ID: 925182731

View in Genome Browser
Species Human (GRCh38)
Location 2:1827444-1827466
Sequence GGCAGAGGGTGGCGGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 827
Summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 748}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925182731_925182742 4 Left 925182731 2:1827444-1827466 CCTCATTCCCGCCACCCTCTGCC 0: 1
1: 0
2: 6
3: 72
4: 748
Right 925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 234
925182731_925182744 15 Left 925182731 2:1827444-1827466 CCTCATTCCCGCCACCCTCTGCC 0: 1
1: 0
2: 6
3: 72
4: 748
Right 925182744 2:1827482-1827504 GAGAGTTGAGGGGACCTCTCTGG 0: 1
1: 1
2: 2
3: 18
4: 177
925182731_925182746 20 Left 925182731 2:1827444-1827466 CCTCATTCCCGCCACCCTCTGCC 0: 1
1: 0
2: 6
3: 72
4: 748
Right 925182746 2:1827487-1827509 TTGAGGGGACCTCTCTGGTTGGG 0: 1
1: 0
2: 2
3: 11
4: 97
925182731_925182741 3 Left 925182731 2:1827444-1827466 CCTCATTCCCGCCACCCTCTGCC 0: 1
1: 0
2: 6
3: 72
4: 748
Right 925182741 2:1827470-1827492 AAGGGGATCTCAGAGAGTTGAGG 0: 1
1: 1
2: 0
3: 21
4: 215
925182731_925182749 28 Left 925182731 2:1827444-1827466 CCTCATTCCCGCCACCCTCTGCC 0: 1
1: 0
2: 6
3: 72
4: 748
Right 925182749 2:1827495-1827517 ACCTCTCTGGTTGGGAAAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 220
925182731_925182745 19 Left 925182731 2:1827444-1827466 CCTCATTCCCGCCACCCTCTGCC 0: 1
1: 0
2: 6
3: 72
4: 748
Right 925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG 0: 1
1: 1
2: 0
3: 9
4: 100
925182731_925182748 27 Left 925182731 2:1827444-1827466 CCTCATTCCCGCCACCCTCTGCC 0: 1
1: 0
2: 6
3: 72
4: 748
Right 925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 172
925182731_925182747 26 Left 925182731 2:1827444-1827466 CCTCATTCCCGCCACCCTCTGCC 0: 1
1: 0
2: 6
3: 72
4: 748
Right 925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 162
925182731_925182743 5 Left 925182731 2:1827444-1827466 CCTCATTCCCGCCACCCTCTGCC 0: 1
1: 0
2: 6
3: 72
4: 748
Right 925182743 2:1827472-1827494 GGGGATCTCAGAGAGTTGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925182731 Original CRISPR GGCAGAGGGTGGCGGGAATG AGG (reversed) Intronic
900115290 1:1025559-1025581 AGGAGAGGGTGGCAGGAATGCGG - Intronic
900116118 1:1028608-1028630 GGGAGAGGGTGGCGTGGCTGTGG - Intronic
900116139 1:1028669-1028691 GGGAGAGGGTGGCGTGGCTGTGG - Intronic
900116243 1:1028974-1028996 GGGAGAGGGTGGCGTGGCTGTGG - Intronic
900116264 1:1029035-1029057 GGGAGAGGGTGGCGTGGGTGTGG - Intronic
900287432 1:1908448-1908470 TGCAGAGGGTGGCAGGAGTGAGG + Intergenic
900431695 1:2605819-2605841 TGGAGAGGGTGGCGGGGGTGGGG + Intronic
900571048 1:3358371-3358393 GGCAGTGGGTGGCAGCCATGGGG + Intronic
900967834 1:5971654-5971676 GGCTGAGTGAGGCGGGAATTGGG - Intronic
902189731 1:14753965-14753987 GGAAGAGGGTGCCGCAAATGTGG + Intronic
902393404 1:16119146-16119168 GGGAGAGGGTGCCAGGAGTGGGG + Intergenic
902576496 1:17381253-17381275 GGAAGAGGGTGTCGGGGGTGGGG - Intronic
902641320 1:17768159-17768181 GGAATAGGGTGGCGGGCAGGTGG + Intronic
902731582 1:18373420-18373442 GGCTGAGGGTGGAAGGAGTGAGG + Intronic
902907812 1:19571848-19571870 GGAAGAGGGTGCCAGGTATGGGG + Intergenic
903070569 1:20725084-20725106 GGCACAGGGAGGTGGGGATGAGG - Intronic
903137627 1:21319688-21319710 GGTAGGGAGTGGCGAGAATGAGG - Intronic
903170274 1:21548171-21548193 GGCAGAGGGTGGTGGGCAGCCGG + Intronic
903350348 1:22713005-22713027 GGCAGAGGCTGGTTGGAATCTGG + Intronic
903364072 1:22795113-22795135 GGCTTAGGGTGGGGGGAGTGAGG - Intronic
903460337 1:23516404-23516426 GGCAGAGGGTGGAGGTAGAGGGG + Exonic
903566319 1:24268589-24268611 GTCAGAGGGTGGGGGGCAAGTGG - Intergenic
903710729 1:25322132-25322154 GGGGGAGGGTGGCGGGGAGGTGG + Intronic
903716361 1:25370275-25370297 GGGGGAGGGTGGCGGGGAGGTGG - Intronic
903809895 1:26029424-26029446 TGCAGAGGGTGCAGTGAATGGGG - Intronic
903834973 1:26197882-26197904 GGCAGCTGGTGGGGGTAATGAGG + Intronic
903846779 1:26283616-26283638 GGTGGTGGGTGGTGGGAATGTGG + Intronic
904568933 1:31446142-31446164 GGCTGAGGGGAGCGGGAATGGGG - Intergenic
904770079 1:32876229-32876251 GGCGGGGGGTGGGGGGGATGGGG + Intergenic
905365696 1:37450157-37450179 GGAAGTGGGTGGCGGGTATGGGG - Intergenic
906044896 1:42821056-42821078 TGCAGAGGGAGGCAGGATTGGGG - Intronic
906525859 1:46492985-46493007 TGGAGAGAGTGGCGGGAATAGGG - Intergenic
906646977 1:47482268-47482290 GGCAGAGGCTGGTGTGAATTAGG - Intergenic
907011588 1:50968564-50968586 GAGAGCGGGAGGCGGGAATGAGG + Exonic
909453383 1:75823621-75823643 GTCAGTGGGTGGAGGGAAAGGGG - Intronic
910480118 1:87649594-87649616 GGGAGAAGGGGGAGGGAATGAGG - Intergenic
911201031 1:95043843-95043865 GGGAGAGGGAGAAGGGAATGAGG + Intronic
911995236 1:104758107-104758129 GGCAGGGGGTGGGGGGATGGGGG + Intergenic
912404953 1:109429463-109429485 GGCGGAGGGTGGCAGGAGGGAGG - Intergenic
912749834 1:112277544-112277566 GGCAGGGGGTGGAGGGAAAGTGG + Intergenic
913169913 1:116222473-116222495 GGGAGAGGGTGACGGGCCTGAGG - Intergenic
913305422 1:117425158-117425180 GGCAAAGGGGGGAGGGAAGGGGG + Intronic
913561711 1:120027621-120027643 GTCAGGGGGTGGGGGGAAAGGGG - Intronic
914282299 1:146187023-146187045 GTCAGGGGGTGGGGGGAAAGGGG - Intronic
914543324 1:148637737-148637759 GTCAGGGGGTGGGGGGAAAGGGG - Intronic
914623297 1:149433275-149433297 GTCAGGGGGTGGGGGGAAAGGGG + Intergenic
914912899 1:151801411-151801433 TGCAGAGGAGGGCGGGCATGCGG - Exonic
915356878 1:155260606-155260628 AGCTGAGGGTGGAGGCAATGGGG + Exonic
915491385 1:156251850-156251872 GGCAGAGGGTGTAGGGAATAAGG - Intronic
915835289 1:159171483-159171505 GGCGGGGGGTGTGGGGAATGCGG + Intergenic
916138157 1:161671712-161671734 GGCAGAGGTTTGCAGGAAAGGGG + Intronic
916183957 1:162113069-162113091 GGCAGAGGGTGGTGGGGATAGGG + Intronic
916259373 1:162825543-162825565 GCCAGAGGGTGGAGGGAGAGAGG + Intronic
916513893 1:165497660-165497682 TGCAGAGGGTGGGGAGTATGTGG - Intergenic
917719112 1:177769194-177769216 GGAAGACTGTGGAGGGAATGGGG - Intergenic
917931729 1:179827144-179827166 GGCTGGGGGTTGAGGGAATGGGG - Intergenic
918045505 1:180938738-180938760 TGCAGAAGGAGGTGGGAATGGGG + Intronic
918550874 1:185740680-185740702 GGCAGGGGGTGGGGGGTAGGGGG + Intronic
918876176 1:190046411-190046433 GACAGAGGGAGGCAGAAATGGGG + Intergenic
919253143 1:195085201-195085223 GGCAGAGGGTGGATGGAAGTGGG - Intergenic
919814301 1:201428057-201428079 GGCAGAGGGTGGCGGGTGTGGGG - Intronic
920578898 1:207086052-207086074 AGCAGAGGGAGGCAGGAAGGTGG + Intronic
921242591 1:213200965-213200987 GTCAGAGGGTGGCGGGTGGGAGG + Intronic
921777501 1:219118655-219118677 GTCAGAGGGTGAAGGGAAAGAGG + Intergenic
921951067 1:220930836-220930858 GGCTGACTGTGGCAGGAATGAGG + Intergenic
922279848 1:224113541-224113563 GCCAGAGGCTGGGGGAAATGGGG - Intergenic
922451093 1:225737913-225737935 GGATGAGGGTGAAGGGAATGGGG + Intergenic
922725295 1:227920190-227920212 GGCAGTGGCTGGCTGGCATGGGG + Exonic
923503461 1:234585532-234585554 AGCAGAGGGTGGCAGGATTGAGG - Intergenic
923904664 1:238370541-238370563 GGAAGAGAGTAGAGGGAATGAGG - Intergenic
924588195 1:245378341-245378363 GGTGGGGGGTGGTGGGAATGTGG + Intronic
924811667 1:247408245-247408267 AACAGAGGGTGGGGGGATTGGGG - Intergenic
1063362154 10:5467777-5467799 GGCAGAGGGTGTTGGGGAGGGGG - Intergenic
1063392414 10:5659184-5659206 GGGAGAGGGTGCAGGGATTGGGG - Intronic
1063726953 10:8647776-8647798 GGCAGAGAGTGGCTTGAATTAGG + Intergenic
1063735169 10:8745301-8745323 GGCTGGGGGTGGAGAGAATGGGG - Intergenic
1063884178 10:10561258-10561280 GTCAGAGTGTGGCTGGAAAGGGG - Intergenic
1064288428 10:14012490-14012512 TGAAAGGGGTGGCGGGAATGGGG + Intronic
