ID: 925182734

View in Genome Browser
Species Human (GRCh38)
Location 2:1827452-1827474
Sequence CCCTTCTAGGCAGAGGGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 331}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925182734_925182741 -5 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182741 2:1827470-1827492 AAGGGGATCTCAGAGAGTTGAGG 0: 1
1: 1
2: 0
3: 21
4: 215
925182734_925182746 12 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182746 2:1827487-1827509 TTGAGGGGACCTCTCTGGTTGGG 0: 1
1: 0
2: 2
3: 11
4: 97
925182734_925182748 19 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 172
925182734_925182743 -3 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182743 2:1827472-1827494 GGGGATCTCAGAGAGTTGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 183
925182734_925182749 20 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182749 2:1827495-1827517 ACCTCTCTGGTTGGGAAAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 220
925182734_925182745 11 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG 0: 1
1: 1
2: 0
3: 9
4: 100
925182734_925182751 30 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182751 2:1827505-1827527 TTGGGAAAAGGGGAGCATCCAGG 0: 1
1: 0
2: 2
3: 30
4: 330
925182734_925182742 -4 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 234
925182734_925182744 7 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182744 2:1827482-1827504 GAGAGTTGAGGGGACCTCTCTGG 0: 1
1: 1
2: 2
3: 18
4: 177
925182734_925182747 18 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925182734 Original CRISPR CCCTTCTAGGCAGAGGGTGG CGG (reversed) Intronic
902241637 1:15094088-15094110 CCCCGGGAGGCAGAGGGTGGTGG - Intronic
902651489 1:17840491-17840513 CCCTGCTAGGAAGTGGTTGGTGG - Intergenic
902810144 1:18883427-18883449 CCCTGCAAGGCAGAGGGCCGGGG + Exonic
903365268 1:22802094-22802116 CACGTCCAGGCAGAGAGTGGAGG + Intronic
904359571 1:29963055-29963077 CCCTTCCAGGGAGTGGGTGGTGG - Intergenic
904359582 1:29963086-29963108 CCCTTCCTGGGAGTGGGTGGTGG - Intergenic
904359680 1:29963365-29963387 CCCTTCCTGGGAGTGGGTGGAGG - Intergenic
905079083 1:35301257-35301279 TCCTTCTGGGCTGAGTGTGGTGG + Intronic
905448217 1:38041155-38041177 ACCTTCTGGGCAGTAGGTGGGGG + Intergenic
905869432 1:41394706-41394728 CCCCTCTGGGGAGAGGGTGGTGG + Intergenic
910359829 1:86404530-86404552 CATTTCTAGGCTGAGGGTGGAGG + Intergenic
914505729 1:148287590-148287612 CATTTCTAGGAAGAGGGAGGAGG + Intergenic
915197116 1:154197761-154197783 CTCTTCTAGGCTGGGCGTGGTGG - Intergenic
915324513 1:155073961-155073983 AACCACTAGGCAGAGGGTGGGGG + Intergenic
915567026 1:156720692-156720714 CCCTTTTAGACACAGGGTGTGGG + Intergenic
915721741 1:157991010-157991032 CTCTCCTAGGCCGAGTGTGGTGG + Intergenic
918024671 1:180731903-180731925 CCTTTCTAGGCTGGGCGTGGTGG + Intronic
918421739 1:184371125-184371147 GCTCTCTAGGCAGAGGGTGCTGG - Intergenic
918486310 1:185032279-185032301 CCCTTCTAGGCATGGGGGTGGGG - Intergenic
918525180 1:185456874-185456896 GCCTTCCAGGCAGAGGGAGCAGG - Intergenic
920117108 1:203628855-203628877 CCCTCCTTGGCTGAGGGTGGTGG + Intronic
921341758 1:214140896-214140918 TCCTTCTGGGCACAGGGTTGTGG - Intergenic
921925684 1:220708387-220708409 CCCTTCTTCTCAGAGGATGGGGG - Intergenic
923103716 1:230838068-230838090 GCCCTCCAGGCAGAAGGTGGAGG + Exonic
923446690 1:234077861-234077883 CCCTTGGAGGTGGAGGGTGGAGG - Intronic
