGTGGTCTCACTGG + Intergenic
1023500917 7:40848412-40848434 TCTATGGCTCGTGTTTTTCCTGG + Intronic
1024250485 7:47502435-47502457 TCTAGGTCCCGTGTTTTCCATGG + Intronic
1032474673 7:132203808-132203830 CCTAGGGACCAGGGTTTCCCTGG - Intronic
1033147764 7:138885637-138885659 TCTTGGGCTCGTGCTTTCTCAGG + Intronic
1037105317 8:15099490-15099512 TCAAGGGCCAGTAGTTTCACTGG + Intronic
1057333877 9:94141362-94141384 TCCAAGTCCCATGGTTTCCCTGG + Intergenic
1057713708 9:97470357-97470379 ACTAGGACCCCTGGTTTCCTTGG + Intronic
1060770052 9:126326474-126326496 TCTAGAGGCCGTGGGCTCCCGGG + Intergenic
1061491943 9:130949831-130949853 TCTGGGACCAGTGGCTTCCCAGG - Intergenic
1192772292 X:74205591-74205613 GCTAGGTCCCCTGGTTTCCTTGG + Intergenic
1195101689 X:101561130-101561152 TCTAGTTTCCTTGGTTTCCCAGG - Intergenic
1201789788 Y:17826953-17826975 AATAGGGCCCTTGGTTTCTCAGG - Intergenic
1201811766 Y:18079036-18079058 AATAGGGCCCTTGGTTTCTCAGG + Intergenic
1202351436 Y:23996700-23996722 AATAGGGCCCTTGGTTTCTCGGG - Intergenic
1202369746 Y:24188602-24188624 TCTGGGGCCTGAGGTTTTCCAGG - Intergenic
1202501039 Y:25481515-25481537 TCTGGGGCCTGAGGTTTTCCAGG + Intergenic
1202519343 Y:25673419-25673441 AATAGGGCCCTTGGTTTCTCGGG + Intergenic