1064799558 10:19053071-19053093 AGCAGAGGGTGGCAGGGCTGAGG - Intronic
1065459127 10:25937255-25937277 GGCAGAGGATGGCAGCAATGTGG - Intronic
1065574089 10:27101033-27101055 GGCAGAGGGGTGGGGGAAGGAGG - Intergenic
1066288188 10:33988967-33988989 GTCAGAGGGTGGGGGGCAAGGGG - Intergenic
1066656109 10:37701194-37701216 GGCAGAGGGTGGGGGGAGGATGG - Intergenic
1067066458 10:43106689-43106711 GGCAGAGGGTGGAGGGGAAGTGG - Intronic
1067189071 10:44054613-44054635 GGCAGGGGGTGGCAGACATGAGG - Intergenic
1067438131 10:46292997-46293019 AGGAGAGGGAGGAGGGAATGGGG + Intronic
1067731233 10:48812901-48812923 GGCAGACGATGGTGGGAAAGAGG - Intronic
1068638813 10:59378759-59378781 GGCAGAGGATGAGGGGAAGGAGG - Intergenic
1068716467 10:60194407-60194429 GGTAGAGGGAGAAGGGAATGGGG - Intronic
1069594806 10:69663742-69663764 GGCAGAGGGTGGAGGGCAGCTGG - Intergenic
1069715912 10:70521189-70521211 GGCAGAGAGTGGAGTGGATGGGG + Intronic
1070614729 10:77960943-77960965 GGTAGGGGGTGGGGGAAATGGGG - Intergenic
1070819940 10:79348629-79348651 GGTAGAGGCTGGCTGGGATGGGG + Intronic
1070820312 10:79350481-79350503 GGGTCAGGGTGGAGGGAATGGGG - Intronic
1071078905 10:81785745-81785767 GGCTGAGGGTGGGATGAATGGGG - Intergenic
1071514437 10:86287860-86287882 GGCAGAAGGTGGCTGGCATCAGG + Intronic
1071647336 10:87367065-87367087 GGGAGAGGGTGGCCTGAATGGGG + Exonic
1071893226 10:90035234-90035256 GTCAGGGGGTGGGGGGCATGGGG + Intergenic
1072607202 10:96994673-96994695 GGTAGGGGGTGGGGGGAATGGGG + Intergenic
1073063764 10:100746610-100746632 GGGAGAGGGTGGCTGGAACCAGG - Intronic
1074077571 10:110142826-110142848 GTAAGAGGGTGGCGGGGTTGGGG - Intergenic
1074119830 10:110485750-110485772 GGCAGGAAGTGGCAGGAATGAGG + Intergenic
1074168703 10:110910650-110910672 GGCAGTGGGGGGTGGGAAGGTGG - Intronic
1074511739 10:114118679-114118701 CGCAGAGAGTGGCAGGACTGAGG - Intergenic
1074526165 10:114265088-114265110 GCCAGGGGCTGACGGGAATGAGG + Intronic
1075407492 10:122204324-122204346 GGCAGAGGGAGAGGGCAATGGGG - Intronic
1076397312 10:130149657-130149679 GGCAGAGGGGGGTGGGAGAGAGG + Intronic
1076625945 10:131822133-131822155 AGCAGAGGGTGCAGGGACTGGGG + Intergenic
1076888887 10:133274487-133274509 GGCAGAGGGTGGGGGGCGGGGGG + Intronic
1076992539 11:282952-282974 AGCAGAGGGAGGAGGGGATGAGG + Intronic
1077555480 11:3224017-3224039 GGGAGAGGGGAGGGGGAATGTGG + Intergenic
1077580295 11:3413195-3413217 GGCAAAGGCTGGTGGCAATGGGG + Intergenic
1078561552 11:12377455-12377477 GGCAGAGGGCGGCGCGAGGGAGG + Exonic
1078589345 11:12625958-12625980 GGCTGAGGGGTGGGGGAATGGGG + Intergenic
1078866868 11:15306186-15306208 GGGTGAGGGTGGAAGGAATGAGG - Intergenic
1079632391 11:22694008-22694030 TTCAGAGGGTAGCGGGAAGGAGG + Intronic
1079646157 11:22865971-22865993 GGCAGAGAGTGGTGGGTATCTGG + Intergenic
1080384380 11:31802560-31802582 GGGAGTGGGTGGGGGGACTGGGG + Intronic
1081313759 11:41605208-41605230 GTCAGAGGGTGGAGGGATGGGGG + Intergenic
1081611813 11:44567441-44567463 GGCAGGGGGTGGGGGTAAGGAGG + Intronic
1081786366 11:45750569-45750591 AGCAGAGCGTGGGGGGCATGCGG + Intergenic
1083131395 11:60626415-60626437 GGCAGAGAGGGGAGGAAATGGGG + Intergenic
1084006566 11:66326425-66326447 GGCGGAGGGTGGAGGGAGGGAGG + Intergenic
1084237214 11:67796023-67796045 GGCAAAGGCTGGTGGCAATGAGG + Intergenic
1084582471 11:70032517-70032539 AGCAGAGGGAGGCGGGAGAGGGG + Intergenic
1084650329 11:70485850-70485872 TTCAGGGGGTGGCAGGAATGAGG + Intronic
1084672860 11:70617643-70617665 AGAAGAAGGTGGCCGGAATGAGG + Intronic
1084835183 11:71796804-71796826 GGCAAAGGCTGGTGGCAATGGGG - Intronic
1085237906 11:75029689-75029711 GGCATAGGGTAGATGGAATGGGG - Intergenic
1087209356 11:95430860-95430882 GGCAGAGGTTGGAAGAAATGTGG + Intergenic
1087553790 11:99688752-99688774 GTCAGAGGGTGGCGGGGAGAAGG - Intronic
1088527522 11:110772964-110772986 GGGTGAGTGTGGCGGGGATGAGG - Intergenic
1088695439 11:112362274-112362296 GGCAGAGAGTGGTGGGAATGAGG + Intergenic
1088841396 11:113630429-113630451 GGCAGAGGGTGGGGTGGAAGGGG - Intergenic
1089170906 11:116510959-116510981 GGGAGAAGGTGGGGAGAATGTGG + Intergenic
1089218088 11:116847810-116847832 GGCTGAGGGTGGGGCGGATGTGG + Intronic
1089243149 11:117098468-117098490 GGCAAGGGGGGGCGGGAAAGGGG + Intergenic
1089310333 11:117554143-117554165 GGCTGAGGGGAGGGGGAATGGGG + Intronic
1089527977 11:119109125-119109147 TGCAGAGGGTGGGGAGATTGAGG + Intronic
1089545802 11:119224385-119224407 GGCAGTGGCTGGAGGTAATGAGG - Intronic
1089620542 11:119719814-119719836 GGCAGGGGGTGGCATGGATGAGG + Intronic
1089814566 11:121160860-121160882 GGCAGAAGTTGGTGGGAATCAGG + Intronic
1090191888 11:124777061-124777083 GGCAGAGGGCGCTGGGAAAGGGG - Intronic
1090346646 11:126076926-126076948 GCCAGAGGGAGGAGGCAATGGGG + Intergenic
1090620181 11:128553681-128553703 GGAGGAGGGTGGCGGGAGTGTGG - Intronic
1090902564 11:131045887-131045909 GGAAGGAGGTGGCGGGAAGGAGG + Intergenic
1090955931 11:131512844-131512866 GGGAGAGGGTGGGGGGCATGGGG - Intronic
1091211078 11:133861972-133861994 GGCCGAGGGTAGGGAGAATGGGG - Intergenic
1091445442 12:542193-542215 AGCAGAGTGTGGCGCTAATGGGG - Intronic
1091521813 12:1253128-1253150 GGGAGAGGGAGGAGAGAATGTGG + Intronic
1091823525 12:3492898-3492920 TGCAGCGGGGGGCGGGGATGGGG + Intronic
1091915740 12:4271096-4271118 TGCAGAGGGCGCCGGGAAGGGGG + Intergenic
1091920060 12:4296908-4296930 GACGGAGGATGGCTGGAATGTGG + Intronic
1092149418 12:6236828-6236850 GGCAGAGGCAGGCGGGGGTGGGG - Intronic
1092245946 12:6864233-6864255 GGAAGAAGGGGGTGGGAATGAGG + Intronic
1092365353 12:7872760-7872782 GGCCGGGGGGTGCGGGAATGAGG - Intronic
1092407882 12:8233616-8233638 GGCAGAGGCTGGTGGCAATGGGG + Intergenic
1093231093 12:16542910-16542932 ATCAGAGGATGGAGGGAATGTGG - Intronic
1094340184 12:29402471-29402493 GGCAGAGGGTTGAGAGAAAGAGG + Intergenic
1095937823 12:47704764-47704786 GGCAGAGGTTGGGGGGCAGGGGG + Intronic
1096405305 12:51339813-51339835 GGCAGAGAGTGGCGGGACCTGGG + Intronic
1096526211 12:52211838-52211860 TGCAGAGGGAGGAGGGGATGGGG + Intergenic
1096938335 12:55309006-55309028 GTCAGGGGGTGGTGGGAAAGGGG + Intergenic
1097823117 12:64147430-64147452 GGCACAGGAAGGCGGGGATGGGG - Exonic
1099989819 12:89709543-89709565 GGGAAAGGGTGGCCGGAGTGAGG + Intergenic
1100523725 12:95400644-95400666 GGCAGAGGGTGTGTGGAATGGGG - Intergenic
1100787050 12:98089794-98089816 GACAGAGGGAGGATGGAATGAGG + Intergenic
1100982607 12:100173165-100173187 GGCAGGGAGAGGCGGGGATGGGG + Intergenic
1101289336 12:103351928-103351950 GGAAGAGGGTGGAGGGGAAGGGG - Intronic
1101676583 12:106922426-106922448 GGCAGTGGGGGGCTGGAGTGAGG - Intergenic
1101766041 12:107700342-107700364 GGCTGGGGGTGGGGGAAATGGGG - Intronic
1102033606 12:109758743-109758765 GGCAGAGTGTGGCAGCAAAGGGG + Intronic
1102317205 12:111898834-111898856 GTCAGGGGGTGGGGGGAAGGGGG - Intergenic
1102707144 12:114891936-114891958 GGCAGAAGGTGGCTGATATGGGG - Intergenic
1102978276 12:117222134-117222156 GGCTGAGGGAGGGGAGAATGGGG - Intronic
1103940511 12:124498976-124498998 GGCAGGGTGAGGCAGGAATGAGG + Intronic
1103963158 12:124621977-124621999 GGCACAGAGTGGCTGGACTGGGG - Intergenic
1104053457 12:125211662-125211684 TGCAGCGGGTGGAAGGAATGAGG - Intronic
1104092264 12:125526794-125526816 GGCAGAGGGAGGCGGCTGTGGGG + Intronic
1104117661 12:125764958-125764980 GGCAGAGGTTGGAGGGAATCTGG + Intergenic
1104490219 12:129187436-129187458 GGCTGAGGGTGTCAGGGATGTGG + Intronic
1104611133 12:130228713-130228735 GCCAGAGGGTGTGGGGATTGTGG - Intergenic
1104685884 12:130783624-130783646 GGCTGAGGGTGGCGGGAAAGGGG + Intergenic
1104722154 12:131050552-131050574 GGCAGAAGGTGGAGGGAACCAGG + Intronic
1104887483 12:132119158-132119180 GGCAGAGGCTGGCGGGCCTGGGG - Intronic