1062766090 10:66359-66381 CCATTCCAGGCTGGGGGTGGTGG + Intergenic
1064440959 10:15353230-15353252 CCCTTCTCATCAGAGGTTGGAGG - Intronic
1064716173 10:18178904-18178926 ACCTTGTAGGGACAGGGTGGAGG + Intronic
1065385726 10:25131394-25131416 CCACTTTTGGCAGAGGGTGGAGG - Intergenic
1066297726 10:34069296-34069318 CCCTACAAGCCAGAGAGTGGGGG + Intergenic
1066449705 10:35517603-35517625 CTGCTCTAGGCAGAAGGTGGAGG + Intronic
1066656113 10:37701202-37701224 GCCTGTGAGGCAGAGGGTGGGGG - Intergenic
1067849126 10:49743929-49743951 CCCTTCGAGGCACAGTGTTGGGG + Intronic
1068351073 10:55845922-55845944 GCCTCCTAGGCAGTGTGTGGGGG - Intergenic
1069087956 10:64163644-64163666 TCCTTCTAGGGAGAGGGAGAGGG - Intergenic
1069566285 10:69465446-69465468 CCCAGCTAGACAGAGTGTGGGGG - Intronic
1069613816 10:69793325-69793347 TCCTTCTGGGCAAGGGGTGGGGG + Intergenic
1070315921 10:75312121-75312143 CCCATCTACCCAGAAGGTGGAGG + Intergenic
1070769147 10:79072154-79072176 CCCTCCTAAGCAAAGGGGGGAGG + Intronic
1071606726 10:86998821-86998843 ACCTGCGAGGCAGAGGGTGCAGG + Intergenic
1072378156 10:94838552-94838574 CCCCTCCAAGCAGAGGGAGGAGG - Intronic
1072629300 10:97134498-97134520 CCATTCAAGCCTGAGGGTGGGGG + Intronic
1072692742 10:97582554-97582576 CCCTTGTGGGCAGTGGGAGGAGG - Intronic
1073030189 10:100519692-100519714 CCTTTCTCGGCAGAGCGCGGAGG - Intronic
1075677370 10:124304658-124304680 CCCTTCTTTGAAGAGGATGGGGG - Intergenic
1076729791 10:132432519-132432541 CTCTGCTGGGCACAGGGTGGTGG - Intergenic
1077096053 11:799619-799641 CACTCCGAGGCAGAGTGTGGTGG - Intronic
1080848640 11:36048383-36048405 ACCTCCTGGGCAGGGGGTGGGGG - Intronic
1081461158 11:43274071-43274093 CCCATCTAGGTGCAGGGTGGGGG + Intergenic
1081569559 11:44281162-44281184 CCATTTTAGGGAGAGGGTGCTGG + Intronic
1081597198 11:44467444-44467466 CCCTGCTGGTCAGAAGGTGGAGG - Intergenic
1081802556 11:45869881-45869903 CCCTTCTGGGCTGAGGGATGAGG + Intronic
1082007567 11:47428254-47428276 CCCTCCTAGGCCCAGGCTGGAGG - Intergenic
1083047065 11:59746677-59746699 TCCTTCTTGGAGGAGGGTGGGGG + Intronic
1083054494 11:59806819-59806841 CACTTTTAGGCATTGGGTGGTGG - Exonic
1083256611 11:61499962-61499984 CCCATCTGGGCAGAGCCTGGGGG - Intergenic
1084740690 11:71137631-71137653 GCCTTCCAGGGAGTGGGTGGCGG - Intronic
1086543478 11:87940917-87940939 CCCTTCTGGGCTGGGCGTGGTGG - Intergenic
1088736733 11:112733762-112733784 CCCTTCTAGTCAGAGGCAAGTGG - Intergenic
1089213825 11:116823537-116823559 CCCTTCCATGCTGAGGTTGGTGG - Intergenic
1089612888 11:119679445-119679467 CCCAGCTAGGCAGAGGGAAGTGG + Intronic
1091046130 11:132327543-132327565 ACCTTCTAGCAAGAGGGTGAGGG - Intronic
1091660651 12:2380819-2380841 CCCTGCTTGGGAGTGGGTGGGGG + Intronic
1091912287 12:4242307-4242329 CCCGTGGAGGTAGAGGGTGGGGG + Intergenic
1092976758 12:13752718-13752740 CCCTTAAAGGCAGAGGCTGGAGG + Intronic
1095650023 12:44596676-44596698 CACTTTGAGGCAGATGGTGGAGG - Intronic
1096038013 12:48490007-48490029 CCCTTCTTGGCTGAGCGGGGTGG - Intronic
1096158818 12:49359801-49359823 CCCTTCTGGGCTGGGAGTGGTGG - Intergenic
1096699303 12:53371621-53371643 GCATTCTAGGAAGAGGCTGGAGG - Intergenic
1097196138 12:57243337-57243359 CCCATCTGGGCTGAGGTTGGCGG - Intergenic
1097241957 12:57581617-57581639 CCCTAGAAGGCATAGGGTGGGGG + Intronic
1099517414 12:83614742-83614764 CCCTTCTAGGACGGGTGTGGTGG + Intergenic
1100195490 12:92239906-92239928 TCCTTGTTGGCAGAGTGTGGTGG - Intergenic
1101893290 12:108734315-108734337 CCCTTCTGGGCTGGGTGTGGTGG - Intergenic
