ID: 925182703

View in Genome Browser
Species Human (GRCh38)
Location 2:1827300-1827322
Sequence TGTGATCTGCAGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925182703_925182712 26 Left 925182703 2:1827300-1827322 CCTTCCACCTCCTGCAGATCACA 0: 1
1: 0
2: 1
3: 42
4: 345
Right 925182712 2:1827349-1827371 TCTTCCTGTGTTATAAAACAAGG 0: 1
1: 0
2: 4
3: 33
4: 311
925182703_925182709 -4 Left 925182703 2:1827300-1827322 CCTTCCACCTCCTGCAGATCACA 0: 1
1: 0
2: 1
3: 42
4: 345
Right 925182709 2:1827319-1827341 CACAGAGGGACCCAGAGCTCAGG 0: 1
1: 0
2: 3
3: 39
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925182703 Original CRISPR TGTGATCTGCAGGAGGTGGA AGG (reversed) Intronic
900745924 1:4360734-4360756 TGTGGCTTGCAGGAGGTGCATGG - Intergenic
900814003 1:4829338-4829360 TCTGCTCTGGAGGAGGTGGGAGG - Intergenic
900934438 1:5756247-5756269 TGGGTTCTGCAGGCGGAGGAAGG - Intergenic
901216024 1:7555841-7555863 TGTGAGATGCAGGACGTGGTTGG - Intronic
902630207 1:17700375-17700397 TGTGCTCTGGAGAAGGGGGATGG + Intergenic
902844722 1:19100888-19100910 TGAGACCAGCAGGAGGAGGAAGG - Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904319142 1:29685185-29685207 TCTGATCAGCAGGAGGTGGGGGG + Intergenic
904678986 1:32215785-32215807 TGCCCTCTGCAGGAGGTGGAAGG - Exonic
906117509 1:43366413-43366435 TGTACTGTGCAGGGGGTGGAGGG + Intronic
907455481 1:54572656-54572678 TGTGGTCTGCTGGAGGTAGAGGG + Intronic
910216313 1:84848159-84848181 TGAGCTCTGCAGTGGGTGGAAGG - Intronic
913017761 1:114757049-114757071 TGAGAACTACAGGAGGTGGAAGG + Intronic
913199338 1:116483533-116483555 TTTGATCTGGAGGATGTGAAGGG - Intergenic
913320980 1:117588235-117588257 AGTGTTGAGCAGGAGGTGGATGG - Intergenic
913343434 1:117783158-117783180 TGTCATTTGCAGGAGTGGGAAGG + Intergenic
913608755 1:120490528-120490550 AGTGATCTATGGGAGGTGGAGGG + Intergenic
913609144 1:120493473-120493495 TGGGTTCTGCAGGTGGAGGAAGG - Intergenic
913986674 1:143572151-143572173 AGTGATCTATGGGAGGTGGAGGG - Intergenic
914204685 1:145516976-145516998 TGGGTTCTGCAGGTGGAGGAAGG + Intergenic
914205080 1:145519926-145519948 AGTGATCTATGGGAGGTGGAGGG - Intergenic
914358352 1:146908278-146908300 TGAGATCTGCTGGAGGTTCAGGG + Intergenic
914370502 1:147020305-147020327 AGTGATCTGTGGGAGGTGGAGGG + Intergenic
914370875 1:147023250-147023272 TGGGTTCTGCAGGTGGAGGAAGG - Intergenic
914483808 1:148090163-148090185 TGGGTTCTGCAGGTGGAGGAAGG + Intergenic
914484192 1:148093105-148093127 AGTGATCTGTGGGAGGTGGAGGG - Intergenic
914495073 1:148188729-148188751 TGAGATCTGCTGGAGGTTCAGGG - Intergenic
914582048 1:149028366-149028388 TGGGTTCTGCAGGTGGAGGAAGG + Intronic
914582440 1:149031310-149031332 AGTGATCTATGGGAGGTGGAGGG - Intronic
914690135 1:150018424-150018446 TGTGATCTGCAGCCCGGGGAAGG - Intergenic
914802448 1:150971521-150971543 TGTGATTTGGGGGAGGAGGAGGG - Intronic
915579010 1:156802224-156802246 AGTGAACTGAAGGAGGTGGGAGG - Intergenic
916055447 1:161066209-161066231 TGTGGTGTGCAGGAGGATGAAGG - Intronic
916266375 1:162893545-162893567 TGTGAAATGCAGGAAGGGGAAGG - Intergenic
917046580 1:170867219-170867241 TTTGATCTTCAAGAGGTGGGGGG - Intergenic
918748061 1:188231763-188231785 TGTTATCTGCAGATGCTGGAAGG - Intergenic
919988302 1:202691183-202691205 TGTGTTCGGCAGGTTGTGGAGGG + Intronic
920245829 1:204586696-204586718 GGTGTCCTTCAGGAGGTGGAAGG - Intergenic
