ID: 925182732

View in Genome Browser
Species Human (GRCh38)
Location 2:1827451-1827473
Sequence CCTTCTAGGCAGAGGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 278}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925182732_925182745 12 Left 925182732 2:1827451-1827473 CCCGCCACCCTCTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG 0: 1
1: 1
2: 0
3: 9
4: 100
925182732_925182744 8 Left 925182732 2:1827451-1827473 CCCGCCACCCTCTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 925182744 2:1827482-1827504 GAGAGTTGAGGGGACCTCTCTGG 0: 1
1: 1
2: 2
3: 18
4: 177
925182732_925182746 13 Left 925182732 2:1827451-1827473 CCCGCCACCCTCTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 925182746 2:1827487-1827509 TTGAGGGGACCTCTCTGGTTGGG 0: 1
1: 0
2: 2
3: 11
4: 97
925182732_925182748 20 Left 925182732 2:1827451-1827473 CCCGCCACCCTCTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 172
925182732_925182747 19 Left 925182732 2:1827451-1827473 CCCGCCACCCTCTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 162
925182732_925182743 -2 Left 925182732 2:1827451-1827473 CCCGCCACCCTCTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 925182743 2:1827472-1827494 GGGGATCTCAGAGAGTTGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 183
925182732_925182742 -3 Left 925182732 2:1827451-1827473 CCCGCCACCCTCTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 234
925182732_925182749 21 Left 925182732 2:1827451-1827473 CCCGCCACCCTCTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 925182749 2:1827495-1827517 ACCTCTCTGGTTGGGAAAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 220
925182732_925182741 -4 Left 925182732 2:1827451-1827473 CCCGCCACCCTCTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 925182741 2:1827470-1827492 AAGGGGATCTCAGAGAGTTGAGG 0: 1
1: 1
2: 0
3: 21
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925182732 Original CRISPR CCTTCTAGGCAGAGGGTGGC GGG (reversed) Intronic
900287431 1:1908441-1908463 CCATCACTGCAGAGGGTGGCAGG + Intergenic
901071287 1:6520021-6520043 CCTGCCAGGCAGAGAGGGGCTGG + Intronic
901221857 1:7587935-7587957 CCATCTGGGCCGAGGGAGGCGGG - Intronic
901779997 1:11587626-11587648 GCTTATAGCCAGATGGTGGCTGG - Intergenic
902667313 1:17948657-17948679 CATGCTCGGGAGAGGGTGGCGGG - Intergenic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
903859743 1:26357390-26357412 GCTTCCAGGCATAGGGTGACTGG + Intergenic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
905869434 1:41394707-41394729 CCCTCTGGGGAGAGGGTGGTGGG + Intergenic
906567947 1:46813890-46813912 CCTGCTAAGCAGAGGGTAGGAGG - Exonic
908640585 1:66218603-66218625 TCTTCTGGGCTGGGGGTGGCTGG - Intronic
908829906 1:68168487-68168509 CCATCTAGTCCCAGGGTGGCTGG + Intronic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
910934970 1:92480258-92480280 ACTTCCAGGCAGAGAGTGGCTGG + Intronic
912306370 1:108571724-108571746 CCTCCTAGGAAGTGGGCGGCAGG - Intronic
912521865 1:110251059-110251081 GCTTCTACCCAGAGGGTGGCAGG + Intronic
912550955 1:110484988-110485010 CCGTGTGGGCAGAGAGTGGCTGG - Intergenic