1101953108 12:109191604-109191626 CCCTTCAAGGAACATGGTGGTGG + Exonic
1102424393 12:112829557-112829579 CCTTTGTAGGCTGGGGGTGGTGG - Intronic
1102542900 12:113635140-113635162 CTCTTCCAAGCAGAGAGTGGGGG - Intergenic
1103363505 12:120367738-120367760 TACTTCTAGGGAGAGGGTGGCGG + Intronic
1103576020 12:121877791-121877813 CCCTCGTTGGCAGAGTGTGGGGG - Intergenic
1105069890 12:133227914-133227936 CCCCTCTGGGCAGAGGGAGGGGG + Exonic
1106326145 13:28692399-28692421 CCCTCCAAGCCAGAGAGTGGGGG - Intergenic
1109931675 13:69224690-69224712 CCCTTCCAAGCAGTGGGAGGAGG + Intergenic
1111845958 13:93508769-93508791 CTTTTCTAGGGAAAGGGTGGAGG + Intronic
1116269326 14:42741423-42741445 TCCTTGCAGGCAGGGGGTGGGGG - Intergenic
1116712294 14:48383644-48383666 TCCTTATAGGCACAGGATGGGGG + Intergenic
1117402509 14:55371032-55371054 CCCTGGAAGGCAGTGGGTGGGGG - Intronic
1118600639 14:67469606-67469628 TCCTTCCAGGAAGAGGATGGAGG - Intronic
1119508566 14:75193384-75193406 CCCTTCTAGGCACACTGGGGTGG - Intergenic
1121004641 14:90482081-90482103 CCCTTCTTTGCAGATGGTGTGGG + Intergenic
1122317693 14:100835607-100835629 GCCTGCTAGGCAGAGGGCTGTGG - Intergenic
1122890707 14:104730941-104730963 CCAGACTAGGCAGAGAGTGGGGG + Intronic
1122924107 14:104891944-104891966 GCCATCTGGGCAGAGGGTGCTGG + Intronic
1122954885 14:105065986-105066008 CCCATGTAGGAAGAGGGAGGCGG - Intergenic
1123018639 14:105387301-105387323 CCATTCTCGGCAGAGGAGGGCGG - Intronic
1124360079 15:29030126-29030148 GCTTTCTGGGCAGAGGGTGATGG - Intronic
1124957551 15:34369267-34369289 TCCTTCTAGGCTGGGCGTGGTGG - Intergenic
1126684382 15:51234716-51234738 TCCATCTAGAGAGAGGGTGGAGG - Intronic
1126956137 15:53935726-53935748 CCTATCTTGGCTGAGGGTGGGGG - Intergenic
1128764850 15:70244908-70244930 CTCTTTTAGGCCGAGTGTGGTGG + Intergenic
1129685496 15:77684145-77684167 CCCACCAAGGCAGAGTGTGGGGG - Intronic
1129882899 15:79018823-79018845 CCCTCCTAGGCCCAGGGAGGTGG - Intronic
1131108897 15:89751861-89751883 ACCTTCTGAGCAGAGGGAGGGGG + Intergenic
1132563275 16:608531-608553 CCCTTCTAGACAAATGGTTGTGG + Intronic
1132864337 16:2086124-2086146 CCCTGCCCCGCAGAGGGTGGGGG - Intronic
1133187553 16:4110743-4110765 CACTTCTAGGAAAAGGGTGGTGG + Intronic
1134025996 16:10954375-10954397 CCCTTATAGGCAGAGAGGGCAGG - Intronic
1134452874 16:14374105-14374127 CCCTCCTAGGCTGGGCGTGGTGG - Intergenic
1135335700 16:21599584-21599606 CCCTTCAGGGCAAAGGCTGGGGG - Exonic
1136682431 16:31976096-31976118 CCCTTCTAGGCAGGGGCAGGAGG - Intergenic
1136782690 16:32917264-32917286 CCCTTCTAGGCAGGGGCCGGAGG - Intergenic
1136887106 16:33936586-33936608 CCCTTCTAGGCAGGGGCAGGAGG + Intergenic
1137842289 16:51651466-51651488 CCCTTCTGGGAGGAAGGTGGAGG - Intergenic
1137952303 16:52795190-52795212 CCCTTCTAGGCAGAAGTTTTTGG + Intergenic
1138614893 16:58157467-58157489 CCCTCCTTGGCTGAGTGTGGTGG + Intergenic
1140141058 16:72258287-72258309 CTCTGCTAGGCATGGGGTGGGGG + Intergenic
1140293400 16:73685301-73685323 CCCTTGTGGGCTGAGCGTGGTGG - Intergenic
1141500050 16:84437801-84437823 ATGTTCTAGGCAGGGGGTGGTGG - Intronic
1142476705 17:193249-193271 CCCTACGGGGCAGAGGGTGGAGG + Intergenic
1142788356 17:2243391-2243413 GCCTTCTAGGCCGGGCGTGGTGG + Intronic
1143205536 17:5137597-5137619 CCCTTCCAGGCTGGGGCTGGTGG - Intronic
1143229729 17:5342970-5342992 CCCTTTTTGGCTGAGTGTGGTGG + Intronic
1143253518 17:5539376-5539398 CCCTTCTGGGCAGAGGGAAGAGG - Intronic
