ID: 925182737

View in Genome Browser
Species Human (GRCh38)
Location 2:1827455-1827477
Sequence ATCCCCTTCTAGGCAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 142}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925182737_925182742 -7 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 234
925182737_925182743 -6 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182743 2:1827472-1827494 GGGGATCTCAGAGAGTTGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 183
925182737_925182747 15 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 162
925182737_925182752 28 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182752 2:1827506-1827528 TGGGAAAAGGGGAGCATCCAGGG 0: 1
1: 1
2: 2
3: 23
4: 292
925182737_925182745 8 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG 0: 1
1: 1
2: 0
3: 9
4: 100
925182737_925182744 4 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182744 2:1827482-1827504 GAGAGTTGAGGGGACCTCTCTGG 0: 1
1: 1
2: 2
3: 18
4: 177
925182737_925182749 17 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182749 2:1827495-1827517 ACCTCTCTGGTTGGGAAAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 220
925182737_925182741 -8 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182741 2:1827470-1827492 AAGGGGATCTCAGAGAGTTGAGG 0: 1
1: 1
2: 0
3: 21
4: 215
925182737_925182748 16 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 172
925182737_925182746 9 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182746 2:1827487-1827509 TTGAGGGGACCTCTCTGGTTGGG 0: 1
1: 0
2: 2
3: 11
4: 97
925182737_925182751 27 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182751 2:1827505-1827527 TTGGGAAAAGGGGAGCATCCAGG 0: 1
1: 0
2: 2
3: 30
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925182737 Original CRISPR ATCCCCTTCTAGGCAGAGGG TGG (reversed) Intronic
901071283 1:6520017-6520039 TTCCCCTGCCAGGCAGAGAGGGG + Intronic
901351549 1:8601432-8601454 ACCCCCTTCCAGGGAGTGGGGGG + Intronic
901841586 1:11957247-11957269 ATCCCCTTCCAGGCCTAGGCTGG + Intronic
903214957 1:21838793-21838815 ATCCCCTTCCACGCAGAGCCGGG + Intronic
907413510 1:54298537-54298559 CTGCCCTTCTAGGCAGAGCGTGG + Intronic
913162147 1:116154125-116154147 TTCCCCTTCTGTGCAGAGGCTGG + Intergenic
914454713 1:147824898-147824920 AGCCTCTTCCAGGCAGATGGAGG + Intergenic
915868195 1:159528448-159528470 ATCCCCTCCTAGAGGGAGGGTGG - Intergenic
916496003 1:165347421-165347443 TTCTGCTTCTATGCAGAGGGTGG + Intronic
920500219 1:206480792-206480814 AGCCCCTTCTTGGGATAGGGAGG - Intronic
921079722 1:211729387-211729409 ATCCGCTTCTAAGCAGTTGGTGG + Intergenic
922040020 1:221887363-221887385 TTCCCTTTTTGGGCAGAGGGAGG - Intergenic
922125057 1:222713325-222713347 GTCCCGTTCGAGGCAGCGGGCGG - Intronic
1063598190 10:7456529-7456551 ATCCCATTCTAGGTAGACTGGGG - Intergenic
1064439432 10:15340364-15340386 AAAGCCTTTTAGGCAGAGGGAGG - Intronic
1067828762 10:49597980-49598002 GTTCCCTTCCAGGCAGAGGAAGG + Intergenic