1105008629 12:132739100-132739122 GGTTGAGGGTGGAGGGAGTGAGG + Intronic
1105057120 12:133112223-133112245 GGCAGAGGGTGGAGGGACAGAGG - Exonic
1105948357 13:25208675-25208697 GGAAGAAGGTGGCGGGGTTGGGG + Intergenic
1106011282 13:25825937-25825959 GACAGAGGATGGAGGGAATTGGG + Intronic
1106193689 13:27475767-27475789 GGCTGGGGAAGGCGGGAATGGGG - Intergenic
1107364471 13:39655729-39655751 GGCAGAGGGCAGCGGGGAAGTGG + Exonic
1107479148 13:40771078-40771100 GACAAAGGGTGGCGGGAAAGGGG + Exonic
1107819172 13:44270797-44270819 GGAAGAGGGTGGAGGTGATGGGG + Intergenic
1107948309 13:45439534-45439556 GCCAGAGGATGGAGGAAATGGGG + Intergenic
1108018728 13:46103218-46103240 TGCAGAGGTTGGCGGGCAGGTGG - Intronic
1108442105 13:50465204-50465226 GGCAGATGGTGGTGGGAGTGGGG + Intronic
1108589000 13:51895683-51895705 GGCAGAGGGTGGGGGGATGTAGG - Intergenic
1108884656 13:55165201-55165223 GGCAGAGGGAGTCTGCAATGGGG - Intergenic
1109169733 13:59080620-59080642 GGTGGAGGGAGGCGGGAATAGGG - Intergenic
1109298090 13:60559728-60559750 AGCAGAGGGTGAGGGAAATGAGG + Intronic
1110207944 13:72939386-72939408 GTCAGAGGGTGGGGGCAAAGAGG - Intronic
1110393526 13:75003464-75003486 GGCTGGGGGTGGGGAGAATGGGG - Intergenic
1110868472 13:80423406-80423428 GTCAGAGGGTGGGGGGCAAGGGG - Intergenic
1113011020 13:105765755-105765777 GGCAGAGATTGCAGGGAATGAGG - Intergenic
1113186247 13:107688826-107688848 GGCAGAGGTTGGCAGAAATGTGG + Intronic
1113507989 13:110830449-110830471 GGAAGAGGGTGGCGAGACAGTGG + Intergenic
1113531940 13:111033516-111033538 GGCAGGGGGCGGCTGGAATCAGG + Intergenic
1113814466 13:113161736-113161758 GGCAGGGGGTGGCAGGAATGGGG - Intronic
1113824917 13:113244744-113244766 GGCAGAGAATGGCGTGAACGCGG + Intronic
1113966705 13:114156601-114156623 GGCAGAGGCTGGTGGGGAGGTGG - Intergenic
1113972693 13:114202024-114202046 GGCAGAGGGTGGTGGGTAGGGGG - Intergenic
1114660997 14:24344809-24344831 GGCAGGGGGTGGAAGGAAGGGGG - Intergenic
1114742622 14:25113711-25113733 GGCACAGATTGGAGGGAATGGGG + Intergenic
1115347723 14:32361156-32361178 GGCATAGGATGAGGGGAATGCGG + Intronic
1115754097 14:36516722-36516744 GCCAGAGGGTGCCGGGGAGGGGG + Exonic
1116817685 14:49598955-49598977 GGCGCCGGGTGGCGGGAAGGAGG + Exonic
1117621920 14:57595914-57595936 GGTTGAGGGTGGAGGGAGTGGGG + Intronic
1118932447 14:70255103-70255125 GGCTGGGGGTGGCGGGGAGGGGG - Intergenic
1119410336 14:74426234-74426256 GGCGGCGGGAGGCGGGAAGGAGG - Intergenic
1119719969 14:76883884-76883906 GGCGGAGGGTGGCGGTGGTGAGG + Intergenic
1119736218 14:76984489-76984511 AGCAGTGGGTGGAGGGAATGTGG + Intergenic
1120057880 14:79946952-79946974 GGCAGAGGGTGTAGGTATTGTGG + Intergenic
1120203679 14:81565173-81565195 GGTAGAGGGTGGGAGGAAGGAGG - Intergenic
1121338523 14:93091646-93091668 GCCAGAGGGTGGAATGAATGAGG + Intronic
1121468179 14:94129315-94129337 GGCAGAGGGAGATGGGAAAGGGG + Intronic
1121676583 14:95758515-95758537 AGCAGAGGTTGGCGGCATTGAGG + Intergenic
1122097814 14:99384238-99384260 CCCAGAGGGAGGCGGGGATGGGG + Intergenic
1122143564 14:99676116-99676138 GCCAGGGGGTGGGGGGGATGCGG - Exonic
1122173584 14:99898957-99898979 GGCAGAGGGTGGCTGAAATTTGG - Intronic
1122903854 14:104793055-104793077 GGCTGGGGGAGGTGGGAATGGGG - Exonic
1123201847 14:106673645-106673667 GTCATGGGGTGGCGGGAAGGGGG + Intergenic
1123626322 15:22229205-22229227 GCCAGAGGGATGAGGGAATGAGG + Intergenic
1123917103 15:25042471-25042493 GGTAGAGGAGGGCTGGAATGAGG + Intergenic
1125610145 15:40964158-40964180 GGCAGAGGGTGGCAGGAGAAGGG + Intergenic
1125719987 15:41840689-41840711 GGCAGTGGCTGGCGAGGATGTGG - Intronic
1125733852 15:41910023-41910045 GTCCAAGGGTGGCCGGAATGTGG + Intronic
1125963286 15:43851062-43851084 GGAAGAGAGTTGCGGGAAAGGGG - Intronic
1126519629 15:49577288-49577310 TGCAGGGGGTGTGGGGAATGGGG - Intronic
1126802652 15:52313719-52313741 GGCCGAGGCTGGCTGGAATCTGG + Exonic
1126803937 15:52326543-52326565 GGCTGAGGGAGGGAGGAATGGGG + Intronic
1127286458 15:57538000-57538022 GGCGGGGGGTGGCGGGGAGGAGG - Intronic
1127763800 15:62165371-62165393 GGGAGAGGGTGGCGGGAAGGCGG - Intergenic
1128317612 15:66671116-66671138 GGCAGAGGGGGGCGGGGCAGAGG - Intronic
1129176432 15:73843126-73843148 GTCAGAGGGTGGTGGGAACTGGG - Intergenic
1129265794 15:74392448-74392470 GCCAGAGGGTGGGGGGCTTGAGG - Intergenic
1129313052 15:74725665-74725687 GGCGGAGGGCGGCGGGGGTGGGG + Intergenic
1129341507 15:74889542-74889564 GCCAGAGCAAGGCGGGAATGTGG - Intergenic
1129823970 15:78622189-78622211 TGCAGATGGTGGCGGGGAAGGGG - Intergenic
1129893912 15:79090022-79090044 GGCAGAGGGGGCAGGGATTGAGG - Intronic
1129903407 15:79169142-79169164 GACAGAGGGAGGGGGGAAGGCGG + Intergenic
1129981360 15:79874311-79874333 GGGAGAGGGGGATGGGAATGGGG - Intronic
1130329984 15:82914548-82914570 GGCTGGGGGAGGAGGGAATGGGG + Intronic
1130978659 15:88796799-88796821 GGCAGAGGGTAGGGGTAATTAGG + Intergenic
1131378265 15:91943232-91943254 GGCTGAGGGGAGGGGGAATGGGG - Intronic
1131528710 15:93173903-93173925 GTCAGGGGGTGGGGGGCATGGGG - Intergenic
1132116201 15:99138137-99138159 AGCAGAGGGTGGGGTGAGTGTGG + Intronic
1132674689 16:1116885-1116907 AGCAGAGGGGGGCGGGGAAGGGG - Intergenic
1132700245 16:1219153-1219175 AGCAGAGGCTGGCGGGGATGGGG + Intronic
1132733645 16:1375187-1375209 GGCAGAGGCTGGCGTGGACGTGG + Intronic
1132799462 16:1744518-1744540 GAGAGAGGGTGGCGGGGCTGCGG + Intronic
1132808629 16:1787295-1787317 GGGAGAGGCTGGTGGGAGTGAGG + Intronic
1132843941 16:1991440-1991462 GGCAGAGCGGGGCGGGAGGGAGG - Intronic
1133857005 16:9559167-9559189 GGCAGAGGGTGGCATCAGTGGGG - Intergenic
1134311175 16:13076479-13076501 GACAGAGGGTGGGGGAAAGGAGG - Intronic
1134449357 16:14354102-14354124 GGCAGAGGGAGGAGGGAAGGAGG + Intergenic
1134507174 16:14817573-14817595 GACAGTGGGTGGGGGAAATGGGG - Intronic
1134694875 16:16216330-16216352 GACAGTGGGTGGGGGAAATGGGG - Intronic
1135487575 16:22879471-22879493 GGCAGAGGGTGGATGGGGTGGGG + Intronic
1136246016 16:28976296-28976318 AGGAGAGGGTGTCTGGAATGGGG + Intronic
1136551230 16:30983630-30983652 GGCAGATGGTGGCCGACATGCGG + Exonic
1137056477 16:35748730-35748752 GGCAAAGGTGGGCGGGAATTTGG - Intergenic
1137071715 16:35909629-35909651 GGACTAGGGTGGTGGGAATGGGG + Intergenic
1137236154 16:46620372-46620394 GCCAGTGGGTTGGGGGAATGGGG - Intronic
1137740114 16:50761452-50761474 AGCAGAGGCTGGAGGGAAAGAGG - Intronic
1137775370 16:51049788-51049810 GGGGGAGGGTTGGGGGAATGGGG - Intergenic
1137861469 16:51850892-51850914 CCCAGAGGGCGGCTGGAATGCGG - Intergenic
1137931214 16:52589263-52589285 TCCAGAGAGTGGCTGGAATGAGG - Intergenic
1138297184 16:55897056-55897078 GGTAGAGGATGGGGGGGATGCGG - Intronic
1138432129 16:56975733-56975755 TGCAGTGGGTGGGGGGAGTGAGG - Intronic
1138994226 16:62428700-62428722 GTCAGAGGGTGGGGGGCAAGGGG + Intergenic
1139334749 16:66223895-66223917 GACAGAGGGTTGAGGGAAAGGGG + Intergenic
1139355861 16:66366788-66366810 GGCGCAGGGTGGCGGGTTTGGGG - Intronic
1139387159 16:66579928-66579950 GGCCGAGGGTGGGGGGAAGGAGG + Intronic
1139835002 16:69831049-69831071 GGCAGAGGGAGGCAGGAAGAAGG + Intronic
1140323828 16:73980775-73980797 GGCAGAAGATGGGGAGAATGAGG + Intergenic
1141253353 16:82378895-82378917 GGATGAGGGTGAGGGGAATGAGG + Intergenic
1141397282 16:83716428-83716450 GGCAAGGGTTGGCGGGAAGGAGG - Intronic
1141846040 16:86609819-86609841 GGTAGAGAGTGGGAGGAATGGGG + Intergenic
1142008217 16:87700493-87700515 GGCAGAGGGTGGAGGGAGGAGGG + Intronic
1142111477 16:88333830-88333852 GGCAGGGGGTGGGGGGGACGTGG + Intergenic
1142133739 16:88442409-88442431 GGCAGAGGACGGCGGGCGTGAGG - Intergenic
1142336626 16:89493458-89493480 GTCAGAGGGTTGTGGGAAGGTGG + Intronic