1143626017 17:8110463-8110485 GCCGTTTAGGCAGTGGGTGGGGG + Exonic
1144876580 17:18400289-18400311 CCCTTCCAGGCTGGGGCTGGTGG - Intergenic
1145155646 17:20544131-20544153 CCCTTCCAGGCTGGGGCTGGTGG + Intergenic
1145270975 17:21404766-21404788 TCCTTCTTCACAGAGGGTGGGGG - Intronic
1145309180 17:21692153-21692175 TCCTTCTTCACAGAGGGTGGGGG - Intergenic
1145313810 17:21716579-21716601 ACCATGGAGGCAGAGGGTGGAGG + Intergenic
1145712252 17:26988553-26988575 ACCATGGAGGCAGAGGGTGGAGG + Intergenic
1145761248 17:27426406-27426428 CCCTTCCAGGCTGGGGCTGGTGG - Intergenic
1145798284 17:27668297-27668319 CCCTTCCAGGCTGGGGTTGGTGG + Intergenic
1145861741 17:28216926-28216948 CACTTCCAGGCAGGGGGTTGAGG + Intergenic
1146161292 17:30560563-30560585 CCCTTCCAGGCTGGGGCTGGTGG - Intronic
1147142952 17:38469434-38469456 CCCTTCTGGGCAGGGGCAGGAGG - Intronic
1147284976 17:39395135-39395157 CACTTCTAGGCCGGGCGTGGTGG + Intronic
1147372756 17:40004770-40004792 CCCTTCCAGGAAGGGTGTGGTGG + Intergenic
1147423051 17:40332058-40332080 ACCTCCATGGCAGAGGGTGGAGG - Intronic
1148369624 17:47087958-47087980 CACTTCTAGGCTGGGCGTGGTGG + Intergenic
1148744190 17:49909373-49909395 AGCTTCTAGGCAGAGGGGAGCGG + Intergenic
1149566208 17:57642504-57642526 CTCTTCCAGGAAGAAGGTGGGGG - Intronic
1149817390 17:59739435-59739457 CCCTTCTGGGCTGGGCGTGGTGG + Intronic
1152268205 17:79308473-79308495 CCCTGCTAGACACTGGGTGGGGG + Intronic
1152695201 17:81740806-81740828 CCCTGCTGGGCATGGGGTGGTGG - Intergenic
1153044372 18:842395-842417 CCCTTCTGGTCAGAAAGTGGAGG - Intergenic
1154253626 18:12765138-12765160 CCCTTCTTGGAAGCGGGTGCAGG - Intergenic
1154357778 18:13635301-13635323 CCCTTATAAGAAGAGGCTGGAGG - Intronic
1154999761 18:21674845-21674867 CCCTGATAGCCAGAGGGAGGAGG - Intronic
1155357481 18:24967339-24967361 CCACTCTAGGCAGAGGGTGTAGG - Intergenic
1155761272 18:29570403-29570425 CCCTAGTAGGAAGAGGGTGGTGG + Intergenic
1157441443 18:47714929-47714951 TCCAGCTAGCCAGAGGGTGGGGG - Intergenic
1160507950 18:79437686-79437708 GCCGTCAGGGCAGAGGGTGGAGG - Intronic
1160571100 18:79818234-79818256 TCCTTCTGGGAGGAGGGTGGGGG - Intergenic
1160737072 19:667775-667797 CCCTGCCAGGATGAGGGTGGAGG - Intergenic
1160881396 19:1322327-1322349 CCCTTCCAGCCAGCGGGTGAGGG - Intergenic
1161094837 19:2384289-2384311 CCTTTCTCTGCAGAGGGTGGGGG - Intergenic
1161571607 19:5033709-5033731 TGCTTCCAGGGAGAGGGTGGGGG - Intronic
1163721104 19:18898644-18898666 CCCTACCAGGCTGGGGGTGGGGG + Intergenic
1163847183 19:19644167-19644189 CCCTTTTAGGTAGGGAGTGGAGG + Intergenic
1165087830 19:33363690-33363712 TCCTTCTAGGGAGAGGGAGGTGG - Intergenic
1165289574 19:34872489-34872511 CTCTTCTTGGCTGAGTGTGGTGG + Intergenic
1165329511 19:35133830-35133852 CCCACCTAGGCTGAGGGTGGAGG - Intronic
1165358779 19:35320718-35320740 CCATCCTGGGCAGAGGTTGGGGG + Intronic
1165472335 19:36010727-36010749 CCCTTTGACCCAGAGGGTGGGGG - Intronic
1166326418 19:42053775-42053797 CCCTGCTGGGGTGAGGGTGGGGG - Intronic
1166985207 19:46655728-46655750 CTGTTCTAGGCACTGGGTGGGGG - Intronic
1167729144 19:51240690-51240712 CCCTTCTTGGAAGAGGGATGTGG - Intronic
1168156018 19:54473250-54473272 CCCCTCTGGGCGGAGTGTGGGGG + Exonic
1168640714 19:58029536-58029558 CAGTTCCAGGCGGAGGGTGGAGG + Intergenic
925142074 2:1557609-1557631 CCCTTCCGGGCAGATGGTGGGGG + Intergenic
925182734 2:1827452-1827474 CCCTTCTAGGCAGAGGGTGGCGG - Intronic
926304375 2:11627461-11627483 CCCTTCTAGACTGAGCATGGAGG - Intronic