921307709 1:213813669-213813691 TGTGTTCTTCAGGAGAAGGAGGG + Intergenic
923083245 1:230680420-230680442 TGGGAGCTCCAGGAGGTGCAGGG - Intronic
924552314 1:245090109-245090131 TGTCATGTGCGTGAGGTGGAAGG + Intronic
924691541 1:246356094-246356116 TGTGATCTGATGGAGGTAGCAGG - Intronic
1062967743 10:1623048-1623070 TGTGCTGAGCAGGAGTTGGAAGG + Intronic
1063352034 10:5364924-5364946 TGTCGTCTGCATGACGTGGACGG + Intergenic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1063484151 10:6403413-6403435 TGGGCTCTGCAGGTGTTGGATGG - Intergenic
1063555103 10:7071174-7071196 TGTGATCTGCAGGTGTTGATGGG - Intergenic
1065589994 10:27253734-27253756 TCTGATCAGCAGGAGGAGGCGGG + Intergenic
1067084111 10:43229245-43229267 TGTGAGGTGCAGGCGGGGGAGGG - Intronic
1067434818 10:46269456-46269478 TGTCATCTGCAGGAGAAGCAAGG + Intergenic
1067507798 10:46871496-46871518 TGGGATCTGGAGTAGGTGTATGG + Intergenic
1067654453 10:48180349-48180371 TGGGATCTGGAGTAGGTGTATGG - Intronic
1069603453 10:69724633-69724655 TGGGATCTGTAGGAAGGGGAAGG - Intergenic
1069786484 10:70991334-70991356 TCTGATCTCCAGGAGGCGGAGGG + Intergenic
1070058015 10:72953953-72953975 TGTGAACTGCAGCAGGGGGAAGG + Intronic
1070119546 10:73562396-73562418 TGTGTTCTGTAGAAGGTGGAGGG - Intronic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1072617523 10:97059598-97059620 TGTGACATCTAGGAGGTGGAGGG - Intronic
1075783968 10:125035780-125035802 TGTGAACTGCACCAGCTGGAGGG - Intronic
1075823741 10:125335974-125335996 TGTCATCTGCTGTATGTGGAAGG + Intergenic
1075934870 10:126331758-126331780 TGTGGTCTTCAGGGTGTGGATGG + Intronic
1076485910 10:130816844-130816866 TGGGAACTGCAGCAGGTGGAGGG - Intergenic
1077216430 11:1397066-1397088 TGTGCTCTGCAGGAAGTTAACGG + Intronic
1077418026 11:2434735-2434757 TGTGGTGTGCAGGTGCTGGAAGG + Intergenic
1078142997 11:8705141-8705163 TTTGAGCTGCAGGAGCAGGAGGG - Intronic
1078242160 11:9539554-9539576 TGTTATTTGCTTGAGGTGGAGGG - Intergenic
1078526014 11:12102070-12102092 CGTGAGCTGCAGGAGCTGGAAGG + Intronic
1079361201 11:19771898-19771920 TGGGGTCTGCAGGGGGTTGAAGG - Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1081853638 11:46290607-46290629 TGGGGTCTGCAGGAGGGGAAGGG + Intronic
1083745409 11:64733448-64733470 TGGGGCCTGCAGGAGGTGGAGGG + Intronic
1084436130 11:69141546-69141568 TTTGATCTGCAGGACCTGGCAGG + Intergenic
1084548445 11:69826119-69826141 TGAGCTCTGGAGCAGGTGGACGG + Intergenic
1084741318 11:71141122-71141144 TGTAACCTGCAGGTGGAGGAAGG - Intronic
1085624420 11:78061165-78061187 TGTGTACTGCAAGTGGTGGAGGG - Intronic
1088662584 11:112062443-112062465 TGTGATCACCGGGTGGTGGATGG + Exonic
1089032104 11:115342395-115342417 TGTGTCCTGAAGGAGATGGAAGG + Intronic
1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG + Intronic
1089806296 11:121093797-121093819 TCTGATCAGCAGGAGGAGGCAGG - Intergenic
1089972295 11:122703905-122703927 TGTGACCTGCAGGCACTGGAGGG + Intronic
1090084415 11:123638799-123638821 TTTGAGCTGCCGGTGGTGGAGGG + Intronic
1092257254 12:6934159-6934181 TGACATCTACAGGAGGAGGAAGG - Exonic
1094417867 12:30236321-30236343 AGTGTTCTGTTGGAGGTGGATGG + Intergenic
1095240702 12:39855548-39855570 TGTGAGCTCCATGAGGAGGAAGG + Intronic
1096693611 12:53335543-53335565 TGTGAGTTGGAGGAGGTGGGTGG + Intronic
1098213304 12:68188525-68188547 TGTGGTTAGCAGGAGGTTGAGGG + Intergenic
1098856456 12:75658083-75658105 TGTGTTCTTCAAGAGATGGAGGG - Intergenic