1069982046 10:72259680-72259702 TTCCCCTTCTGGGCTGTGGGTGG + Intergenic
1073430202 10:103480859-103480881 ATCCCATTCTAGTCTCAGGGAGG + Intergenic
1073542594 10:104325648-104325670 GGCCCATTCTAGGAAGAGGGAGG - Intronic
1090461428 11:126894919-126894941 AAGCCATTCTAGGCAGAGAGAGG + Intronic
1093499728 12:19798312-19798334 ATCCCCTTCTTGGCCGGGCGCGG + Intergenic
1095615667 12:44184944-44184966 AGCACCATCTAGGCAGAGGGAGG - Intronic
1097938529 12:65279001-65279023 CTCCCCTTCTCGGCTGAGGCAGG - Intronic
1107908437 13:45083256-45083278 ATCCCTTTCTAGGCTGGGCGTGG + Intergenic
1112632551 13:101178577-101178599 CTCCCCTTCTCCGTAGAGGGTGG + Intronic
1119276196 14:73358497-73358519 ATTTCTTTCTAGGCAGAGGGAGG - Intronic
1202851731 14_GL000225v1_random:24525-24547 AGCCCCCTATAGGCAGAGCGTGG - Intergenic
1202854142 14_GL000225v1_random:39624-39646 TTCCCCCTGTAGGCAGAGAGTGG + Intergenic
1125402654 15:39320738-39320760 TTCATTTTCTAGGCAGAGGGTGG - Intergenic
1128562095 15:68675428-68675450 AGCATCTTCTAGGCAGAGGAGGG + Intronic
1130161874 15:81409660-81409682 GTCCCCTTCCAGGCTGTGGGAGG + Intergenic
1131142918 15:89992291-89992313 AGCACCATCTGGGCAGAGGGCGG - Intergenic
1132299205 15:100766056-100766078 ACCCCGTTCTGGGAAGAGGGGGG + Intergenic
1137564049 16:49522214-49522236 TTCTCCTTCCAGGCAGAGGGTGG + Intronic
1137721423 16:50629856-50629878 AGCCTCTTCTAGATAGAGGGAGG - Intronic
1138175620 16:54895743-54895765 AGCCCCTTGGTGGCAGAGGGAGG + Intergenic
1140033104 16:71354078-71354100 AAACACTTCTAGGCATAGGGAGG + Intergenic
1140728709 16:77837130-77837152 ATCTCACTCTAGGCAGAGGCAGG - Intronic
1143395468 17:6591864-6591886 GTCCCATTCTAGGCACAGTGAGG + Intronic
1151059687 17:71077782-71077804 ATCCCACTCTAGGAACAGGGTGG - Intergenic
1151432093 17:74070549-74070571 ATCCCCTTCCAGCCATAGAGTGG + Intergenic
1151485827 17:74398985-74399007 AGCCATTTCTAGGCAGAGGCTGG - Intergenic
1151494207 17:74449804-74449826 AGATCCATCTAGGCAGAGGGTGG - Intronic
1153830324 18:8916834-8916856 ATCACCTTCTAATCAGAGGGTGG + Intergenic
1157189101 18:45565764-45565786 GTGCCCTTCTAGGCACAGGAAGG + Intronic
1157901829 18:51525571-51525593 AGCCACTTACAGGCAGAGGGAGG + Intergenic
1158388284 18:57019840-57019862 ATTCCTTTCTAGACAAAGGGAGG + Intronic
1160427700 18:78789845-78789867 CTCCCGGTCTAGGCAGAGCGTGG - Intergenic
1160855153 19:1213915-1213937 ATCTGTTTCTAGGCAGACGGAGG + Intronic
1162933947 19:13971496-13971518 AACCACTTCTAGGCACAGGGAGG + Intronic
1164389326 19:27804869-27804891 ACCCTCTTCTGGGCAAAGGGAGG + Intergenic
1165329513 19:35133833-35133855 ATGCCCACCTAGGCTGAGGGTGG - Intronic
1165935893 19:39388858-39388880 ATCCACATCTAGGGAGATGGAGG + Exonic
1167717134 19:51150743-51150765 AGAGCCTTCCAGGCAGAGGGAGG + Intronic
925182737 2:1827455-1827477 ATCCCCTTCTAGGCAGAGGGTGG - Intronic
925282391 2:2693730-2693752 ATCCACTTTTAGGCAGACTGAGG + Intergenic
925350434 2:3197573-3197595 ACCCTCTTTTAGGCAGGGGGAGG - Intronic
926239088 2:11071090-11071112 ATCCCCTCCTATACAAAGGGAGG - Intergenic