926771713 2:16383557-16383579 AACTTCTTGGCAGAGGTTGGGGG + Intergenic
926864391 2:17342018-17342040 CCCCTCCAGGCAGTGGGAGGAGG + Intergenic
927842600 2:26455072-26455094 CCCTACTTGGCAGAGGATGGAGG + Intronic
927926213 2:27015527-27015549 CCACGCTGGGCAGAGGGTGGAGG + Intronic
931187991 2:59972245-59972267 CCCTTCTGGGCTGACTGTGGCGG + Intergenic
931849311 2:66236766-66236788 CTCTTCTAGGTAGGGCGTGGTGG + Intergenic
932128977 2:69170263-69170285 CTCTCCTCGGCAGGGGGTGGAGG - Exonic
932217278 2:69975143-69975165 CCCTTCAAGGGAGGGGCTGGGGG - Intergenic
933181661 2:79234364-79234386 CCCTACAAGCCAGAGGATGGTGG - Intronic
933630008 2:84645130-84645152 CCATTCTAGGCCGGGGGTGGTGG + Intronic
933761997 2:85678913-85678935 CTGTTCCAGGCACAGGGTGGGGG + Intergenic
933988280 2:87612293-87612315 CCCTTCTAAGCTGGGGGTAGGGG + Intergenic
934113948 2:88766255-88766277 CCCTTCCAGGCTGAGGGCTGTGG + Intergenic
934849010 2:97685214-97685236 CCATTCTAGGCCGGGCGTGGTGG - Intergenic
936305560 2:111338515-111338537 CCCTTCTAAGCTGGGGGTAGGGG - Intergenic
937083446 2:119156463-119156485 CGCTTCTAGGCACTGGGAGGAGG + Exonic
937764500 2:125643744-125643766 GCCTTCTGGGCTGAGGGCGGGGG - Intergenic
938325678 2:130398414-130398436 CCATTCTAGGCCGGGCGTGGTGG + Intergenic
938423282 2:131161784-131161806 CCATTCTAGGCCGGGCGTGGTGG - Intronic
938666743 2:133546613-133546635 ATATTCTAGGCACAGGGTGGGGG - Intronic
939028250 2:137039931-137039953 CCCAGCTAGTCAGAGGGTGTTGG + Intronic
940201298 2:151153815-151153837 CCCTTCCAGGCAGCAGGAGGAGG - Intergenic
941551776 2:166925774-166925796 CCTTTTTTGGCAGAGTGTGGTGG + Intronic
943961176 2:194265072-194265094 CCCATCTTGGCACAGGGTTGGGG + Intergenic
944082802 2:195808021-195808043 CTCTCCTAGGGAGAGGTTGGAGG - Intronic
944731131 2:202518423-202518445 CCATTCTAGGCTGGGTGTGGTGG - Intronic
945755676 2:213843561-213843583 CCCTTCTAGGCCGGGCGAGGTGG + Intronic
946164875 2:217857819-217857841 CCCGTATAGGCTGAGGGTAGGGG - Intronic
946182238 2:217955632-217955654 CCCTCCTAAGCAGTGGGAGGCGG + Intronic
946347610 2:219123835-219123857 CACACCTAGGAAGAGGGTGGGGG + Intronic
946403404 2:219480616-219480638 CCCTTCCAGTCAGAGAGGGGCGG + Intronic
947737035 2:232460417-232460439 GTCTTTTGGGCAGAGGGTGGGGG + Intergenic
948836521 2:240628680-240628702 CTCCTCTGGGCAGAGGGAGGAGG + Intronic
948981946 2:241498943-241498965 CCCTTCTAGACAGGACGTGGAGG - Intronic
1169633198 20:7656993-7657015 ACATTCTAGGGAGAGGGGGGAGG + Intergenic
1171348373 20:24483961-24483983 GTCTTCTCGGCAGAGGGTGCAGG + Intronic
1172564603 20:35919091-35919113 ACCTGGGAGGCAGAGGGTGGTGG - Intronic
1172949577 20:38714257-38714279 GCCTTGCAGGCTGAGGGTGGGGG + Intergenic
1174100345 20:48122226-48122248 CCCTTTAAGTCAGAGGGTCGTGG - Intergenic
1174539272 20:51276238-51276260 ACCTTTTAGGCTGAGGGTGGGGG - Intergenic
1175939547 20:62531662-62531684 CCCTTCGGGGCAGAGTCTGGGGG + Intergenic
1176285563 21:5017439-5017461 CCCTGCAGGGCAGGGGGTGGAGG + Intergenic
1177896180 21:26857833-26857855 CCCCTCTAAGCAGTGGGAGGAGG + Intergenic
1178783847 21:35633907-35633929 CACTTCTAGGCAGAGCATAGAGG + Intronic
1179168946 21:38957904-38957926 TCCTTCTACGCAGAGGGAGTGGG + Intergenic
1179725522 21:43339504-43339526 TCCTTGTAGGCAGAGGCTGAGGG - Intergenic
1179824611 21:43957181-43957203 CCCTGAGAGGCAGAGGGTGGGGG + Intronic
1179871618 21:44246036-44246058 CCCTGCAGGGCAGGGGGTGGAGG - Intergenic
1180581564 22:16844178-16844200 CCTCTGTAGGCAGAGGGAGGAGG + Intergenic