1100700771 12:97145448-97145470 TTTAGTCTGCATGAGGTGGAGGG - Intergenic
1101081478 12:101189802-101189824 TGTGATGTGAAGGTGGAGGATGG - Intronic
1101592337 12:106136017-106136039 TGTGCTCAGCAGGGGGAGGACGG + Intronic
1101794508 12:107960489-107960511 TGTGAACTGGAGCAGATGGAAGG - Intergenic
1101957337 12:109222929-109222951 TGTGCTCTGCAGATGGTGAAAGG - Intronic
1102539485 12:113608345-113608367 TGAGACCTGAAGGAGGTGCAGGG - Intergenic
1102589240 12:113945234-113945256 TGTGATATGGAGGAGCTGGATGG + Intronic
1103274156 12:119697653-119697675 GGTTACCTGCGGGAGGTGGACGG + Exonic
1104788233 12:131465305-131465327 TGAGAGGTGGAGGAGGTGGAAGG - Intergenic
1107091338 13:36484226-36484248 TGTATTCTGCAGGTGTTGGATGG + Intergenic
1108253393 13:48588780-48588802 TGTGTTCTACAGAAGGTGGCTGG - Intergenic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1113010333 13:105757907-105757929 TGGGATCTGCATTAGGAGGAAGG - Intergenic
1113367893 13:109693707-109693729 TGTGAACGGAAGGAGCTGGATGG + Intergenic
1114339613 14:21729480-21729502 TGTGATATGCAAGAGTTGGTGGG + Intergenic
1117344250 14:54817401-54817423 TGTGCTCTGCTGGAACTGGACGG - Intergenic
1117555241 14:56877035-56877057 TGGGAGATGCAGGGGGTGGAAGG + Intergenic
1117677231 14:58167155-58167177 TGTGAGGTGCAGGTGGTGGGTGG - Intronic
1118778093 14:68986459-68986481 TGTGTTGTGGGGGAGGTGGAGGG - Intergenic
1119712370 14:76831399-76831421 TGAAACCTGGAGGAGGTGGAGGG + Intronic
1121333284 14:93061357-93061379 TGGGCTCTGGAGGAGGTGGGTGG - Intronic
1122160228 14:99778527-99778549 AGGAATCTGCAGGAAGTGGATGG - Intronic
1122628498 14:103096873-103096895 TGTGATCAGGTGAAGGTGGATGG + Intergenic
1122628759 14:103097889-103097911 TGTCATCAGCGGGAGGTGGGGGG + Intergenic
1123172822 14:106390465-106390487 GGTGACCTGCAGGATGTGTAAGG - Intergenic
1124686652 15:31788666-31788688 TGGCAGCTGCAGGAGGTGGAAGG + Intronic
1124879671 15:33630302-33630324 TGTGAACTGCAGGAGGTACTTGG - Intronic
1125482653 15:40091157-40091179 TGAGGTCTGCTGGAGGTGGCAGG + Exonic
1125730569 15:41890606-41890628 TGGGATCTTCAGGGGGTGGCTGG + Intronic
1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG + Intronic
1127299385 15:57637950-57637972 CATGATCTGCAGGATGTGGCTGG - Intronic
1127371228 15:58343714-58343736 TGTGATATGGGGTAGGTGGAAGG + Intronic
1127843031 15:62846880-62846902 TGTGCTCTGCTTGGGGTGGAAGG - Intergenic
1128091985 15:64925491-64925513 TGTGGTCTGCAGGGAGTAGAGGG - Intronic
1128695883 15:69762511-69762533 TGTGATCTGCAGGAGGCAAGAGG + Intergenic
1131668659 15:94596636-94596658 GTTGAACTGGAGGAGGTGGAGGG - Intergenic
1133031470 16:3013258-3013280 TGTGTCCAGCAGGAGGGGGAAGG - Exonic
1133384117 16:5354961-5354983 TGTGATCAGCAGAGGTTGGAAGG + Intergenic
1133627132 16:7581244-7581266 TCTGTTCTGCAGGAGTTGGAAGG - Intronic
1133787309 16:8983597-8983619 TGTGAGCGGCAGGAGGCAGAGGG + Intergenic
1135468238 16:22705834-22705856 TGTGAAGTGCTGGAGGTGGGAGG + Intergenic
1136654283 16:31700674-31700696 TGTGACCTGCAGGTACTGGACGG + Intergenic
1137440856 16:48497625-48497647 TGTGATTTGCAGGTGGTTGCAGG - Intergenic
1137486635 16:48896541-48896563 TGGTATCTGCAGGAGCTGGAAGG - Intergenic
1137590322 16:49689548-49689570 CGTGACCTCCAGGAGGTCGAGGG + Intronic
1139010795 16:62631459-62631481 TGTGAGGTGGAGGAGGGGGAAGG - Intergenic
1140364881 16:74373664-74373686 GGTGATGAGCAGGAGGTGGAGGG - Intergenic
1140754688 16:78056701-78056723 AATGAGCTGCAGGAGGTGGGAGG - Intronic