1143124670 17:4634033-4634055 GACAGAGGGTGGAAGGAGTGAGG + Intronic
1143775362 17:9195525-9195547 GGCAGAGGCTGGCAGGGGTGGGG + Intronic
1143887135 17:10073064-10073086 GGCAAAGGCTCGCTGGAATGAGG + Intronic
1144033440 17:11342346-11342368 GGCAGAGGGAGGCAGGAGAGAGG + Intronic
1144050560 17:11494219-11494241 GGAAGAGAGTGGCAGGGATGAGG - Intronic
1144566182 17:16361399-16361421 GGCTGAGGGAGGAGGGAGTGGGG + Intergenic
1145056454 17:19706808-19706830 GGCAGTGGGGAGCAGGAATGAGG - Intronic
1145721338 17:27075835-27075857 TGCAGAGGGTGGGGGTCATGAGG - Intergenic
1146055500 17:29578785-29578807 GGCAGAGGGAGATGGGAATTGGG + Intronic
1146181518 17:30701315-30701337 GGCTGGGGGAGGAGGGAATGGGG - Intergenic
1147224861 17:38968539-38968561 GGCTGAGGGAAGAGGGAATGGGG + Intergenic
1147538319 17:41335140-41335162 GGCAGAGTGTGGCTGGCTTGCGG + Intergenic
1147743036 17:42679505-42679527 GGCTGAGGGTCGTGGGAAAGGGG - Exonic
1147969631 17:44212495-44212517 GGCAGGGGGAGGGGGGAAGGGGG + Intronic
1147986492 17:44310093-44310115 GGCAGGGGTTGGGGGAAATGAGG - Intronic
1148262088 17:46193013-46193035 GGCAGAGGGGGAGGGGAAGGCGG + Intronic
1148686131 17:49502208-49502230 AGTAGAGGGTGGCGGGCAGGAGG + Intronic
1149202186 17:54199845-54199867 GGCAGGGGTTGGGGGGAAAGGGG - Intergenic
1149257747 17:54846228-54846250 GGCTGAGGAGGGAGGGAATGGGG - Intergenic
1149441766 17:56680117-56680139 GGCATAGGGTGGCGGGGGTAGGG - Intergenic
1149671516 17:58416971-58416993 GGCAGAGGGAGGGGGGAAAAAGG + Exonic
1149698122 17:58633071-58633093 GCCAGAGTGTGGCTGGAGTGAGG - Intronic
1150249820 17:63699419-63699441 GGCAGGGGCTGGGGGGATTGCGG + Intronic
1150481788 17:65516691-65516713 GGCAGAGGGTGGAGGAAGGGAGG + Intergenic
1151133014 17:71917746-71917768 GGCAGAGGTTGGAGGGAAGGAGG - Intergenic
1151316153 17:73323976-73323998 GACAGAGGGTGGGGGGAACAGGG - Intergenic
1151407958 17:73901791-73901813 TGCAGCGAGTGGAGGGAATGAGG + Intergenic
1151559259 17:74861817-74861839 GGGAGAGGGGCCCGGGAATGCGG - Intergenic
1151591462 17:75047289-75047311 GGGAGGGGGCGGCGGGAGTGGGG + Exonic
1152084237 17:78207857-78207879 GGCAGAGGGTAGCTGGCTTGGGG - Intergenic
1152185747 17:78855450-78855472 GGCAGAGGGAGGATGGGATGAGG + Exonic
1152212493 17:79009798-79009820 AGCAGAGGCTGCCGGGAACGCGG - Exonic
1152243916 17:79175482-79175504 GGCCGAGGGTGGGGTGACTGGGG + Intronic
1152589684 17:81205399-81205421 GGCAGTGGGTGGGGGGTAGGAGG + Intronic
1152652146 17:81499685-81499707 GGCGGAGGGTCGGGGGACTGAGG - Intergenic
1152700416 17:81815703-81815725 GGCAGAGGGACTCGGGAATGGGG - Intergenic
1152730086 17:81965876-81965898 GGCACCAGGTGGCGGGGATGAGG + Intergenic
1153275169 18:3360761-3360783 GGCCGAGGGAGGCGGGAAGGAGG + Intergenic
1153856949 18:9159336-9159358 GTCAGAAGGTGGCTAGAATGTGG - Intronic
1156496688 18:37530532-37530554 GGCAGGGGGTAGGGGGAGTGGGG - Intronic
1158155656 18:54422714-54422736 GGCAGGGGGTGGCAGGGAAGAGG + Intergenic
1158661884 18:59396002-59396024 GGCAGCGGGTGACGGGGAGGTGG - Intergenic
1159157708 18:64605863-64605885 GTCAGGGGGTGGGGGGAAAGAGG + Intergenic
1160507946 18:79437678-79437700 GGCAGAGGGTGGAGGGCAGAGGG - Intronic
1160521070 18:79508299-79508321 GACAGAGGGTGCCGGGCAGGAGG + Intronic
1160623155 18:80184780-80184802 GGCTGGGGGTTGGGGGAATGGGG + Intronic
1160790092 19:919129-919151 TGGAGTGGGGGGCGGGAATGGGG + Intronic
1160913205 19:1484133-1484155 GGCAGAGGGGGGTGGGACTCGGG + Intronic
1161158436 19:2747637-2747659 GGCAGTGAGTAGCGGGAGTGTGG + Intergenic
1161158446 19:2747671-2747693 GGCAGTGAGTAGCGGGAATGTGG + Intergenic
1161454676 19:4364010-4364032 AGGTGAGGGTGGCAGGAATGGGG + Intronic
1161730493 19:5957560-5957582 GGCAAAGGGAGGAGGGAAGGTGG - Intronic
1161925249 19:7294510-7294532 GGCACAGGGAGGCGGGGAGGCGG - Intergenic
1163117080 19:15195462-15195484 GGCGGAGGGTGGGGGGATAGAGG - Intronic
1163130187 19:15267617-15267639 GGCAGGGGGTGGGTGGCATGGGG - Intronic
1163761162 19:19137576-19137598 GGCACAGGCTCCCGGGAATGAGG - Intronic
1163830167 19:19543784-19543806 GGCAGCGGGTGTCGGGACAGAGG - Exonic
1164392838 19:27840727-27840749 GGCAGTGGGTGGAGGGAGGGCGG - Intergenic
1165350532 19:35272738-35272760 GGCAGGGGTTGGGGGAAATGTGG + Intronic
1165657328 19:37545214-37545236 GGAAGTGGGTGGCAGGAATGGGG + Intronic
1165984358 19:39754648-39754670 GGCAGAGAGAGGAGGGAGTGAGG + Intergenic
1166121436 19:40689792-40689814 GCCAGGGGGTGGAGGGATTGGGG + Intronic
1166366743 19:42281721-42281743 GGCAGGGAGGGGCGGGAATCCGG - Intronic
1166389725 19:42402229-42402251 GGGAGAGAATGGAGGGAATGGGG + Intronic
1166669690 19:44702404-44702426 GCCAGAGAGTGGCAGGACTGAGG + Intronic
1167081836 19:47281499-47281521 GGCTGAGGGGAGGGGGAATGGGG - Intergenic
1167459772 19:49618749-49618771 GGGAAAGGGTGGAGGGGATGGGG - Intronic
1167706102 19:51082168-51082190 GGCATGGGGTGGCGGGATCGTGG - Intronic
1168246197 19:55114149-55114171 GTCTGAGGGTGGAGGGACTGGGG - Intronic
1168703044 19:58452845-58452867 AGGAGAGGGTGGCAGCAATGTGG + Intronic
925005607 2:440961-440983 AGCAGAGGGTGGGGGGATGGAGG + Intergenic
925055146 2:851447-851469 GGCAGAGTCTGGGTGGAATGAGG - Intergenic
925058817 2:875645-875667 GGCAGAGCCTGGGTGGAATGAGG + Intergenic
925095111 2:1192188-1192210 GGCAGAGGGAGTTGGGAACGTGG + Intronic
925138997 2:1537279-1537301 TGCAGAGGGTGGGGGGGATTTGG - Intronic
925182731 2:1827444-1827466 GGCAGAGGGTGGCGGGAATGAGG - Intronic
925211425 2:2050744-2050766 GGCAGAAGGTAGCGGGACTTGGG + Intronic
925830170 2:7886107-7886129 GGCATAGGGTGGCAGGAAGAAGG + Intergenic
925926527 2:8675176-8675198 GGGAGAGGGTTGAGGGAGTGGGG - Intergenic
925946002 2:8864587-8864609 GGCGGAGCTTGGCGGGAAGGAGG - Intronic
926090161 2:10044087-10044109 GGGAGCGGCTGGCGGGAACGCGG + Intronic
926175596 2:10588914-10588936 TGCAGAGGGTGGAGGGGACGAGG - Intronic
927054049 2:19353967-19353989 GGCAGTGGGTTTTGGGAATGGGG - Intronic
927281824 2:21315428-21315450 GGAAGAGGGTGGGGGGATGGAGG + Intergenic
927288555 2:21381917-21381939 GGCGGGGGTTGGGGGGAATGGGG + Intergenic
927473111 2:23391051-23391073 GGCTGAGGGAGGTAGGAATGGGG - Intronic
929960664 2:46493942-46493964 GGGAGAGGGTGGCGGGGTGGAGG + Intronic
931241077 2:60453024-60453046 GGGAGAGGGAGGAGGGAAAGGGG + Intronic
932043111 2:68319997-68320019 GGTAAAGGGAGGCGGGAAGGGGG + Exonic
932316304 2:70786244-70786266 GGCAGGGGGTGCAGGGAGTGGGG + Intronic
932430668 2:71672067-71672089 GGGAGAAGGTGGCTGGAAGGAGG + Intronic
932680357 2:73819157-73819179 GTCAGAGGGAGGAGGGAATGAGG - Intergenic
933567997 2:83974836-83974858 GGTAGAGGGTGGGAGGAAAGGGG + Intergenic
933666846 2:84971253-84971275 GGCGGCGCGGGGCGGGAATGGGG - Exonic
933748612 2:85588758-85588780 GGCAGAGGATGGGAGGGATGGGG - Intronic
934036396 2:88092144-88092166 AGCAGAAGGTTGGGGGAATGAGG - Intronic
934714505 2:96535953-96535975 GGCTGTGGGAGGTGGGAATGAGG - Intergenic
934845589 2:97659781-97659803 GGCAGAGTGTGAGGAGAATGTGG - Intronic
935015467 2:99177838-99177860 GGCAGTGGGTAGGAGGAATGGGG - Intronic
935637614 2:105261783-105261805 GGCAGAGGCTGGAGGAAAAGGGG + Intergenic
936285748 2:111179974-111179996 CACAGAGAGTGGCTGGAATGGGG - Intergenic
936584399 2:113741271-113741293 GGCTGGGGGTGGTGGGAAAGAGG + Intronic
936639888 2:114300335-114300357 GTCGGAGGGTGGCGGGATAGGGG - Intergenic
937037086 2:118791277-118791299 GGCAAAGGGAGAGGGGAATGGGG - Intergenic
937239986 2:120453768-120453790 TACAGAGGGTGGCCTGAATGTGG + Intergenic
937441990 2:121923685-121923707 GGCAGAGGGTGGGAGGAGAGAGG - Intergenic
937770949 2:125720718-125720740 GGCACAGGATGGTGGGGATGGGG - Intergenic
938287599 2:130130287-130130309 GGTAGATGGTGGGGGGAAAGAGG + Intergenic
938427995 2:131208572-131208594 GGTAGATGGTGGGGGGAAAGAGG - Intronic