913205502 1:116534567-116534589 CCTTCAGGGCAGTGGGCGGCAGG + Intronic
915624676 1:157107335-157107357 ACTACTGGGCAGAGGGAGGCAGG - Intergenic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
920226603 1:204443597-204443619 CCTGCAAGGCAGAGGGAGTCAGG + Exonic
921079724 1:211729391-211729413 GCTTCTAAGCAGTTGGTGGCAGG + Intergenic
922752468 1:228077018-228077040 GCTTCCAGGCAGAGGCTAGCAGG - Intergenic
922755332 1:228093445-228093467 ACATATGGGCAGAGGGTGGCTGG - Intronic
1063308804 10:4933611-4933633 CCTGGTAGGCAGTGGGTGCCTGG - Intronic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1067693687 10:48520465-48520487 CCTTCAAGGCAGAGCCTGACAGG + Intronic
1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG + Intergenic
1067834390 10:49629152-49629174 CCTTATAGGCAGTGGGTAGGAGG - Intronic
1068351071 10:55845921-55845943 CCTCCTAGGCAGTGTGTGGGGGG - Intergenic
1068892630 10:62163606-62163628 CCTTCTAGGCAGATGATGCCTGG + Intergenic
1070661636 10:78310728-78310750 CCTTTGACACAGAGGGTGGCTGG + Intergenic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1072623813 10:97098368-97098390 GCTGCTAGGCAGAGAGGGGCAGG + Intronic
1073063765 10:100746617-100746639 CTGACTAGGGAGAGGGTGGCTGG - Intronic
1074391585 10:113062585-113062607 CCTTTTGGGGATAGGGTGGCAGG + Intronic
1074563295 10:114553634-114553656 ACATCTAGGCAGAGAGTGGGAGG - Intronic
1075317994 10:121467459-121467481 CCTTCTCGGCAGGGTGAGGCAGG + Intergenic
1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG + Intronic
1076898738 10:133326803-133326825 GCCTCCAGGCAGGGGGTGGCAGG - Intronic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1077969346 11:7171586-7171608 ACTACTAGGCAGATGGTGACTGG - Intergenic
1078778895 11:14418677-14418699 GCTCCTAGGCAGAGAATGGCCGG - Intergenic
1079990268 11:27239337-27239359 CCTTCTGGGGAGAGGGTAACGGG - Intergenic
1081334016 11:41842247-41842269 AACTCTAGGCAGACGGTGGCAGG + Intergenic
1081644212 11:44778497-44778519 CCTTCTAGTAGGTGGGTGGCTGG + Intronic
1083324142 11:61865062-61865084 CCACCTGGGCAGAGGCTGGCTGG - Intronic
1083687292 11:64384242-64384264 CCTCCTAGGCAGAGGGCAGGAGG + Intergenic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1085334246 11:75678977-75678999 GCTTCTGGGCAGAAAGTGGCGGG - Intergenic
1086811025 11:91310433-91310455 CCTTTTAGGCCGATGGTAGCTGG - Intergenic
1090137057 11:124209812-124209834 GCTCCTGGGCAGAAGGTGGCGGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1096009667 12:48202335-48202357 CCTGCTAGACAGACTGTGGCTGG + Exonic
1096751093 12:53759276-53759298 CCTGCTGGGTAGAGGGTGGGAGG - Intergenic
1097196136 12:57243336-57243358 CCATCTGGGCTGAGGTTGGCGGG - Intergenic
1097274770 12:57805473-57805495 ACTTCTATGCAGATGGAGGCTGG - Intronic
1099918140 12:88922038-88922060 CCTACTAGGCAGATGGTGAAAGG + Intergenic
1101318019 12:103647222-103647244 CAATCCAGGCAGAGGGTGGTAGG + Intronic
1101537746 12:105634908-105634930 CATTCTGGGCAGAAAGTGGCAGG + Intergenic
1101837778 12:108307173-108307195 CATTGTAGCCAAAGGGTGGCTGG + Intronic
1102031383 12:109741898-109741920 CCTGCCAGGCAGGGAGTGGCTGG - Intronic