1180957805 22:19748843-19748865 CCCTTCTCCCCTGAGGGTGGTGG - Intergenic
1181107535 22:20583952-20583974 CCCTTCTAGACAGGGGTTGGGGG - Intronic
1181319890 22:21996120-21996142 CACTTCTAGGCAGAGGGAACAGG - Intergenic
1183205158 22:36413784-36413806 CTCTTGGAGGCAGAGGCTGGTGG + Intergenic
1183323724 22:37180394-37180416 CCCTTCTCCCCAGAGGGAGGCGG - Exonic
1183414840 22:37676180-37676202 CCCTTCTAGGTCGGGGGTGGAGG + Intronic
1183749432 22:39711421-39711443 CCCTGCTCGTCAGGGGGTGGGGG + Intergenic
1183918300 22:41141962-41141984 TGCTTCTAGGCAGGGAGTGGTGG - Intronic
1184246381 22:43237834-43237856 CCCTTCCTGGCAGAGTGTGGGGG + Intronic
950457457 3:13101192-13101214 CCCTTCTAGGCTGGGCGCGGTGG + Intergenic
950483489 3:13259176-13259198 GCCTGCATGGCAGAGGGTGGTGG - Intergenic
950578266 3:13846101-13846123 CTCTCCCAGGCAGAAGGTGGTGG + Intronic
951200759 3:19873651-19873673 CCCTTCCAAGCAGTGGGAGGAGG - Intergenic
951796886 3:26549023-26549045 CCCTTCCAGGCTGAGTATGGTGG - Intergenic
953603678 3:44392472-44392494 CACTTGAAGGCAGAGGATGGAGG - Intronic
954258793 3:49424136-49424158 CCCTTCTAGGCAGGGTGCAGTGG - Exonic
954306882 3:49731733-49731755 CCATTCTAGGCTGGGCGTGGTGG + Intronic
954328953 3:49878873-49878895 CCCTGCCAGACAGAGGGAGGAGG - Intergenic
954593928 3:51809290-51809312 CCCTTCTTGGCAGACACTGGGGG + Intergenic
954622785 3:52005375-52005397 CCCTGGTGGGCAGAGGCTGGTGG + Intergenic
954766773 3:52924723-52924745 CCCATCCAGACAGAGAGTGGAGG + Intronic
954874784 3:53794923-53794945 CCCCTAAAGGCAGAGGGTGCTGG + Intronic
955056261 3:55458501-55458523 CCCTTCAAGGCACTGGGAGGGGG - Intergenic
955412163 3:58662744-58662766 CCCTCCGAGGCAGTTGGTGGGGG + Intronic
955963790 3:64367274-64367296 CCCTTCTGACCAGAGGATGGAGG - Intronic
956462332 3:69484984-69485006 GCCTCCTGGGCAGAAGGTGGGGG - Intronic
957132659 3:76242596-76242618 CACATCTAGGCAGGGCGTGGTGG + Intronic
957791376 3:84945191-84945213 CCCTTCTAAAGAGAGGGTTGAGG - Intergenic
960736807 3:120790254-120790276 ACCTTTCAGGTAGAGGGTGGGGG - Intergenic
960933210 3:122875637-122875659 GCCTTCTAGGCTGGGTGTGGTGG - Intronic
961372739 3:126441297-126441319 CCTTTCTATGCTGAAGGTGGTGG - Intronic
961681391 3:128602649-128602671 CCCTCTTGGGCAGAGGGTAGGGG - Intergenic
964790466 3:160449805-160449827 CCCTTCGGGGCAGAGGAGGGCGG - Exonic
964920577 3:161890976-161890998 CCTTTATAGGCACAGGATGGGGG + Intergenic
967105838 3:186254459-186254481 GCCTTCTAGGCAAAGGGAGCAGG - Intronic
968025756 3:195441974-195441996 CCCTCCTGGGCAGAGGCTGCTGG + Intronic
968035397 3:195543841-195543863 CCCGTCTAGGCAGAGAGCGCAGG + Intergenic
968771404 4:2509835-2509857 GTCATCTTGGCAGAGGGTGGGGG + Intronic
969813815 4:9671144-9671166 CCCTTCTAGGCAGCCTGTGTGGG + Intergenic
970265913 4:14286017-14286039 CCCTTCTAGGATGATGGTAGAGG + Intergenic
971327737 4:25657878-25657900 CCCCTATAGGCTAAGGGTGGTGG - Intronic
972456453 4:39260626-39260648 CCCTACTAGGCTGGGTGTGGTGG - Intronic
973624153 4:52754324-52754346 TCATTTTAGGCAGAGTGTGGTGG + Intergenic
974640716 4:64626269-64626291 CTCTTCAAGACAGAGGATGGAGG + Intergenic
978776417 4:112510558-112510580 CCCTTCTAGCCCCAGGCTGGGGG + Intergenic
979528374 4:121741259-121741281 CCCTTCTAGGCAGAGGGAATAGG - Intergenic
981570851 4:146148940-146148962 CCCTTCCAGGCAGCTGATGGGGG - Intergenic
982204876 4:152990132-152990154 CCCTTCTAGGAGATGGGTGGAGG - Intergenic
983560475 4:169096674-169096696 CTTTTCTAGGCACAGGGTGGTGG - Exonic
987391211 5:17377138-17377160 TCCTTCCAGGAAGAGGGTGTAGG + Intergenic