1141343116 16:83221677-83221699 TGGGCTCTGCAGGAGGTGCAGGG + Intronic
1141392732 16:83678230-83678252 TTTGATCAGCAGGGTGTGGAAGG - Exonic
1141592824 16:85079998-85080020 TGTGATCTTCAGGGGAGGGAGGG - Intronic
1142246933 16:88974493-88974515 TGTGCTGTGCAGGGGGTGGGAGG - Intronic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1143139776 17:4735116-4735138 TGTGCTGTGCAAGAGGAGGAGGG - Exonic
1143386582 17:6534593-6534615 TGTGATCTGGTGGTGGTGGGGGG + Intronic
1143510522 17:7393136-7393158 TGTGGCCTCCAGGAGGTGGGCGG - Exonic
1143551141 17:7631224-7631246 TCTGTGCTGCTGGAGGTGGATGG + Exonic
1143782503 17:9236636-9236658 TGAGATCTGCTGGGGGTGGAAGG + Intronic
1144627868 17:16854223-16854245 AGTGATCAGAAGGAGCTGGAGGG + Intergenic
1145103257 17:20094164-20094186 TGTGGGCAGCAGGAGGGGGATGG + Intronic
1145159461 17:20564824-20564846 AGTGATCAGAAGGAGCTGGAGGG + Intergenic
1145970891 17:28955853-28955875 TGGTATATACAGGAGGTGGAGGG + Exonic
1146632005 17:34476842-34476864 TGTGATAAGCAGGGGTTGGAGGG + Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1150650280 17:67005669-67005691 TGTGATCAGCAGAAGGGAGACGG - Intronic
1151544482 17:74784402-74784424 TGTGATCTGGAGGGGAAGGAAGG + Intronic
1151997307 17:77618208-77618230 TGGGAGGTGAAGGAGGTGGAGGG - Intergenic
1152190709 17:78885691-78885713 TGTGAGGGGCAGGAGGTGGAGGG + Intronic
1152534601 17:80943199-80943221 TGTCAGCTGCTGGAGGTGGGCGG + Intronic
1152628767 17:81400199-81400221 TTAGATCTGCAGGAGGGGGCGGG - Intronic
1153557064 18:6326042-6326064 TGTGATCTAATGAAGGTGGATGG - Intronic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1156282360 18:35652377-35652399 TGTTTTCTGCAGTATGTGGAAGG + Intronic
1156472399 18:37385572-37385594 TGTGGGCTGGGGGAGGTGGAGGG - Intronic
1156484999 18:37459530-37459552 TGTGATGTGCTGGAAGTGGGAGG + Intronic
1157570198 18:48707104-48707126 TGGGGAGTGCAGGAGGTGGAGGG + Intronic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158418999 18:57275988-57276010 TGTGATGTGAAGGAGGTAGAAGG - Intergenic
1158776246 18:60583491-60583513 AGAGATCTGAAGCAGGTGGATGG - Intergenic
1160487818 18:79309508-79309530 AGTGATCTCCAGCAGGTAGAAGG + Intronic
1161076402 19:2287970-2287992 TGTCCTCTGGAGGATGTGGAGGG + Intronic
1161279360 19:3436969-3436991 TGGGAGCTACAGGAGGAGGAAGG + Intronic
1161736677 19:5995840-5995862 TGGGAGCTGCTGGGGGTGGAGGG + Intronic
1161878201 19:6928242-6928264 TGTGTTCTGAAGGAGGAGCAAGG + Intronic
1162156574 19:8682237-8682259 TATGATCTGGAGGATGAGGATGG + Intergenic
1163835404 19:19570382-19570404 TGTGAACTACAGGGGGTGGCAGG - Intronic
1165214621 19:34261698-34261720 TTTGAGCTGCAGGAGATTGAGGG + Intronic
1165823752 19:38693778-38693800 TGTGGGCTGCAGGAGGGAGACGG - Intronic
1166665170 19:44675408-44675430 TGTGTTTTGCAGGAGATGTAGGG - Intronic
1166866096 19:45838359-45838381 GGTACTCTGGAGGAGGTGGATGG + Intronic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925789586 2:7470477-7470499 AGTCACCTGCAGGAGGTGGCTGG + Intergenic
925904945 2:8534816-8534838 CGGGATCTGCAGGCTGTGGAAGG + Intergenic
926349325 2:11981072-11981094 TGTGGTTTGCATGAGTTGGACGG - Intergenic
926446466 2:12948511-12948533 TGTGATCTGGAGCAGGAGGAGGG + Intergenic
928127944 2:28629077-28629099 TGGGAGCTGCAGGGAGTGGAGGG - Exonic
928486544 2:31738119-31738141 TGGCATCTGGAGGAGCTGGAGGG - Intergenic
929813956 2:45216122-45216144 AGAGATCTGTAGGAGGTGGGTGG - Intergenic