1102472219 12:113165770-113165792 TCTACAAGGCAGGGGGTGGCAGG - Intronic
1104684966 12:130778893-130778915 CCATCTAGACAGGAGGTGGCGGG - Intergenic
1104997830 12:132669812-132669834 CCTGTTGGGCGGAGGGTGGCTGG - Intronic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1108807806 13:54181413-54181435 ACTTGTGGGCAGAGGGTGGGAGG - Intergenic
1109372743 13:61445284-61445306 CCTTCTGGGTAGAGGGTTGGAGG + Intergenic
1109865731 13:68260773-68260795 CCATCTAGAAAGAGGGGGGCAGG - Intergenic
1115816798 14:37172292-37172314 GCTTCTCGGCAGATCGTGGCCGG - Exonic
1116269324 14:42741422-42741444 CCTTGCAGGCAGGGGGTGGGGGG - Intergenic
1116712296 14:48383645-48383667 CCTTATAGGCACAGGATGGGGGG + Intergenic
1117316561 14:54576833-54576855 CCCTTTAGGCAGACAGTGGCTGG - Intronic
1117892103 14:60435707-60435729 CCTTCTGGGGAGAGCGGGGCAGG + Intronic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1118825029 14:69372175-69372197 TTGTCTAGGCAGAAGGTGGCTGG + Intergenic
1119103929 14:71906463-71906485 CCTCCTAGGCAAAGGGAGGTTGG - Intergenic
1120153227 14:81061633-81061655 GCTTGAAGGCAGAGGGTGGGAGG + Intronic
1120838393 14:89061527-89061549 ACTTCTCTGCAAAGGGTGGCTGG + Intergenic
1121217438 14:92259447-92259469 CCTCCCAGTCAGAGGGAGGCTGG - Intergenic
1122881340 14:104691803-104691825 CCTCCTAGGGTGAGGCTGGCAGG - Intronic
1122924109 14:104891945-104891967 CCATCTGGGCAGAGGGTGCTGGG + Intronic
1122954883 14:105065985-105066007 CCATGTAGGAAGAGGGAGGCGGG - Intergenic
1123018638 14:105387300-105387322 CATTCTCGGCAGAGGAGGGCGGG - Intronic
1125420605 15:39500599-39500621 CATTCAAGGCAAATGGTGGCTGG + Intergenic
1125610142 15:40964151-40964173 TATGCCAGGCAGAGGGTGGCAGG + Intergenic
1125920537 15:43522979-43523001 CCTTCTGGGCTGGGGGTGTCTGG - Exonic
1127245769 15:57172623-57172645 CCTTGAAGGTAGAGGGTGGGAGG + Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129682774 15:77667322-77667344 CCTTCTAGGCTGTGGGTGCTCGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131189416 15:90301645-90301667 CATTCTTGGCAGGGGGTGGGAGG + Intronic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1133222845 16:4326576-4326598 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1136559874 16:31033089-31033111 CTTTCGAGGCAGTGGGTGGTAGG - Intronic
1137705909 16:50535748-50535770 CCCTCTGGCCAGAGGTTGGCTGG + Intergenic
1139098586 16:63736258-63736280 CCTACTAGGCAGAGAGTAGTAGG + Intergenic
1140210969 16:72969945-72969967 CCTTCTGGGCAGTGGGCGTCCGG - Intronic
1141671835 16:85496232-85496254 CCTTGGAGGCACGGGGTGGCGGG - Intergenic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1144232321 17:13220478-13220500 GCTTCTGGGAAGAGGGAGGCTGG + Intergenic
1146176627 17:30669339-30669361 CCCTCTAGGAAGAGGGGGCCTGG + Intergenic
1146350088 17:32085454-32085476 CCCTCTAGGAAGAGGGGGCCTGG + Intergenic
1146650627 17:34603947-34603969 GCTTCTAGGTAGAGGGAGGGTGG - Intronic
1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG + Intergenic
1149441771 17:56680124-56680146 GCTTCCTGGCATAGGGTGGCGGG - Intergenic
1151721867 17:75861489-75861511 CCCTCTTGGCAGAGCCTGGCAGG + Intergenic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1154217228 18:12423944-12423966 CCAGCTGGGCAGAGTGTGGCTGG - Intronic