988811578 5:34790160-34790182 TGCTTCTAGGCATAGGGTGGGGG + Intronic
989240866 5:39201991-39202013 CCCTTCTAAGCTGACAGTGGGGG - Exonic
992071626 5:73154182-73154204 CCCTTCCAGAGACAGGGTGGGGG - Intergenic
993501630 5:88673219-88673241 CCCTTCTGGGGAGAGGGAGAAGG + Intergenic
994587911 5:101734371-101734393 CCTTTCTAGGAAGAAGCTGGTGG + Intergenic
994684031 5:102926763-102926785 CCCTAGTGGGCAGAGGGTGTGGG - Intronic
996376377 5:122812403-122812425 GCATTCTAGGCAGAGGGAGCAGG - Intronic
997286172 5:132680300-132680322 CCATTCCAGGCAGAAGGAGGAGG + Intronic
998138443 5:139686901-139686923 CCTCTCTAGGGAGAGAGTGGGGG + Intergenic
998844745 5:146297394-146297416 CCTTTCTTGGCCGAGCGTGGTGG + Intronic
999767546 5:154753036-154753058 CCCTGCTGTGTAGAGGGTGGAGG - Intronic
1000991529 5:167916614-167916636 CGCTTCTCGGCAAAGGCTGGGGG - Intronic
1001411130 5:171512792-171512814 CCCTTTTGGGGTGAGGGTGGTGG - Intergenic
1001430658 5:171659221-171659243 CTCTTCTAGGCAGTGGGGGTGGG + Intergenic
1002048398 5:176554939-176554961 CCCTTCGAGGCTGGGTGTGGTGG - Intronic
1004039424 6:11961078-11961100 GCATTCCAGGCAGAGGGTGCAGG - Intergenic
1004896855 6:20156412-20156434 CCCTCCTGGGGAGAGGGTGGTGG - Intronic
1006514138 6:34536697-34536719 CCCTTGTAGGAGGAGGGTGGGGG - Intergenic
1006785271 6:36662468-36662490 ACCTTCTAGACAGGAGGTGGGGG - Intergenic
1006947221 6:37792751-37792773 CTTTTGGAGGCAGAGGGTGGTGG + Intergenic
1007431855 6:41781075-41781097 CCCTTCAGGGCAGCGGGTGTTGG + Intronic
1007507979 6:42351757-42351779 CACTTCTAGGCTGAGGGAGGTGG + Intronic
1008567660 6:52785029-52785051 CACATCAAGGCAGAAGGTGGTGG + Intergenic
1008571795 6:52823865-52823887 CACATCAAGGCAGAAGGTGGTGG + Intergenic
1011858673 6:91727241-91727263 CCCTTCTAGGCATAGCAGGGAGG - Intergenic
1013071796 6:106736252-106736274 TACTTCTAGGCAAATGGTGGGGG + Intergenic
1013550536 6:111203444-111203466 CCCTTCTAGGCCAGGCGTGGTGG + Intronic
1014633340 6:123814137-123814159 TCCTACAAGGCAGGGGGTGGAGG + Intronic
1017009452 6:150053467-150053489 CCGTTCTAGTTTGAGGGTGGTGG + Intergenic
1017105928 6:150887742-150887764 CCCTTTTAGGCTGGGTGTGGTGG - Intronic
1017490922 6:154944645-154944667 GCCTTCTAGGCTGAGTGTGGTGG + Intronic
1017839101 6:158206853-158206875 CCCTTCCAGGCTGGGCGTGGTGG - Intergenic
1021033984 7:15774417-15774439 TCTTTATAGGCACAGGGTGGGGG - Intergenic
1021558036 7:21941641-21941663 CCCTTCTAGTTAAAGGGAGGAGG + Intronic
1023148792 7:37179881-37179903 TCCTTCTAGGCAAAGTGTGCAGG + Intronic
1023880047 7:44313155-44313177 CCCAGCTAGGCAGCGGGAGGTGG - Intronic
1025233174 7:57216547-57216569 CTGTTCTAGGGTGAGGGTGGTGG + Intergenic
1027393860 7:77732619-77732641 CACTTCTAGGCTGGGTGTGGTGG - Intronic
1028947387 7:96595972-96595994 CCTTTGCAGGCATAGGGTGGAGG + Intronic
1029297176 7:99550785-99550807 CCCTTCCTGGCAGGGCGTGGTGG + Intronic
1029612973 7:101637177-101637199 CCCTAGTTGGCAGGGGGTGGGGG - Intergenic
1030291732 7:107879557-107879579 CTCTTCTGGGCAGAAGGTGCTGG + Intergenic
1030843564 7:114383313-114383335 CCCTTCCAAGCAGTGGGAGGAGG - Intronic
1030932639 7:115544077-115544099 CCATTCTTTGCAGAAGGTGGTGG + Intergenic
1031943438 7:127813848-127813870 CACTTCAAGGCCGAGCGTGGTGG - Intronic
1032342868 7:131091980-131092002 CCATTCTAGGCCGGGCGTGGTGG - Intergenic
1032619292 7:133511527-133511549 CACTTTTAGGCAGATGGGGGAGG + Intronic
1033846124 7:145434091-145434113 AGCTTCTAGGCTGAGTGTGGTGG + Intergenic