939056958 2:137377693-137377715 GGCAGAGGTTGCCGTGAATCAGG - Intronic
939138478 2:138324519-138324541 GGCAGAGTGTGGGCAGAATGAGG - Intergenic
940021284 2:149158510-149158532 GGCTGAGGGTAGAGGAAATGGGG + Intronic
941749073 2:169116545-169116567 AGCAGAGGGTGGCAGGGCTGAGG - Intergenic
942015868 2:171814632-171814654 GGGGGAGGGTGGCAGGAAGGAGG - Intronic
942130102 2:172870059-172870081 GGCAGCGGGACTCGGGAATGAGG - Intronic
942289506 2:174454931-174454953 GGTAGGGGGTGGCAGGGATGGGG + Intronic
942767470 2:179473668-179473690 GTCAGAGGGTAGGGGCAATGGGG - Intronic
942919758 2:181358168-181358190 GGCTGAGGGTGGGGGAAATGGGG - Intergenic
943116964 2:183684621-183684643 GTCAGGGGGTGGTGGGAAAGGGG + Intergenic
944273057 2:197804847-197804869 GGGGGACGGTGGCGGGAGTGGGG - Exonic
944933719 2:204545806-204545828 GGCGGCAGGTGGCGGGAATCGGG - Intronic
944977784 2:205076772-205076794 GGAAGGGGGTGGGGGAAATGGGG - Intronic
945941170 2:215951918-215951940 GATAGAGGGTGGGGGAAATGGGG - Intronic
946025922 2:216671582-216671604 GGCAGTGGGAGGAGGGAATAAGG + Intergenic
946081389 2:217122711-217122733 GGGAGAGGCTGGCTGCAATGTGG - Intergenic
947428342 2:230004058-230004080 GGCAGAGGGTGGCAGGAGGCAGG - Intronic
947636344 2:231682461-231682483 GGCAGAAGGTGGAGAGAATAAGG - Intergenic
947742159 2:232489608-232489630 GGGAGAGGGTGGCTGGAAGGGGG - Intergenic
947921165 2:233875655-233875677 GTCAGGGGGTGGGGGGAAAGGGG - Intergenic
947926512 2:233926435-233926457 GGGAGAGGGTGGAGGGAAAACGG + Intronic
948045484 2:234940549-234940571 GGCAGAGAGTGGAGGGCAGGTGG - Intergenic
948189320 2:236045873-236045895 AGCAGAGGGTGGTGAGCATGGGG + Intronic
948361589 2:237424879-237424901 GACAGAGGGTTGCTGGATTGTGG + Intronic
948371775 2:237494208-237494230 GGCAGAGGGTGGAGGGCAGAGGG + Intronic
948560166 2:238847081-238847103 GGCTCAGGGTGGCTGGAGTGTGG - Intergenic
948787777 2:240361905-240361927 GGCTGAGGGTGGCGAAGATGGGG + Intergenic
948861627 2:240755337-240755359 GGCTGAGTGTGGCGGGAGGGAGG + Intronic
948958687 2:241315443-241315465 GGCAGGTGGTGGCGGGAGTGCGG - Intronic
949021354 2:241742981-241743003 GCCAGAGCGTGGCAGGCATGAGG + Intronic
949032878 2:241805281-241805303 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949032894 2:241805320-241805342 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949032909 2:241805359-241805381 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949032925 2:241805398-241805420 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033069 2:241805741-241805763 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033146 2:241805932-241805954 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033189 2:241806035-241806057 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033205 2:241806074-241806096 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033281 2:241806257-241806279 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033297 2:241806296-241806318 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033313 2:241806336-241806358 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033408 2:241806565-241806587 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033424 2:241806604-241806626 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033470 2:241806717-241806739 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033517 2:241806830-241806852 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033533 2:241806869-241806891 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033549 2:241806908-241806930 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033564 2:241806947-241806969 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033640 2:241807134-241807156 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033656 2:241807173-241807195 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033687 2:241807251-241807273 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033716 2:241807329-241807351 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033810 2:241807562-241807584 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033877 2:241807726-241807748 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033892 2:241807765-241807787 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033993 2:241808007-241808029 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
1168895475 20:1320744-1320766 TCCAGAGGGAGGAGGGAATGGGG + Intronic
1169159069 20:3360989-3361011 AGCAGAGGGTGGCAGGGCTGAGG + Intronic
1169780409 20:9303335-9303357 GGCTGAGGGTAGGGGGAATGTGG - Intronic
1170328192 20:15179399-15179421 GGGAGAGGGTGGGAGGAGTGGGG - Intronic
1170346527 20:15392982-15393004 GGATAAGGGTGGCGGCAATGTGG + Intronic
1171051616 20:21864832-21864854 GGCAGAGGAGGGAGGGGATGAGG + Intergenic
1171051651 20:21865055-21865077 TGCAGAGGCTGGGGGGAGTGGGG + Intergenic
1171073173 20:22095021-22095043 GGAAGTGGGTGGGGGAAATGAGG + Intergenic
1171959350 20:31482697-31482719 GGCAGAGAGGGAAGGGAATGTGG - Intronic
1172109014 20:32534677-32534699 GGCGGGGGGTGGGGGGAGTGGGG - Intronic
1172779373 20:37426767-37426789 GGGAGTGGGTGGAGGAAATGGGG - Intergenic
1172788306 20:37485025-37485047 AGAAGAGGGTGGTGGGAAAGTGG + Intergenic
1173189238 20:40863519-40863541 TTCAGGGGGTGGGGGGAATGAGG - Intergenic
1173320312 20:41981755-41981777 GGGAAAGGGAGGTGGGAATGTGG + Intergenic
1173461138 20:43244253-43244275 GGCTGAGGGAGGGAGGAATGGGG + Intergenic
1173571954 20:44082872-44082894 GGCAGGGGTTGGCTGGAAAGGGG - Intergenic
1173619792 20:44428352-44428374 TGCAGGGGGTGGTGGGCATGGGG - Exonic
1173730481 20:45325135-45325157 GGCAGAGGGTGGGGGCAGAGAGG - Intergenic
1174370194 20:50081865-50081887 AGCAGAGGGTGGCAGGGCTGAGG + Exonic
1174506308 20:51019980-51020002 GGCCCAGGGTGGTGGGACTGTGG - Intronic
1174643010 20:52061445-52061467 AGCAGATGGTTGTGGGAATGGGG - Intronic
1175147957 20:56910981-56911003 GGTAAAGGGTGGCAGGAGTGAGG - Intergenic
1175279209 20:57791939-57791961 TGCACAGGGTGGCGGGGAGGAGG - Intergenic
1175629701 20:60525079-60525101 GACAGAGGGTGGGGGGCAAGGGG + Intergenic
1175766163 20:61594247-61594269 GGAAGAGGGTGGGGGGGAAGAGG + Intronic
1175881499 20:62262089-62262111 GGCAGAGGGTGACGGGGTGGGGG - Intronic
1175954319 20:62600781-62600803 GGCAGAGGGTGCGAGGAACGTGG + Intergenic
1176035124 20:63032427-63032449 GGAAGAGGGCGGTGGGAAGGAGG - Intergenic
1176121573 20:63456523-63456545 GGCTGAGGGTGGCGGTGAGGTGG - Intronic
1176129131 20:63488837-63488859 GGCAGAGGACTGCGGGGATGGGG - Intronic
1177953417 21:27567292-27567314 GGCAGAGTATGGAGGGGATGTGG + Intergenic
1179185797 21:39084422-39084444 GCCAGAAGGTGGAGGGAAGGTGG - Intergenic
1179264634 21:39792375-39792397 GCCATAGGGTGGGGGGAAGGGGG + Intronic
1179438833 21:41379554-41379576 GGTGGGGGATGGCGGGAATGTGG - Intronic
1179810184 21:43865180-43865202 GGCGGAGGGCGGCGGGATGGGGG + Intronic
1179888665 21:44325300-44325322 GACAGATGGTGGCAGGAAAGAGG - Intronic
1180570507 22:16712570-16712592 GTCAGTGGGTGGGGGGAAAGGGG + Intergenic
1180711200 22:17840912-17840934 GGCAGAGGGTGTCTGACATGAGG + Intronic
1180727988 22:17960685-17960707 GTGAGAGGGTGGGGGGAAGGAGG + Intronic
1180728137 22:17961481-17961503 GTGAGAGGGTGGGGGGAAGGAGG - Intronic
1181397003 22:22629819-22629841 GGCAGAGGGAGGAGGGGGTGGGG + Intergenic
1181499748 22:23309178-23309200 GGCAGAGGGAGGAGGGGGTGGGG + Intronic
1181505427 22:23353124-23353146 GTCAGAAGGTGGTGGGGATGGGG + Intergenic
1182012794 22:27014594-27014616 GTCAGATGGTGGCCAGAATGGGG - Intergenic
1182150568 22:28024400-28024422 GACAGAGGGTGGGGGGAAAATGG + Intronic
1182949625 22:34360900-34360922 GTCAGTGGGTGGGGGGAAAGGGG + Intergenic