1154378307 18:13827011-13827033 CCTGCTAGGTGGAGGGTGGATGG - Intergenic
1155136492 18:22999313-22999335 AGTTGTAGGCAGATGGTGGCTGG + Intronic
1155186308 18:23389648-23389670 CCTACTCGGCAGAGTGGGGCAGG - Intronic
1156036578 18:32771971-32771993 GCATCTAGGCAGAGGAGGGCAGG + Intronic
1156471513 18:37379957-37379979 CCTTCCACTCAGAGGGTGGATGG + Intronic
1157203490 18:45679170-45679192 CCTGCTAGGCAGAGGGAGCCAGG + Intronic
1157424183 18:47570848-47570870 CCTTCTGGGAAGAGGGTACCCGG - Intergenic
1158734169 18:60060995-60061017 CTTTCTAGGTGGAGGGGGGCGGG + Intergenic
1160507948 18:79437685-79437707 CCGTCAGGGCAGAGGGTGGAGGG - Intronic
1161781532 19:6296333-6296355 CCTACTCGGGAGAGGGAGGCAGG - Intergenic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1162982193 19:14247548-14247570 CCCTCTAGGAAGAGGGGGCCAGG - Intergenic
1163722603 19:18905353-18905375 CTCTCTATGCAGTGGGTGGCAGG - Intronic
1163832060 19:19551795-19551817 GCTTCTAGGCAGAGGGATGTTGG + Intergenic
1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG + Intergenic
1165233133 19:34399889-34399911 CCTTCTTGGCAGAGTGGAGCTGG + Exonic
1165362349 19:35344759-35344781 CCTTCCAGGCAAAGGCTGCCAGG + Intronic
1166111445 19:40625752-40625774 GCTGATAGGCAGAGGGTGCCTGG + Intronic
1166897457 19:46032840-46032862 CCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1167487795 19:49773265-49773287 CTATCTAGGCAGAGTCTGGCTGG + Intronic
1167558602 19:50211220-50211242 CCTTCTAGGAAGACTGAGGCAGG + Intronic
1167715512 19:51140602-51140624 CCTTATGGGGAGAGAGTGGCTGG + Intergenic
1168165671 19:54545799-54545821 CCTTCTTGGCGGGGGGTGGGTGG - Intergenic
1168320971 19:55509204-55509226 TCTTATGGGGAGAGGGTGGCTGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925869897 2:8261041-8261063 CCTTCCATGCAGAGAGTGGTAGG - Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
926771714 2:16383558-16383580 ACTTCTTGGCAGAGGTTGGGGGG + Intergenic
928272001 2:29864914-29864936 CCTTCAGGGGAGAGGGTGGGAGG - Intronic
928407868 2:31028614-31028636 CCTTCGAGGCAGCAGGAGGCGGG + Intronic
930435123 2:51331058-51331080 CATTCTGGGAAGAGGGTTGCAGG + Intergenic
930653148 2:53982580-53982602 AATTCTAGGCAGTGGGTGGAAGG - Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
933634236 2:84689802-84689824 TCTTCTAGTCAGTGAGTGGCAGG + Intronic
934473668 2:94578128-94578150 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
935128607 2:100244805-100244827 AGTTATAGTCAGAGGGTGGCTGG + Intergenic
935426980 2:102929892-102929914 CGTTCTAGGCAGAAGGGGGGAGG - Intergenic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
942437077 2:175990370-175990392 CATTCTTGGCAGAAGGTGACAGG - Intronic
944586997 2:201181226-201181248 CCTTCTTGGGAAAGGGGGGCCGG - Intergenic
944962481 2:204890718-204890740 CCTGCTAGCCACAGGGAGGCAGG + Intronic
946170281 2:217891187-217891209 GCTTCTCGGCACAGGATGGCAGG - Intronic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
948075229 2:235160688-235160710 CCTTATAGGAGGAGGGAGGCAGG - Intergenic
948928770 2:241117005-241117027 CCCTCCAGGCAGAGGGCAGCGGG + Intronic