932336665 2:70935691-70935713 TGAGAGCTGGAGGATGTGGAGGG - Intergenic
932372479 2:71202754-71202776 TGATAACTGCAGGATGTGGATGG - Intronic
932558959 2:72850680-72850702 TGGGAGCTGAAGGAGGTGGAAGG - Intergenic
935422415 2:102883552-102883574 TGTGCTCTTCAAGATGTGGAAGG + Intergenic
936659240 2:114523805-114523827 TGGGATGAGCAGCAGGTGGAGGG - Intronic
937289092 2:120771169-120771191 TGTGCTCTGCATGAGGAGGCGGG + Intronic
937306891 2:120877139-120877161 TCTGACCTGCTGGAGGAGGAGGG - Intronic
937332406 2:121039821-121039843 TTCGTTCTGCAGGAAGTGGAAGG - Intergenic
937903744 2:127041627-127041649 TGTGACCTGCAGGGGGTGGCTGG - Intergenic
938107704 2:128544638-128544660 AGTCATCTCCAGGAGGTGGGGGG + Intergenic
938191144 2:129281892-129281914 TGTCTCCTGCAGGATGTGGATGG + Intergenic
939165680 2:138639009-138639031 TGAGATCTGAAGGAGCTGAAGGG - Intergenic
943334719 2:186599907-186599929 TGTGATCTGCAGTAAGAGGGTGG - Intronic
944525895 2:200619292-200619314 TGTGAGCTGCAGGATGGGAAGGG + Intronic
945136037 2:206628287-206628309 TTTGATCTGCTGGAGTTGAAGGG + Intergenic
946186866 2:217985994-217986016 TGTGTTCTGAAGGAGCTGTAAGG - Intronic
947859416 2:233348245-233348267 GGTGAACTGCAGGTGGAGGAGGG + Intergenic
948835456 2:240624077-240624099 TCTGATCTGCCAGAGGTGGAAGG + Intronic
1169010368 20:2245175-2245197 TGTTCTGTGCAGGAAGTGGAGGG + Intergenic
1169925644 20:10781504-10781526 TGTGATCTCTAGGATGTGGCTGG + Intergenic
1170728028 20:18947290-18947312 TGTGCTTTGCAGGAGGTGGTGGG - Intergenic
1170792187 20:19517392-19517414 AGTCATCAGCTGGAGGTGGAGGG + Intronic
1171018987 20:21568027-21568049 TGACATCTGAAGGAGGTAGAGGG - Intergenic
1172086176 20:32384708-32384730 TCTGAACTTCAGGAGGTAGAAGG - Intronic
1172298348 20:33830114-33830136 AGTGCTCAGCAGGATGTGGAAGG + Intronic
1172853003 20:37980078-37980100 CGTGATCTGCAGGCTGTAGAAGG - Intergenic
1172949824 20:38715779-38715801 GGTGAGATGCAGGAGGGGGAGGG - Intergenic
1173298276 20:41778597-41778619 TGTGAAGAGCAGGAGTTGGATGG - Intergenic
1174238521 20:49114339-49114361 TGGGTACTGCAGGAGGTGGTGGG + Exonic
1174404540 20:50294849-50294871 TGGGGTCTGCACGCGGTGGAAGG - Intergenic
1174414167 20:50356363-50356385 TGTGACCTGGGGCAGGTGGATGG + Intergenic
1174682484 20:52422067-52422089 TGTGGTCTGCTGGAGGTGGGGGG + Intergenic
1176364687 21:6025751-6025773 TGTGAACTGGAGGAGGCTGAGGG + Intergenic
1176511439 21:7751505-7751527 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1177220924 21:18191782-18191804 TGTGATTTCCAGGAGGTTGGGGG + Intronic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1178645553 21:34382034-34382056 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1179758831 21:43512794-43512816 TGTGAACTGGAGGAGGCTGAGGG - Intergenic
1179951737 21:44712163-44712185 TGTGCTCTGCGGGGGGTGGGGGG + Intergenic
1180920264 22:19518110-19518132 TGTGATGTGGGAGAGGTGGATGG + Intronic
1180982228 22:19884216-19884238 TGGCCTCTGCAGGAGGTGGCAGG + Intronic
1180992280 22:19943882-19943904 TGTGGCATGCAGGAGCTGGAGGG + Intronic
1181760286 22:25053638-25053660 TGTGAACTCCAGGAGGCTGACGG - Intronic
1181887357 22:26031881-26031903 TGTGAATGGCAAGAGGTGGATGG - Intergenic
1181940297 22:26470642-26470664 TGTGATCTGGAGGTGGCTGATGG + Intronic
1182505926 22:30782308-30782330 GGTTGTCTGCAGGAGGTGGAAGG - Intronic
1183576245 22:38691488-38691510 TGAGATCTGCAGGACCTTGAGGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