1183097547 22:35562219-35562241 GGCAGAGGGGGGAGGGATGGAGG + Intergenic
1183197489 22:36363453-36363475 GACAGAGGGAGGCAGGAAGGAGG + Intronic
1183617479 22:38954415-38954437 GACAAAGGGTGGGGGGAATAGGG - Intronic
1183990550 22:41594432-41594454 GGCGGGGGGTGGCGGGGGTGGGG + Intergenic
1184172739 22:42769290-42769312 GGCAGAGGGTGGGGGGCAGCAGG + Intergenic
1184241443 22:43213031-43213053 AGCAGAGGGAGGCGGGTCTGGGG + Intronic
1184468422 22:44682322-44682344 GGCAGACGGTGGAGAGAATGGGG + Intronic
1184892983 22:47390734-47390756 AGCAGCAGGTGGAGGGAATGCGG - Intergenic
1185014439 22:48334933-48334955 GGCACAGGGTGGCGAGGGTGGGG - Intergenic
1185061589 22:48609852-48609874 GGCAGAGGCTGGCGGGAGGCAGG - Intronic
1185110216 22:48896432-48896454 GGCAGGGGGTGGAGGGCATGTGG + Intergenic
949548908 3:5096238-5096260 GGCAGCGGGGGGCGGGGGTGGGG + Intergenic
950032217 3:9860670-9860692 GGCAGAGGAAGGTGGGGATGGGG - Intergenic
950053226 3:10007632-10007654 TGGAGGGGGTGGTGGGAATGGGG + Intronic
950304878 3:11909947-11909969 TGGAGGGGGTGGTGGGAATGAGG + Intergenic
950859861 3:16138215-16138237 GGTAGAGGGGGTGGGGAATGGGG + Intergenic
950861937 3:16155819-16155841 GGCAGTGGGTGGGGGCAATGGGG - Intergenic
951108210 3:18770288-18770310 GGCTGAGGGTGGCGGGCGGGGGG + Intergenic
951462962 3:22970504-22970526 GGCAAAGGGTAGAGGGAATATGG + Intergenic
951540296 3:23776012-23776034 GGCTGAGGCTGGCGGATATGAGG - Intergenic
951711264 3:25586569-25586591 GGCAGTGGGTGGCAGGACTCAGG - Intronic
951860495 3:27246676-27246698 GGCAGGGGTTGGGGGGATTGGGG - Intronic
952550824 3:34475111-34475133 GGCTGGTGGTGGAGGGAATGGGG - Intergenic
953549758 3:43892599-43892621 GGCAGACGGTGGCAGGTTTGGGG + Intergenic
953868982 3:46609762-46609784 GGCAGAGGGAGCAGGGGATGGGG + Intronic
953926564 3:46985646-46985668 GGGAGAAGGTTGTGGGAATGTGG - Intronic
954427121 3:50449305-50449327 GGAAGAGGGTAGCAGGAATTGGG + Intronic
954447967 3:50556868-50556890 GGCAGAAGGTGGGTGGAAGGGGG + Intergenic
954730322 3:52655234-52655256 GCCAGGGGCTGGAGGGAATGGGG - Intronic
954748714 3:52801936-52801958 GACAGAGGAGGGAGGGAATGGGG - Intronic
954777151 3:53029796-53029818 GGTGGAGGGTGGGGAGAATGGGG + Intronic
954993531 3:54861412-54861434 GGCAGGGAGTGGCGAGAAAGAGG + Intronic
955615585 3:60803587-60803609 GGCTGAGGGTGGTGTGAGTGGGG + Intronic
957958804 3:87224248-87224270 GTCAGGGGGTGGGGGGAAAGGGG - Intergenic
958851969 3:99338321-99338343 GGCTGAGGGTGGGAGGATTGGGG - Intergenic
958937663 3:100274564-100274586 GGCAGAGGGAGGGGAGAATGAGG - Intronic
959678555 3:109066019-109066041 GGGAGAGGGAGGCAGGGATGGGG + Intronic
960347212 3:116547830-116547852 GGCTGAGGGTGGGGGGAAAGGGG + Intronic
960638962 3:119809538-119809560 GGCGGGGGGTGGGGGGAAGGCGG + Intronic
960940050 3:122927690-122927712 TGCAGAGGTTGGCAGGAAGGAGG + Intronic
961013388 3:123449782-123449804 GGCAGCGGGAGGAGGGGATGCGG - Intergenic
961075612 3:123979287-123979309 GGCAGATGGTGGGGAGAGTGTGG - Intronic
961142716 3:124568822-124568844 GCCAGGGGCTGGAGGGAATGGGG + Intronic
961301664 3:125925752-125925774 GGCAAAGGCTGGTGGCAATGGGG - Intergenic
961308073 3:125973221-125973243 GGCAGATGGTGGGGAGAGTGTGG + Intronic
961528406 3:127524127-127524149 GGCGGGGGGTGTAGGGAATGGGG - Intergenic
961674407 3:128555873-128555895 GGGGGAGGGTGGCGGGCATGTGG - Intergenic
961773535 3:129267795-129267817 GGCGGAGGGTGGAGGGAGTGAGG - Intronic
961886800 3:130102103-130102125 GGCAGAGTCTGGTGGCAATGGGG + Intronic
962575521 3:136752151-136752173 GGCGGCGGGGGGCGGGAAAGAGG - Intronic
962835544 3:139185527-139185549 GGCAGGGGGTGGGGGAGATGGGG + Intronic
962841358 3:139235574-139235596 GGCAGATGGTGATGGGAATTTGG - Intronic
963107628 3:141660299-141660321 GGCGGAGGCTGGAGGGACTGTGG - Intergenic
963584322 3:147165038-147165060 GTCAGAGGGTGGGGGGTAGGAGG + Intergenic
963605484 3:147409257-147409279 GGCTGAGGGCGGGGGGAATGCGG + Intronic
963679838 3:148360673-148360695 GTCATGGGGTGGGGGGAATGGGG - Intergenic
963923783 3:150930233-150930255 AGCAGAGGGAGGCTGGACTGTGG + Intronic
964045810 3:152325077-152325099 GGCGGGGGGGGGCGGGTATGTGG - Intronic
965066097 3:163850636-163850658 GGCAGGGGGTGGAGGGGAGGAGG + Intergenic
965530888 3:169769199-169769221 GGCTGGGGGTGGGGGGACTGGGG - Intronic
965558501 3:170040020-170040042 GTCGGAGGGTGGGGGGAAAGGGG + Intronic
966311272 3:178596679-178596701 GGCGGGGGTTGGTGGGAATGTGG - Intronic
966341312 3:178927803-178927825 GTCATGGGGTGGGGGGAATGAGG + Intergenic
966476260 3:180351044-180351066 GGCTGGGGGTGGAGGAAATGGGG - Intergenic
966945708 3:184775764-184775786 GTCAGAAGGTGCAGGGAATGAGG - Intergenic
967818652 3:193819682-193819704 GGGAGAAGGTGGCTGGACTGAGG + Intergenic
967859825 3:194142034-194142056 GGCGGAGGCTGGTGGGAATTGGG - Intergenic
968123883 3:196144405-196144427 GGCAGAGGGTGACAGGAAGGTGG - Intergenic
968888966 4:3356528-3356550 GGTTGGGGGTGGGGGGAATGGGG - Intronic
968995967 4:3946108-3946130 GGCAAAGGCTGGTGGCAATGGGG + Intergenic
969495328 4:7523082-7523104 GGCAGAGGGAGGAGGGAAATGGG - Intronic
969544396 4:7815242-7815264 GGCTGGGGGAGGAGGGAATGGGG + Intronic
969581239 4:8066738-8066760 GGCTGGGGGAGGAGGGAATGGGG + Intronic
969588436 4:8107870-8107892 GCCAGAGGGAGGCGTGACTGTGG + Intronic
969868972 4:10093204-10093226 AGCTGAGGCTGGGGGGAATGGGG - Intronic
970261208 4:14227007-14227029 GGCAGAGGGAGGGGGGAAACTGG - Intergenic
970400163 4:15709529-15709551 TGCAGAGGGTGGGGAGAAGGAGG + Intronic
973042799 4:45494112-45494134 AGCAGGGGGTGGAGGAAATGAGG - Intergenic
973333663 4:48934618-48934640 GGGTGAGGGTGGCAGGAATGTGG - Intergenic
974059698 4:57020430-57020452 GGCAGAAGGAGAGGGGAATGGGG + Intronic
975619803 4:76285008-76285030 GCCAGAGGGTGGAGGGCAAGGGG - Intronic
978828000 4:113047786-113047808 GGAGGAGGGTGGAGGGAGTGAGG + Intronic
978932272 4:114329644-114329666 GTCAGAGGGTGGGGGGATAGGGG - Intergenic
980580688 4:134746285-134746307 GGTAAAGGGTGGCGGGGTTGGGG + Intergenic
981816740 4:148839667-148839689 GGGAGAGGGTTGGGGGAAAGAGG + Intergenic
983978083 4:173961330-173961352 GGCTGGGGGTGGTGGAAATGGGG - Intergenic
984212685 4:176869960-176869982 GTCAGAGGGTGGTGGGGAAGGGG - Intergenic
984918420 4:184743489-184743511 GGCAGAGGGAAGAGGGAAAGGGG + Intergenic
985426407 4:189835638-189835660 GATAGAGGGTGGAGGGAATCAGG - Intergenic
985941223 5:3137896-3137918 GGCAGGGCGTGGCTGAAATGGGG + Intergenic
985996614 5:3600527-3600549 GGCAGAAGTTGGTGGGAAGGAGG + Intronic
986206775 5:5631902-5631924 GGGAGAGGGTGTCGTGAAGGTGG - Intergenic
986467884 5:8045179-8045201 GTCAGAGGGTGGAGGGCAAGGGG + Intergenic
986743891 5:10727476-10727498 GTGAGAGGGTGGTGGGGATGGGG + Intronic
986827463 5:11537044-11537066 GGCAGCAGGTGGGGGGAAGGAGG + Intronic
987104887 5:14628883-14628905 GGCTGAGGGTTTGGGGAATGGGG - Intergenic
987514264 5:18885872-18885894 AGCAGAGGGTGGCAGGGCTGAGG + Intergenic
988144805 5:27291998-27292020 GGCAGAGGGTGGGGGGAGTGGGG + Intergenic
988318100 5:29657807-29657829 GTCAGAGGGTGGAGGGAGAGAGG + Intergenic
989194982 5:38707661-38707683 GGGAAAGGGTGGGGGCAATGGGG + Intergenic
989813271 5:45704317-45704339 GTCAGGGGGTGGGGGGAAGGGGG - Intergenic
990024364 5:51167438-51167460 GGCTGAGGGAGGGAGGAATGGGG - Intergenic
990303454 5:54472341-54472363 AGCAGAGGGTGGAAGGAAAGGGG + Intergenic
990717378 5:58653119-58653141 GTCAGAGGGTGGGGGGCAAGGGG - Intronic
990804108 5:59638601-59638623 GGTAGAGGGTGGGGGCACTGAGG - Intronic
991680523 5:69134891-69134913 GGAAGAGGGGAGGGGGAATGAGG + Intergenic
992550666 5:77856639-77856661 GGCAGAGGGTGGTGGTGTTGGGG - Intronic
992627718 5:78649346-78649368 GGAAGAGGGCGGCGAGGATGGGG - Intronic
992716281 5:79514136-79514158 GGCTGCGGGGGGCGGGAAGGGGG + Exonic