948947604 2:241229012-241229034 CCTGAGAGGCAGAGGGTGACGGG - Exonic
1168765376 20:378666-378688 TCCTCTAGGCAGAGGCTGGATGG - Intronic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG + Intergenic
1172690573 20:36786634-36786656 CGTCCTAGGAAGAGGGAGGCAGG + Exonic
1172949579 20:38714258-38714280 CCTTGCAGGCTGAGGGTGGGGGG + Intergenic
1173172634 20:40739888-40739910 CCCTCTAGGCAAAGGGTCACAGG + Intergenic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174670556 20:52303748-52303770 CCATTTTGGCAGTGGGTGGCGGG - Intergenic
1175067177 20:56299212-56299234 ACTTCTAGATAGAGGGTTGCAGG - Intergenic
1175881504 20:62262096-62262118 AGTTTTAGGCAGAGGGTGACGGG - Intronic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1178493614 21:33070074-33070096 CCTGCGGGGCAGCGGGTGGCGGG - Intergenic
1178882579 21:36461041-36461063 CTTTGTAGGCAGCTGGTGGCTGG + Exonic
1178892684 21:36533234-36533256 CCAGCCAGGCAGAGAGTGGCTGG + Intronic
1179012198 21:37564457-37564479 TCTTCCTGGCAGAAGGTGGCAGG + Intergenic
1179180255 21:39038397-39038419 CCTTCTAGGCTGGGCATGGCAGG - Intergenic
1179277360 21:39904551-39904573 GCTCCTGGGCACAGGGTGGCTGG + Intronic
1179349610 21:40595542-40595564 CCTTCAGGGCAGAGCTTGGCTGG - Intronic
1179510139 21:41867114-41867136 CTTTCTGGGCTGAGGGTGTCGGG - Intronic
1179725520 21:43339503-43339525 CCTTGTAGGCAGAGGCTGAGGGG - Intergenic
1179831702 21:44001061-44001083 CCTTCGAGGCAGAGTGTGCATGG + Intergenic
1180091599 21:45536386-45536408 CCATCTGGTCAGTGGGTGGCAGG + Intronic
1180946578 22:19697122-19697144 CATTCCAGGCAGACAGTGGCTGG - Intergenic
1182511984 22:30826404-30826426 CCAAGTAGGCAGAGGGAGGCTGG - Intronic
1183355076 22:37354219-37354241 CCCTCGAGGGAGAGGCTGGCAGG + Intergenic
1183414842 22:37676181-37676203 CCTTCTAGGTCGGGGGTGGAGGG + Intronic
1183617512 22:38954501-38954523 GCTTCTAGGCTGAGGAGGGCGGG + Intronic
1184043458 22:41957968-41957990 CCCCCAAGGCAGAGGGAGGCCGG + Intergenic
1184387706 22:44185824-44185846 CCTTCCGGGAAGTGGGTGGCAGG - Exonic
1185004491 22:48267774-48267796 CGTTCTAGGAAAAGGATGGCAGG - Intergenic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
950182842 3:10927266-10927288 CCTGCCTGGCAGAGGGAGGCAGG + Intronic
950575551 3:13830141-13830163 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
954906510 3:54067738-54067760 CCCTCTGGGCAGAGGGGGCCAGG - Intergenic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
954985371 3:54786002-54786024 CCATGATGGCAGAGGGTGGCTGG - Intronic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
956910398 3:73810153-73810175 CCTACCTGCCAGAGGGTGGCGGG + Intergenic
958692722 3:97488490-97488512 CCTGCTGGGTTGAGGGTGGCAGG - Intronic
958996617 3:100913001-100913023 CAGTCTAGGCAGAGGCGGGCAGG + Intronic
959212735 3:103409746-103409768 CATTCTAGGCAGAAAGAGGCAGG + Intergenic
962249509 3:133827097-133827119 CCTCCTAGGCAGAGGGTGTGTGG + Exonic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
971377916 4:26069865-26069887 CCAGCTAGGCAGAGGTGGGCAGG - Intergenic
972242367 4:37206929-37206951 TATTCTAGGAAGAGGGTTGCAGG - Intergenic