950667774 3:14507601-14507623 AGCCACCTGCAGGAGGTGGATGG + Exonic
950741586 3:15056543-15056565 TGTGGTCAGAGGGAGGTGGAAGG + Intronic
952687252 3:36163969-36163991 TGTGAGCTGCTGGTGGTGGTTGG + Intergenic
952816994 3:37454175-37454197 TGTGATCTGCAGGCTGAGGCTGG + Intronic
953378981 3:42452257-42452279 TGTGACCCCCAGGAGGTGGGTGG - Intergenic
953487974 3:43320424-43320446 TGGGAGCTCCAGTAGGTGGAAGG + Intronic
954533260 3:51338831-51338853 TGTGCTGGGCAGGAGGGGGAGGG - Intronic
954659178 3:52217588-52217610 GGTGATCTGCAGGAAGTAGGCGG + Intergenic
954798258 3:53172404-53172426 TGTGATCAGCAGGAGGGTGCAGG - Intronic
955408791 3:58642674-58642696 TGTGTCCTGCAGGAGATGCAGGG + Intronic
955569576 3:60290270-60290292 TGTGAATAGCAGGAGGTGGTGGG - Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
956724645 3:72146767-72146789 TGTGAGCAGCAGGAGGCTGAGGG - Intergenic
959372605 3:105547224-105547246 ACTGCTCTGCAGGAGGTTGAAGG + Exonic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960036533 3:113107937-113107959 TGGGAGCTGAAGGAGGTGGCAGG + Intergenic
961314049 3:126022457-126022479 TGTGGTCTGGAGGTGGTGCAGGG + Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962417090 3:135192997-135193019 TGGGATCCTCAGGAGGAGGATGG + Intronic
962847949 3:139287508-139287530 TCTGTTCTGCAGGGAGTGGAAGG - Intronic
962983948 3:140517704-140517726 TCTGCTCTGGTGGAGGTGGAGGG + Intronic
963003522 3:140705200-140705222 TGAGATTTGCAGCAGGGGGAGGG - Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
963924837 3:150940290-150940312 TGTGATTAGCAGAATGTGGATGG + Intronic
966284749 3:178281420-178281442 TGTGTTCTGCTGCAGTTGGATGG - Intergenic
966854084 3:184182189-184182211 GGTGATCTGCATGAAGGGGAAGG + Exonic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967660219 3:192098358-192098380 TAGGATCTGCTTGAGGTGGAAGG + Intergenic
967816251 3:193800866-193800888 TGTGATCTGCAGATTGTGAAGGG + Intergenic
967931455 3:194693374-194693396 TGTGAACTGGAGAAGGAGGAAGG - Intergenic
971801124 4:31292888-31292910 TGTGTTCTGCAGCAATTGGAAGG + Intergenic
972890960 4:43555272-43555294 TGTATTCTGCAGCAGTTGGATGG + Intergenic
973639517 4:52888895-52888917 TGTCGTCTGCAGGAGCTGGGTGG - Intronic
975621924 4:76305205-76305227 TGTGATCTGGAGCAACTGGAGGG + Intronic
977821512 4:101477363-101477385 TGTCATCTTCAGTAGGTTGAAGG - Intronic
978011782 4:103695309-103695331 GGTGAAGTGGAGGAGGTGGAAGG - Intronic
978739324 4:112119513-112119535 TGTTAGCTGCCGGAGGTGAATGG - Intergenic
978809346 4:112833017-112833039 AGTGATCTGTAGCAGCTGGATGG + Intronic
979711229 4:123781829-123781851 TCTGATCTTTAGGAGGAGGAAGG + Intergenic
980093071 4:128462375-128462397 AATGATGTGCAGGAGGTGGGTGG + Intergenic
980857486 4:138456601-138456623 TGTGCTGTGCAGGACATGGATGG + Intergenic
982312689 4:154002393-154002415 AGTGCTCTACAGGAGGTGGCAGG - Intergenic
985998644 5:3612828-3612850 TGAGCCCTTCAGGAGGTGGAAGG - Intergenic
986210347 5:5665688-5665710 GAGGAGCTGCAGGAGGTGGAGGG + Intergenic
986840174 5:11687536-11687558 TGTGATATGGAGGAGGTAGCTGG + Intronic
987296727 5:16559441-16559463 TGCTCTCTGCAGGAAGTGGATGG - Intronic
993183724 5:84588831-84588853 GGTTATAAGCAGGAGGTGGAAGG + Intergenic
993995673 5:94719652-94719674 TGGGATCTGCAGGTGGTGTGCGG + Intronic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
997135138 5:131317512-131317534 TGTGTTTTGGGGGAGGTGGAGGG + Intronic