1034319745 7:150169079-150169101 CCCTTCTAAGAAGATGGAGGGGG + Intergenic
1034381710 7:150701713-150701735 CCCTTCCAGGCAGAAGCTGGAGG - Intergenic
1034773008 7:153798140-153798162 CCCTTCTAAGAAGATGGAGGGGG - Intergenic
1035109109 7:156465417-156465439 CCTCTCTGGGCAGAGGGTGCAGG - Intergenic
1037082072 8:14799641-14799663 ACCTACTAGGCAGAGGAAGGAGG + Intronic
1037741491 8:21612582-21612604 GGCTTCTAGGCATAGGATGGAGG - Intergenic
1037974303 8:23199217-23199239 ACCTTGTAGGCAGGGGGTGAAGG - Intronic
1039037747 8:33378158-33378180 CCCTCCTTGGCACAGCGTGGTGG + Intronic
1039438486 8:37578261-37578283 CCCTCCTTGGCAGAGGGTCCAGG - Intergenic
1042021434 8:64373989-64374011 CCATTCTAGGCCCGGGGTGGGGG - Intergenic
1043453978 8:80395556-80395578 CCCTTCTAAGCACAGGCTGCTGG + Intergenic
1046340205 8:112844568-112844590 CCCTTCTAGGAAGCAGGTTGGGG - Intronic
1046468926 8:114642795-114642817 ACCTGCGAGGCAGAGGTTGGAGG - Intergenic
1046709887 8:117499132-117499154 TCTTTATAGGCACAGGGTGGGGG - Intergenic
1048989098 8:139750942-139750964 CACTGCCTGGCAGAGGGTGGAGG - Intronic
1049607640 8:143537093-143537115 ACCTGCTGGGCAGAGGGCGGGGG - Intronic
1052805892 9:33012827-33012849 CCCTTTTAGAAAAAGGGTGGGGG + Intronic
1053250999 9:36573792-36573814 CCCTTTTAGGCCGGGCGTGGTGG - Intronic
1056486230 9:87060663-87060685 CTCTTCTAGGCTGAGTGTGGGGG - Intergenic
1057106350 9:92421325-92421347 CCCTCCAAGGCCGGGGGTGGTGG - Intronic
1057388093 9:94621993-94622015 GACTCCCAGGCAGAGGGTGGAGG + Intronic
1061310115 9:129756529-129756551 CCCTGCCTTGCAGAGGGTGGGGG + Intergenic
1061772655 9:132938001-132938023 CTCTGCTTGGCAGGGGGTGGGGG - Intronic
1061794224 9:133075204-133075226 CCCAGCTATTCAGAGGGTGGAGG + Intronic
1062053745 9:134460075-134460097 CCATCCTAGGGAGTGGGTGGTGG - Intergenic
1062524185 9:136971664-136971686 CCCTTCTTGGCACAGGGCAGGGG + Exonic
1062635757 9:137490207-137490229 CCCAGCTATGCAGAGGGTTGAGG - Intronic
1062737727 9:138147597-138147619 CCCGTCAAGGCAGGGGATGGCGG + Intergenic
1185845728 X:3435989-3436011 CCCTCCCAAGCAGAGGGCGGTGG + Intergenic
1186556549 X:10566095-10566117 ACTTTCTAGGCAGGGCGTGGTGG - Intronic
1186889738 X:13948333-13948355 CAAATCTAGGCTGAGGGTGGTGG - Intergenic
1189633381 X:42978162-42978184 CACTTCTAGGCCGAGGTGGGTGG - Intergenic
1190836032 X:54101435-54101457 CCCTTTTAGGCATAAAGTGGTGG + Intronic
1195275396 X:103276125-103276147 CCCTGCAAGGCAGCGGGAGGCGG - Intronic
1196130420 X:112149492-112149514 ACATTCTAGGCAGAGGGTATAGG + Intergenic
1196268510 X:113682151-113682173 CCCTTCTGGGTAGAGAGTGTGGG - Intergenic
1196918120 X:120560523-120560545 CTCTTCTTGGCAGAGGTGGGCGG + Exonic
1197298014 X:124742927-124742949 CCCTTCTAGGCAGGAGTAGGGGG + Intronic
1197720665 X:129742467-129742489 CCCCTCTAGGAGGAGGGAGGAGG + Intronic
1197902919 X:131392904-131392926 CCCTGGTCGGCAGGGGGTGGGGG - Intronic
1198465038 X:136897403-136897425 ACCTTGGAGGCAGAGGTTGGTGG + Intergenic
1199034201 X:143032098-143032120 GTCTTCTGGGGAGAGGGTGGAGG + Intronic
1200228684 X:154433171-154433193 CCCCACTTGGCAGAGGGGGGCGG + Intronic
1200725573 Y:6665102-6665124 CCCTTCTGGGCTGAGAGTGACGG - Intergenic
1200818700 Y:7560302-7560324 CCCTCCCAAGCAGAGGGCGGTGG - Intergenic
1200962196 Y:9005939-9005961 CCCTGCTAGGCATAGGATGATGG + Intergenic
1200981706 Y:9268563-9268585 CCCTGCTAGGCATAGGATGATGG - Intergenic
1202128710 Y:21591161-21591183 CCCTGCTAGGCATAGGATGATGG + Intergenic
1202584674 Y:26410004-26410026 CCCTTCCAGGCTGAGGGCTGTGG + Intergenic