973700102 4:53528771-53528793 CCTTCCAGGGAGATGGTGCCAGG - Intronic
974963839 4:68736072-68736094 TCACCTAGGAAGAGGGTGGCAGG + Intergenic
978545900 4:109872674-109872696 GCTTCTAGGAGGAGGGTGGTAGG + Intergenic
979528372 4:121741258-121741280 CCTTCTAGGCAGAGGGAATAGGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981388364 4:144158223-144158245 CCTTGTGGGTGGAGGGTGGCAGG - Intergenic
982170250 4:152655238-152655260 CCTTCTTGGCTGAGACTGGCTGG + Intronic
984950691 4:185005354-185005376 GCTTCTAAGGAGAGGCTGGCTGG - Intergenic
992570460 5:78050109-78050131 CCTTCCAGGTAGAGGGTCCCAGG - Intronic
994353373 5:98770302-98770324 CCTTCTTGGGAGCGAGTGGCTGG + Intronic
996830258 5:127732834-127732856 CCTGCAAGGGTGAGGGTGGCAGG + Intergenic
998463230 5:142324495-142324517 CGTTCGAGGCGGATGGTGGCAGG + Intronic
998578086 5:143339707-143339729 CCTTCTAGGCTGAGGGTTGGTGG + Intronic
999130315 5:149278053-149278075 TGTTCTTGGCAGAGGGTGGGAGG - Intronic
1001746667 5:174098000-174098022 CCTTCCCAGCAGAAGGTGGCTGG + Intronic
1002350181 5:178577608-178577630 CCATCCAGGCAGCGGGGGGCAGG - Intronic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1006514136 6:34536696-34536718 CCTTGTAGGAGGAGGGTGGGGGG - Intergenic
1006848161 6:37077785-37077807 CCTTTTAGGCTGAAGGGGGCAGG - Intergenic
1008645001 6:53504839-53504861 TCCTCTTGGCAGAGAGTGGCTGG - Intronic
1008736479 6:54550431-54550453 ACTTCTGGCCAGATGGTGGCAGG + Intergenic
1009868992 6:69432696-69432718 CCTCCCAGACAAAGGGTGGCCGG + Intergenic
1009869047 6:69432882-69432904 CCTCCCAGACAAAGGGTGGCCGG + Intergenic
1010332103 6:74635310-74635332 TGTTCTAGGCAGAGGCAGGCAGG - Intergenic
1011038211 6:83000771-83000793 GCTTCTAGGCAAGGGGTGGGAGG - Intronic
1011314574 6:86017233-86017255 CCTTTGAGGCAGAGTGTGTCAGG + Intergenic
1011962631 6:93110057-93110079 ACTTCAAAGCAGAGAGTGGCTGG + Intergenic
1012111048 6:95234108-95234130 ACTTCAAGGCTGTGGGTGGCCGG - Intergenic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1013352577 6:109318799-109318821 CCTTCAATGCAGTGGGGGGCAGG + Intergenic
1013995666 6:116304775-116304797 CATTCTAGGCAGATGAGGGCTGG - Intronic
1014529830 6:122545632-122545654 CCTTCTTTGTGGAGGGTGGCAGG + Intronic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1016356371 6:143223127-143223149 TCTGCTAGACAGAGGCTGGCTGG - Intronic
1016367675 6:143337067-143337089 CCTTCCAGGCACAGGGTCACAGG + Intronic
1017123308 6:151044252-151044274 CTTTCTGGGCAGAGGGTGACAGG + Intronic
1017162059 6:151374354-151374376 CCTTCTAGCCAAAAGGTGGGAGG + Intronic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1021691674 7:23236198-23236220 TCTTGTAGGCAGAGGGTCACAGG - Intronic
1022252035 7:28618056-28618078 GCTTCTAGGTGGAGGGTTGCAGG + Intronic
1022520089 7:31000556-31000578 CCTTCCAGGCTGGGGGTAGCAGG + Intergenic
1023037562 7:36146941-36146963 CCTTATAGCCAGAGAGTGGCTGG - Intergenic
1023718844 7:43072400-43072422 CCATCTAGAAAGAGGGGGGCAGG + Intergenic
1023803325 7:43853606-43853628 CCTTCTAGGTAGAGGAAGGTTGG - Intergenic
1023991244 7:45130084-45130106 CTGGCCAGGCAGAGGGTGGCTGG - Intergenic
1027357237 7:77369953-77369975 CCTTCTCGGCAGTGTGTGGAAGG - Intronic