997431433 5:133843765-133843787 TGTGATGTGCAAGGGATGGACGG + Intergenic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998392280 5:141795110-141795132 TGAGGTCTGCGGAAGGTGGATGG - Intergenic
999109914 5:149110196-149110218 TGTGATGCGCAGATGGTGGAAGG - Intergenic
1000488084 5:161873286-161873308 TGTGATCCGCAGGAGTTTGTTGG - Exonic
1000506627 5:162128156-162128178 TGTGATCTCCAGGAAAGGGAGGG - Intronic
1002201183 5:177529363-177529385 TGTGAAGTCCAGGAGGTGGAAGG + Intronic
1003831222 6:10014143-10014165 TGATGTCTGCAGGGGGTGGAGGG - Intronic
1004449170 6:15728853-15728875 TGAGCTCTGCAGGAGAGGGAAGG - Intergenic
1004630727 6:17418605-17418627 TGTGAGCTGCTGGAGGTGGCTGG + Intronic
1005235900 6:23761780-23761802 TGAGATCTACAAGTGGTGGAGGG + Intergenic
1005406780 6:25497829-25497851 AGTGTTATGCTGGAGGTGGAAGG + Intronic
1005775903 6:29130439-29130461 TGAGATATGCAGAAAGTGGAGGG - Intergenic
1007062724 6:38956357-38956379 TGGGATCTGCTGGAGGATGATGG - Intronic
1010509267 6:76697847-76697869 TGTGATCTGCAGGAAGGGAGTGG + Intergenic
1010931212 6:81805639-81805661 GGTGATCTGCAGGAGTTGACAGG - Intergenic
1011394843 6:86895527-86895549 TGTGTTCTGCAGTTGTTGGATGG - Intergenic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1013292586 6:108732165-108732187 TGTGCACTGCAGGAGGTGCCCGG + Intergenic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015234620 6:130956323-130956345 TTTCAGCTGCAGGAGGTGGCTGG + Exonic
1017227809 6:152041120-152041142 AGTTATCTGCAGGAGATGCAGGG + Intronic
1017986330 6:159446011-159446033 TGTGATCTGCAGGTAGTGGAAGG - Intergenic
1018944789 6:168340004-168340026 AGTGAGCTGCAGGAAGTGGAAGG - Intergenic
1019520461 7:1458608-1458630 TGGGAGCAGCAGGAGGTGGCAGG - Intronic
1020131476 7:5561152-5561174 TGGGACCTGCATGAGGTGGTTGG - Intronic
1023334009 7:39149678-39149700 TACGATCGGCAGGAGGTAGAGGG - Intronic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024360804 7:48465343-48465365 TTTGTTCTGCAGGATGTGGTTGG + Intronic
1024714602 7:52061882-52061904 TGTGGTCTGGGGGAGGTGGTGGG - Intergenic
1025256316 7:57385849-57385871 TGTGACCTGGAGCAGGTGGAGGG - Intergenic
1025482259 7:60995313-60995335 AGGGATCTTCAGGAGGTAGATGG - Intergenic
1027655348 7:80923635-80923657 AGTGATTTCCAGGAGGTAGAGGG + Intergenic
1031122607 7:117738740-117738762 TCTGATGTGCAGCAGGTGGTGGG + Intronic
1032465017 7:132138738-132138760 TGTGACCTGCAGCAGCTGCATGG + Intronic
1032533680 7:132643081-132643103 TCAGACCTGCAGGAGGAGGAGGG + Intronic
1032548997 7:132766886-132766908 GGTGAGCTGCAGCAGGAGGAGGG + Intergenic
1034803098 7:154065167-154065189 TGTGATGAGCAGCAGCTGGAAGG + Intronic
1036915099 8:12796990-12797012 AGTCATCTGCAGGATGTGGGTGG + Intergenic
1037179680 8:15990514-15990536 TGTGTTCTGCAGCAGTTAGATGG + Intergenic
1037764939 8:21766823-21766845 TGTGATGTGCATGAGGTGTGTGG - Intronic
1039436491 8:37563021-37563043 TTTGATATGCAGTTGGTGGATGG - Intergenic
1039809051 8:41028348-41028370 TGAGAGGTGCAGGAGGTAGAAGG - Intergenic
1039951826 8:42178991-42179013 TGTGATGTGCAGCGGCTGGATGG + Exonic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041288580 8:56285564-56285586 TGTAAACTGGAGGAGATGGAGGG + Intergenic
1045475634 8:102550086-102550108 TGAGCTCTGAATGAGGTGGAAGG + Intergenic
1045500769 8:102742872-102742894 TGAGATCTGAAGGAAGTGGAGGG + Intergenic
1045504531 8:102769179-102769201 TCTGATTTGAAGGAGGAGGATGG - Intergenic