993662440 5:90654378-90654400 GGTAGAGGGTGGTGGGCGTGAGG + Intronic
994447774 5:99899673-99899695 GGCTGAGGATGAAGGGAATGAGG - Intergenic
994479206 5:100311471-100311493 GTCAGGGGGTGGGGGGAATAGGG + Intergenic
994947508 5:106414811-106414833 TGGAGAGGATGGAGGGAATGGGG + Intergenic
995249511 5:109974999-109975021 GGCAGAGGGAGCAGGAAATGGGG - Intergenic
997013342 5:129904398-129904420 GGGAGCGGGAGGCGGGAGTGAGG + Intergenic
997237289 5:132280200-132280222 GGCACAGGGTGACAGGACTGAGG - Intronic
997672049 5:135683238-135683260 GGCAGAGAGTTCTGGGAATGAGG + Intergenic
997737494 5:136224776-136224798 AGCAGAGGGTGGAGGGAGTGAGG - Intronic
997875517 5:137543261-137543283 GTCATAGGGTGGGGGGAGTGGGG + Intronic
997964704 5:138347882-138347904 GGCAGAGGGTGAGGGGAAAAGGG - Exonic
998139214 5:139690460-139690482 GGCAGAGGGAGGCAGGAAGGAGG - Intergenic
998172600 5:139881319-139881341 GGCAGAGGCAGCTGGGAATGAGG - Intronic
998390287 5:141783080-141783102 GGCAGGAGGTGGAGGGCATGTGG - Intergenic
998630829 5:143896798-143896820 GGCAGAGGGTGGGGTGGAGGTGG + Intergenic
998651736 5:144128313-144128335 GCCAAAGGTTGGAGGGAATGTGG + Intergenic
998861356 5:146447352-146447374 GGCGGAGCGTGGCGGGGACGGGG + Exonic
999255642 5:150208735-150208757 GGCAGAGGGATTTGGGAATGTGG + Intronic
999657645 5:153826323-153826345 GGCAGAGAATGGCGTGAAGGTGG + Intergenic
999746065 5:154592905-154592927 GGTCGAGGGTGGGGGAAATGGGG - Intergenic
999961469 5:156760664-156760686 GGTAGCTGATGGCGGGAATGAGG - Intronic
1000284010 5:159810791-159810813 GTCATGGGGTGGCGGGAGTGTGG + Intergenic
1001560459 5:172665696-172665718 GGCAGGGGGAGGCTGGAATTTGG - Intronic
1002019920 5:176356942-176356964 GGGAGTGGGTGGGGGGAGTGAGG + Intronic
1002160401 5:177311349-177311371 GGCCGGGGGCGGCGGGAGTGGGG - Intronic
1002519397 5:179782968-179782990 GGGGGAGGGTGGCGGGGCTGGGG - Intronic
1003464863 6:6369263-6369285 GGGAGAGGGAGGAGGGAAGGAGG + Intergenic
1004505812 6:16245920-16245942 GGCAGAGGTTGGCGGAAGTCAGG - Intronic
1004583751 6:16979499-16979521 GGCAGAGGTTGGAGAGAATGTGG - Intergenic
1007187097 6:39981197-39981219 TGCAGTGGGTGGCGGGGAAGAGG + Intergenic
1007239732 6:40416402-40416424 CCAAGGGGGTGGCGGGAATGAGG + Intronic
1007716835 6:43861689-43861711 GGTAGAGGGTGGCGGCGAAGCGG + Intergenic
1007786696 6:44284316-44284338 GCCAGAGGGAGGAGGAAATGGGG - Intronic
1008932511 6:56955060-56955082 GCCTGCGGGGGGCGGGAATGGGG + Intergenic
1009561547 6:65251847-65251869 GGCACAGGGAGGCTGGGATGGGG - Intronic
1009808695 6:68634977-68634999 GGGAGAGGCTGGCGGGAGGGGGG - Intergenic
1010181986 6:73097222-73097244 GGCTGGGGGTTGGGGGAATGGGG - Intronic
1011404760 6:87007335-87007357 TGCAGGGGGTGGAGAGAATGGGG + Intronic
1011818661 6:91224088-91224110 GTCAGAGGGTGGGGGGATAGGGG + Intergenic
1013004626 6:106060795-106060817 GGGAGTGGGTGGCTGGGATGGGG + Intergenic
1013119083 6:107125654-107125676 GGCAGGGGGTGCAGAGAATGTGG - Intergenic
1013563961 6:111337064-111337086 GGTAGAGGGTGGGGGGACTCTGG + Intronic
1013780931 6:113727570-113727592 GGGAGTGGGTGGAGTGAATGGGG - Intergenic
1015211992 6:130708919-130708941 GCCAGAGGGTGGAGGGAAGAGGG + Intergenic
1015779044 6:136844647-136844669 GGCTGGGGGTGGGGGAAATGGGG - Intronic
1016013577 6:139162720-139162742 AGCAGAGGGTGGTGGCAATGTGG - Intronic
1016368980 6:143351735-143351757 GTCAGAGGGTGGAGGGAAAGGGG - Intergenic
1017790116 6:157790539-157790561 GGCTGGGGGTGGGGGGAGTGGGG - Intronic
1018032234 6:159850426-159850448 GGCAGGGGCTGGAGGGATTGGGG + Intergenic
1019153288 6:170023247-170023269 GACAGAGGGCGGCGGGAGCGAGG - Intergenic
1019159771 6:170062273-170062295 GGAGGAGGATGGCTGGAATGGGG - Intergenic
1019421924 7:954613-954635 CCCAGAGGGCGGCGGGAATGCGG - Intronic
1019443992 7:1061434-1061456 AGCAGAGGCTGGCGGGAACCTGG - Intronic
1019743809 7:2688563-2688585 GGGAGAGGATGGCGGGGAGGGGG - Intronic
1019990694 7:4688666-4688688 AGCAGAGGGTGCCGGGCGTGGGG - Intronic
1020320240 7:6934517-6934539 GGCAGAGGCTGGTGGCAATGGGG + Intergenic
1022225680 7:28360559-28360581 GGCAGAGAGTGGGGGAAATAGGG + Intronic
1022256216 7:28661064-28661086 GGAATGGGGTGGTGGGAATGGGG + Intronic
1023589868 7:41770338-41770360 GTCAGAGGATGGGGGGAAAGGGG + Intergenic
1023602307 7:41892077-41892099 GTCAGAGGGTGGGCGGAGTGGGG + Intergenic
1023818983 7:43969899-43969921 GGCTGAGGGTGGAGGGTATGGGG - Intergenic
1024519294 7:50290032-50290054 GGCAGGGGATGGGGGGATTGTGG - Intergenic
1024599211 7:50964701-50964723 GGGAGTGGGGGGCGGGAAGGTGG - Intergenic
1025257492 7:57394834-57394856 GGTTGAGGGAGGCAGGAATGGGG - Intergenic
1026019178 7:66694738-66694760 GACAGAGGGTGGAGGGGAGGGGG + Intronic
1026343342 7:69452883-69452905 GGCTGAGGGAGGGAGGAATGGGG + Intergenic
1026962628 7:74418222-74418244 GGGAGAGGGTGGCTGGGAGGGGG - Intergenic
1026980501 7:74523935-74523957 GGGAGAGGGTGGAAGGACTGGGG + Intronic
1027809292 7:82873303-82873325 GGAAGAGGATGACGGGAGTGTGG - Intronic
1027823976 7:83087064-83087086 GTCATAGGGTGGGGGGAAGGGGG + Intronic
1029444036 7:100603114-100603136 GGCAGAGTGAGGCGGGAGTCTGG + Intronic
1029690098 7:102175560-102175582 TGCAGAGGCTGGCAGGAGTGTGG - Intronic
1029744036 7:102506862-102506884 GGCTGAGGGTGGAGGGTATGGGG - Intronic
1029762026 7:102606025-102606047 GGCTGAGGGTGGAGGGTATGGGG - Intronic
1030910848 7:115247098-115247120 GTCAGAGGGTGGAGGGAAAGAGG - Intergenic
1031664947 7:124472416-124472438 GGCAGAGGGTGGGTGGTAGGGGG + Intergenic
1032125524 7:129189724-129189746 AGCAAAGGATGGCGGGGATGAGG + Intronic
1032885999 7:136138942-136138964 GGCAGAAGTTGGCTGGGATGAGG + Intergenic
1032963158 7:137064001-137064023 GCCAGAGGGTGGAGGGACTGGGG + Intergenic
1033411962 7:141126282-141126304 GATAGAGGGTGGTGGGGATGGGG + Intronic
1033614031 7:142993971-142993993 GTCAGAGGGTGGGGGGCAAGGGG + Intergenic
1033657209 7:143381980-143382002 GGGAGTGGGAGTCGGGAATGTGG + Intronic
1033859599 7:145608293-145608315 GTCAGAGGGTGGGGGGCAAGAGG - Intergenic
1034272527 7:149810197-149810219 GTCAGAGGGTGGTAGGAATTGGG + Intergenic
1034838439 7:154373783-154373805 GGCTGCGGGAGGAGGGAATGGGG - Intronic
1035049984 7:155993169-155993191 GGCTGATGGAGGCAGGAATGAGG - Intergenic
1035049998 7:155993259-155993281 GGCTGATGGAGGCAGGAATGAGG - Intergenic
1035050015 7:155993349-155993371 GGCTGATGGAGGCAGGAATGAGG - Intergenic
1035050032 7:155993439-155993461 GGCTGATGGAGGCAGGAATGAGG - Intergenic
1035050048 7:155993529-155993551 GGCTGATGGAGGCAGGAATGAGG - Intergenic
1035189332 7:157152149-157152171 GGCAAAGGGTGTAGGGAAAGTGG + Intronic
1035230567 7:157463573-157463595 GGCGGATGGGGACGGGAATGGGG - Intergenic
1035365417 7:158346285-158346307 GGCCAGGGGTGGAGGGAATGGGG - Intronic
1035372256 7:158386983-158387005 GGCTGAGGATGGGGGGACTGTGG + Intronic
1035553422 8:545785-545807 GGCGGTGGGGGGCGGGGATGGGG + Intergenic
1036037271 8:5032582-5032604 GGGAGAGGGTGGAGGGGAAGTGG + Intergenic
1036848293 8:12184715-12184737 GGCAGAGGCTGGTGGCAATGGGG + Intronic
1036869655 8:12426996-12427018 GGCAGAGGCTGGTGGCAATGGGG + Intronic
1038329127 8:26593746-26593768 GGCAGAGGGGAACTGGAATGTGG + Intronic
1038935596 8:32246805-32246827 GGATGGGGGTGGAGGGAATGGGG + Intronic
1040414666 8:47185644-47185666 GGCAGAGGGAGAAGGAAATGGGG - Intergenic
1041173558 8:55170366-55170388 GCAAGAGGGAGGCAGGAATGGGG + Intronic
1041416324 8:57612874-57612896 GCCAGAGAATGGCGGGAATACGG + Intergenic
1041958806 8:63587546-63587568 GCGGGGGGGTGGCGGGAATGAGG - Intergenic
1042466185 8:69132245-69132267 GCCAGAGGGTGGGGGAAAGGGGG + Intergenic
1042612666 8:70615378-70615400 GGCAGAGGGTGTTGGGGATTTGG + Intronic
1042965800 8:74350596-74350618 GGCGGAGGGTGGCGCGGATCGGG + Intronic
1043397814 8:79855871-79855893 GTCAGAGGGTGGAGGGTAAGAGG - Intergenic