1031986426 7:128167163-128167185 CGTGCTAGGTAGAGGGTGGGAGG + Intergenic
1034272525 7:149810190-149810212 CACTCTAGTCAGAGGGTGGTAGG + Intergenic
1035184063 7:157112079-157112101 CGTTCTGGGCAGAGGAGGGCAGG - Intergenic
1035582875 8:751061-751083 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582885 8:751101-751123 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582895 8:751141-751163 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582905 8:751181-751203 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582915 8:751221-751243 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582925 8:751261-751283 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1037162540 8:15790644-15790666 CCTTCTAGGTAGAGGTTGTGAGG - Intergenic
1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039132518 8:34283369-34283391 TTTTCTAGGAAGAGGGTGGTAGG + Intergenic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1042886171 8:73554478-73554500 CCTTCTAGGCAGAAAGAAGCTGG + Intronic
1046468924 8:114642794-114642816 CCTGCGAGGCAGAGGTTGGAGGG - Intergenic
1048440454 8:134455717-134455739 CCTTGTAGCAACAGGGTGGCTGG - Intergenic
1050456407 9:5838998-5839020 CTTCCTAGGCACAGGGTTGCTGG - Intergenic
1051556272 9:18385853-18385875 AGTTATAGGCAGTGGGTGGCAGG + Intergenic
1051936230 9:22446690-22446712 CCTTCTGGGAGGAGGGCGGCGGG - Intergenic
1052660152 9:31419195-31419217 CTTTATAGGCACAGGGGGGCAGG - Intergenic
1052804759 9:33002875-33002897 CCTTCAAGACAGAAGGTGGGAGG + Intronic
1053314754 9:37041871-37041893 CATTCCAGGCTGAGGGTGGTTGG - Intergenic
1053604139 9:39640024-39640046 CCTTCAAGGCAGACTGGGGCAGG + Intergenic
1053684662 9:40510384-40510406 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054249401 9:62702390-62702412 CCTTCAAGGCAGACTGGGGCAGG - Intergenic
1054279064 9:63114581-63114603 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054395772 9:64650357-64650379 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054430416 9:65155552-65155574 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054499964 9:65865969-65865991 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054563512 9:66736922-66736944 CCTTCAAGGCAGACTGGGGCAGG - Intergenic
1056059511 9:82869851-82869873 CATTCTAGGCAGACAGGGGCAGG + Intergenic
1056532197 9:87497824-87497846 CCTTTTGGGCGGAGGGCGGCCGG - Intronic
1057240235 9:93401167-93401189 CCGCCTTTGCAGAGGGTGGCAGG + Intergenic
1059623590 9:116036264-116036286 CCTTCTAGGCCAAGAGAGGCTGG - Intergenic
1060778146 9:126391845-126391867 CCTTCTCAGCAGGGGGTGTCTGG + Intronic
1061401399 9:130370316-130370338 CGTGCCAGGCAGAGGGTGGCTGG + Intronic
1061566612 9:131444883-131444905 CCTTGGAAGCCGAGGGTGGCTGG + Intronic
1062353403 9:136150048-136150070 GCTTCCAGGGTGAGGGTGGCCGG - Intergenic
1062737729 9:138147598-138147620 CCGTCAAGGCAGGGGATGGCGGG + Intergenic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1195275394 X:103276124-103276146 CCTGCAAGGCAGCGGGAGGCGGG - Intronic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic
1201294505 Y:12452162-12452184 ACTTGAAGGCAGAGGGTGGGAGG + Intergenic