1047527876 8:125649162-125649184 TGTGATGAGGAGGAGGTGGTTGG + Intergenic
1049709366 8:144056750-144056772 TGGGACCTGCAGCAGGTGGTTGG + Exonic
1050033985 9:1415618-1415640 TGGGAGCAGGAGGAGGTGGAAGG + Intergenic
1050237989 9:3603142-3603164 TGTCATATGCAGGAAGAGGAAGG - Intergenic
1050624641 9:7489793-7489815 TGTAATATGGATGAGGTGGAAGG - Intergenic
1050916599 9:11142972-11142994 TGTGACCTGCAGGCCGTGGTTGG - Intergenic
1051838093 9:21363388-21363410 TGTGACCTGCAGTAAGTAGAGGG + Intergenic
1055530292 9:77177288-77177310 GCTGATCTGCAGGAGGGGGCGGG + Intergenic
1056812426 9:89775068-89775090 ACTGATCTGCAAGAGCTGGAGGG - Intergenic
1056844702 9:90027133-90027155 TGTGATTTGCAGGACATAGAAGG - Intergenic
1056880314 9:90385353-90385375 TGTGATCTTCATGAAGTGGCTGG - Intergenic
1056925556 9:90831227-90831249 TGTGAACTACAGGAAGTTGAGGG + Intronic
1056945005 9:90986998-90987020 TGTGATCTTGTGGAGGTTGATGG - Intergenic
1057035960 9:91811743-91811765 TGAGATCAGCAGGAGGCTGAGGG - Intronic
1057083028 9:92187020-92187042 TGGGATTTGCTGGAGGAGGAAGG + Intergenic
1057788329 9:98105172-98105194 TGTGACCCGCAGGAGCTGTAGGG - Intronic
1058804630 9:108578957-108578979 TGTGGTCTAGAAGAGGTGGAGGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1058933571 9:109746636-109746658 TGATATCCCCAGGAGGTGGAAGG + Intronic
1060349588 9:122847202-122847224 TGTGCTCTGCTGGAGGGGGTTGG - Exonic
1061953279 9:133948400-133948422 TGTGATCTGGAGGAGTGGGGTGG + Intronic
1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG + Intergenic
1062707425 9:137953223-137953245 TGTGCTAGGAAGGAGGTGGAAGG + Intronic
1187287830 X:17923045-17923067 GATGGTCTGGAGGAGGTGGAAGG + Intergenic
1188026806 X:25218457-25218479 TGGTATCTGTAGGGGGTGGAGGG + Intergenic
1190243500 X:48676103-48676125 TTTGATCTGCAGGAGTAGGACGG - Intergenic
1190308525 X:49100872-49100894 TTTGATCTGCAGGAGTAGGACGG - Intronic
1190395143 X:49974806-49974828 TGGGTTGTGCAAGAGGTGGAAGG + Intronic
1191880518 X:65840313-65840335 TGTCATCAGCAGGAAGTGCAGGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193741889 X:85226940-85226962 TGGAATCTGCAGTAGGTAGAGGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1195244512 X:102983406-102983428 TGAGGACTGCAGGAGGGGGATGG + Intergenic
1196619832 X:117808780-117808802 TGTGCTCTGATGGAGGTGGCAGG - Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1198774230 X:140162594-140162616 TGTCAACTGCTGGATGTGGAGGG - Intergenic
1198934038 X:141887847-141887869 TGTTATCTGCAGAAGATTGAAGG - Intronic
1199541392 X:148961222-148961244 TGGCATCTACAGGAGGTGAATGG - Intronic
1200089077 X:153625969-153625991 CATGGTCTGAAGGAGGTGGAAGG + Intergenic
1200182161 X:154157157-154157179 TGTAACCTGCAGGAGGTGGGGGG - Intronic
1200187815 X:154194271-154194293 TGTAACCTGCAGGAGGTGGGGGG - Intergenic
1200193465 X:154231411-154231433 TGTAACCTGCAGGAGGTGGGGGG - Intronic
1200199220 X:154269215-154269237 TGTAACCTGCAGGAGGTGGGGGG - Intronic
1200920765 Y:8610901-8610923 TATGATCTGGGGGTGGTGGATGG + Intergenic
1202160311 Y:21927557-21927579 TGTCATCTACAGGAGATGGTGGG - Intergenic
1202231045 Y:22658821-22658843 TGTCATCTACAGGAGATGGTGGG + Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202312113 Y:23537344-23537366 TGTCATCTACAGGAGATGGTGGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202558690 Y:26133250-26133272 TGTCATCTACAGGAGATGGTGGG + Intergenic