1044405788 8:91824466-91824488 GTCAGGGGGTGGGGGGAAAGGGG + Intergenic
1044427806 8:92073367-92073389 GGCAGAGGCTGGGGGGCAGGAGG - Intronic
1044575987 8:93769304-93769326 GGCAGAGGGTGGAGGAAGCGAGG + Intronic
1045402783 8:101835335-101835357 GGCAGAAGGTGGAGGGAAGCGGG - Intronic
1045491291 8:102671309-102671331 GGAGGAGGGTGGAGGGACTGGGG - Intergenic
1046446304 8:114324941-114324963 GCCAGAGGGTGGGGGGAAGGGGG + Intergenic
1047560289 8:125979980-125980002 GGGAGGGGGTAGCGGGGATGAGG + Intergenic
1047647491 8:126884035-126884057 GTCAGAGGATGGCAGGTATGGGG + Intergenic
1047907935 8:129492743-129492765 GTCAGGGGGTGGGGGGAAAGGGG + Intergenic
1048571837 8:135663218-135663240 GCCAGAGGGTGAAGGGCATGAGG - Intergenic
1048643079 8:136386260-136386282 GGCTAAGGGTGGTGGGAATATGG + Intergenic
1048822180 8:138390753-138390775 GGCAGAGGAAGGTGGGGATGCGG + Intronic
1049141911 8:140962685-140962707 GGCAGAGAATGGCGTGAATCGGG + Intronic
1049153882 8:141055477-141055499 GGCAGAGGGTGCCTGGACTGCGG + Intergenic
1049423367 8:142526513-142526535 GGCAGAGAGTGGTGGGGGTGTGG - Intronic
1050985639 9:12078661-12078683 GGAAGGGGGTGGGGGGAAGGAGG - Intergenic
1051216293 9:14801507-14801529 GGCTGAGGGTGGGAGGATTGGGG - Intronic
1051363329 9:16301646-16301668 GGCTGGGGGTGGTGGGAAAGGGG + Intergenic
1052142419 9:25003861-25003883 GGCAGAGGGTGGCGGGGGAGGGG + Intergenic
1052968165 9:34358153-34358175 GCCAGAGGCTGGGAGGAATGGGG - Intergenic
1053242093 9:36504355-36504377 TGCAGATGGTGGCGGGAAGACGG + Intergenic
1053294149 9:36901106-36901128 GACAGAGGGTGGAGGTAAGGAGG - Intronic
1053474891 9:38375640-38375662 GGCATAGGGTGGGGGGTCTGGGG + Intergenic
1056111288 9:83397508-83397530 GGGAGAGGCTCGCTGGAATGAGG + Intronic
1056544611 9:87603244-87603266 GGCGGAGGGTGGCAGAGATGGGG - Intronic
1056622267 9:88224355-88224377 TGCAGACGGTGGTGGGAATGTGG - Intergenic
1056643328 9:88388787-88388809 GGCGGGGGGCGGCGGGGATGGGG - Intronic
1056689828 9:88798642-88798664 GGCAGACGGTGGGGACAATGAGG + Intergenic
1056781065 9:89551525-89551547 GGTGGGGGGTGGGGGGAATGGGG - Intergenic
1057121244 9:92576332-92576354 GGCAAAGGGAGGAAGGAATGGGG + Intronic
1057210239 9:93197260-93197282 GGCAGGGGGTGGAGGTGATGTGG - Intronic
1057853716 9:98585487-98585509 GGCGTAGGGTGGGGGGAGTGGGG + Intronic
1058218587 9:102266772-102266794 GGCAGGGGGTGGGGGAAGTGGGG - Intergenic
1059586240 9:115610023-115610045 GGCTGAGGGTGGAGGAAACGAGG + Intergenic
1059587859 9:115625538-115625560 GGCAGAGGCTTGGGGGAATAAGG + Intergenic
1059780166 9:117517923-117517945 GGAAGAGGAGGGTGGGAATGAGG - Intergenic
1060233272 9:121841220-121841242 CGAAGAGTGTGGCGGGAATGGGG + Intronic
1060471327 9:123950911-123950933 GGTTGAGGGAGGAGGGAATGGGG + Intergenic
1060473532 9:123968509-123968531 GCTAGAGGGAGGGGGGAATGGGG - Intergenic
1060481847 9:124021018-124021040 GGCAGTGGGTGGGGCGAGTGTGG + Intronic
1060725251 9:126002012-126002034 GGCTGTGGGAGGCGTGAATGGGG + Intergenic
1060785335 9:126448103-126448125 GTCAGAGGCTGGCAGGGATGTGG - Intronic
1061184254 9:129042778-129042800 GTCAGAGGGGGTCGGGGATGTGG + Intronic
1061547466 9:131313075-131313097 GGCACAGGGAGGCGGGATGGGGG + Intergenic
1061779605 9:132987806-132987828 GGTAGAGGGTGGTGGGAAGGGGG + Intronic
1061896679 9:133651980-133652002 GGCAGATGGTGGTGGGATTCGGG + Intronic
1062139112 9:134945680-134945702 GGCAGAGGGTGGAGGGCAGAGGG + Intergenic
1062360135 9:136183714-136183736 GGAAGTGGGGGGCAGGAATGGGG + Intergenic
1062443957 9:136585611-136585633 GGCAGAGGGTGGCTGGAGCTGGG + Intergenic
1062483244 9:136762143-136762165 GGGAGAGGCTGGGGGGCATGGGG + Intronic
1062513566 9:136921190-136921212 GGGAGAAGATGGCGGGTATGCGG - Exonic
1062523620 9:136969680-136969702 GGCAGAGGGAGGCTGGGCTGGGG - Intronic
1185984405 X:4815049-4815071 GGCTGAGGGGTGGGGGAATGGGG - Intergenic
1186517171 X:10174643-10174665 GGCACAGGGTGGGGGGAATTAGG - Intronic
1186917305 X:14237299-14237321 GCCAGAGGCTGGTGGGAAGGGGG + Intergenic
1187155557 X:16717812-16717834 GGATGGGGGTGGGGGGAATGGGG - Intergenic
1187190885 X:17033884-17033906 GCCAGAGAGTGGAGGGAAAGCGG - Intronic
1188980456 X:36722164-36722186 GGCAGAGGCTGGAGTGACTGTGG + Intergenic
1189056313 X:37702655-37702677 GGAAGAGTGTGGAAGGAATGTGG - Intronic
1189069350 X:37847429-37847451 CGCAGAGGAAGGCGGGAGTGGGG + Intronic
1189313452 X:40036230-40036252 GGGAGAGGGTGGAGGGAAGGAGG - Intergenic
1189407197 X:40735617-40735639 GGCGGGGGGAGGCGGGGATGGGG + Intronic
1190074252 X:47304327-47304349 GGCTGAGGGTGAGGGGAATAGGG - Intergenic
1190107129 X:47568924-47568946 GGGAAAGGGTGGGGGAAATGAGG + Intronic
1190107550 X:47570850-47570872 GGCAGACGGGGGCAGGAAAGGGG - Intronic
1190180077 X:48184673-48184695 GGGAGAGGGTGCCAGGAAGGAGG - Intergenic
1190189964 X:48268847-48268869 GGGAGAGGGTGCCAGGAAGGAGG + Intronic
1190193094 X:48293893-48293915 GGGAGAGGGTGCCAGGAAGGAGG - Intergenic
1190197191 X:48329540-48329562 GGGAGAGGGTGCCAGGAAGGAGG + Intergenic
1190199067 X:48344872-48344894 GGGAGAGGGTGCCTGGAAGGAGG - Intergenic
1190204898 X:48394785-48394807 GGGAGAGGGTGCCTGGAAGGAGG + Intergenic
1190205638 X:48400618-48400640 GGGAGAGGGTGCCTGGAAGGAGG - Intergenic
1190358969 X:49631505-49631527 GTCAGAGGGTGGGGGGCAAGGGG - Intergenic
1190659599 X:52642506-52642528 GGGAGAGGGTGCCAGGAAGGAGG - Intergenic
1190663928 X:52679918-52679940 GGGAGAGGGTGCCAGGAAGGAGG + Intronic
1190675494 X:52778504-52778526 GGGAGAGGGTGCCAGGAAGGAGG - Intronic
1190732447 X:53234601-53234623 TGCAGGGGGTGGCGGCCATGTGG + Exonic
1191914601 X:66188055-66188077 ACCAGAGGGTGGCAGGAATGTGG + Intronic
1191954921 X:66633931-66633953 GGGACAGGGTGGAGGGAGTGTGG - Intronic
1192037236 X:67577113-67577135 GTCAGGGGGTGGGGGAAATGGGG - Intronic
1192319067 X:70074675-70074697 GGCTGAGGGGAGTGGGAATGGGG - Intergenic
1192358197 X:70422980-70423002 GGCACAGGCTGGCGGGAAGCTGG - Intergenic
1192452397 X:71252533-71252555 GGGAGAGGGTGGTGGTAAGGAGG - Intronic
1192691746 X:73372570-73372592 GGCAGTGGTTGGTGGGAGTGGGG + Intergenic
1192758659 X:74072146-74072168 GTCAGCGGGTGGGGGGAAAGGGG - Intergenic
1193096557 X:77555701-77555723 GTCAGGGGGTGGGGGGAAAGGGG + Intronic
1194148128 X:90288644-90288666 AGCAGAGGGTGGCAGGGCTGAGG + Intergenic
1194663891 X:96656104-96656126 GGCAGTCAGTGGCGGGAGTGAGG - Intergenic
1195000863 X:100642009-100642031 GGCAGAGGGTGTCCAGAATGAGG + Intergenic
1195996402 X:110736049-110736071 GGCAGAGGGTGCAAGGAAAGTGG + Intronic
1196174524 X:112626477-112626499 GTCAGGGGGTGGCGGGGGTGGGG - Intergenic
1196419540 X:115507961-115507983 GGCAGCGGGTGGCAGGGAGGGGG - Intergenic
1197658695 X:129146323-129146345 GGTGGAGGGTGGAGGCAATGAGG + Intergenic
1197692928 X:129522782-129522804 GGCAGAGGCCGACGGGAAGGCGG + Intronic
1197762876 X:130039958-130039980 GGCAGGGGGAGGAGGGAAGGAGG + Intronic
1198223589 X:134625239-134625261 GGCAGAGGGTGAGAGAAATGGGG + Intronic
1198514099 X:137386990-137387012 GGAAAAGGGTGGCAGGGATGGGG + Intergenic
1198773123 X:140151620-140151642 GTCGGAGGGTGGGGGGAAAGGGG - Intergenic
1199088130 X:143652868-143652890 GTCAGGGGGTGGCGGGCAAGGGG + Intergenic
1199770001 X:150969221-150969243 GGCTGAGGGGAGGGGGAATGAGG - Intergenic
1199861474 X:151804241-151804263 GGTGGAGGGTGGGGGGAAAGGGG - Intergenic
1200102820 X:153696503-153696525 GGGTGAGGGTGGCGGGCCTGCGG + Exonic
1200267830 X:154655284-154655306 GGGTGAGGGTGGCGGGCCTGCGG + Intergenic
1200494513 Y:3865415-3865437 AGCAGAGGGTGGCAGGGCTGAGG + Intergenic
1201294506 Y:12452169-12452191 GGCAGAGGGTGGGAGGAGAGTGG + Intergenic
1201782861 Y:17742683-17742705 GGCTGAGGGTGGAGGAAAGGTGG + Intergenic
1201818692 Y:18163304-18163326 GGCTGAGGGTGGAGGAAAGGTGG - Intergenic