926880151 2:17536777-17536799 ATTCCCTTCTCTGCAGAAGGAGG + Intergenic
932813755 2:74845245-74845267 AGCCCCTTCCTGGCAGAGGCTGG + Intronic
933684743 2:85133799-85133821 ATCCCCTTCCAGGACGAGGGGGG + Exonic
936091245 2:109502641-109502663 ATCACCGTCTAGACAGAGCGCGG - Intronic
936116012 2:109703847-109703869 CTCCACTTTTGGGCAGAGGGAGG - Intergenic
936606993 2:113968718-113968740 ATCCACTTCTAGCCATAGAGAGG - Intergenic
937083444 2:119156460-119156482 CTCCGCTTCTAGGCACTGGGAGG + Exonic
937122725 2:119451979-119452001 ATCCCCAGCTAGGGAGAGGAGGG + Intronic
937435551 2:121877430-121877452 ATCCACTTCCAGGCATAGAGGGG - Intergenic
940144545 2:150532536-150532558 ATCTCCTTCAAGGCAGGAGGAGG + Intronic
940201301 2:151153818-151153840 TTCCCCTTCCAGGCAGCAGGAGG - Intergenic
941160495 2:162029409-162029431 ATCCCCATCAGAGCAGAGGGTGG - Intronic
942459331 2:176158854-176158876 ATCCCCTTGTAGGCCCAGAGAGG + Intronic
946182235 2:217955629-217955651 AGCCCCTCCTAAGCAGTGGGAGG + Intronic
947952655 2:234161437-234161459 AGCCCCCTGGAGGCAGAGGGTGG + Intergenic
948370609 2:237487147-237487169 ATGCCCTGCCAGGCAGAGGGCGG - Exonic
1168813507 20:721397-721419 AGCCCCTTCAGGGCAGAGAGAGG - Intergenic
1169209151 20:3755997-3756019 TTTCCCTTGTAGGCAGTGGGTGG - Intronic
1169731524 20:8790640-8790662 ATCCTCTGCTGGACAGAGGGTGG - Intronic
1175321955 20:58094491-58094513 AGCCCCTTCTAGGCTGTGGCTGG - Intergenic
1175564063 20:59958860-59958882 TGCCCCTTCTAGGCTAAGGGAGG + Intronic
1177321397 21:19525426-19525448 ATCCCCTGCTAGGCACAAGTTGG - Intergenic
1178704581 21:34862665-34862687 ATGTCCTTCTAAGAAGAGGGAGG - Intronic
1180853680 22:19033750-19033772 GACCCCTCCTAGGCAGAGGCAGG - Intergenic
1181322948 22:22022716-22022738 AGCCCCTCCTCTGCAGAGGGTGG + Intergenic
1184475769 22:44720489-44720511 GACCCCTTCCAGGCAGAGGAGGG - Intronic
1185096440 22:48808547-48808569 ATCCTCTTCCAGGCCCAGGGGGG + Intronic
950303721 3:11902596-11902618 TTACCCTCCTAGGCAGGGGGTGG + Intergenic
950490298 3:13300595-13300617 AGCCCCTGCTAGGGAGTGGGTGG - Intergenic
954189996 3:48952701-48952723 ATCCCCATCTTGCCAGTGGGGGG - Intronic
957387824 3:79519798-79519820 ATCCTCCTCTAGGCAAAGGTAGG + Intronic
957535883 3:81502971-81502993 GTCCTCTGCTAGGCATAGGGAGG - Intronic
958944689 3:100350110-100350132 AGCTACCTCTAGGCAGAGGGAGG - Intronic
963806636 3:149729134-149729156 ATCCCCTTCCAGGCTGGGTGCGG - Intronic
964649684 3:158996626-158996648 AACCCCTTCAGGGCAGAGGAGGG - Intronic
964767139 3:160190194-160190216 GCCCCCTTCTAGGCAGAAGGGGG + Intergenic
965869615 3:173250130-173250152 ATCCTCTTCTAGGGATAGTGAGG - Intergenic
968185689 3:196632455-196632477 ATCACCTTCCAGGCTCAGGGCGG + Intergenic
968267288 3:197372001-197372023 TCCCCCTTTCAGGCAGAGGGAGG + Intergenic
968521510 4:1036610-1036632 ACCCCCATCGGGGCAGAGGGTGG - Intergenic
969875904 4:10135335-10135357 ACCCCCTTCTAGGCAGATTCAGG + Intergenic
972263950 4:37440581-37440603 ACCTCCTTCTAGGGAGGGGGAGG + Intronic
977798910 4:101201916-101201938 ATCCCATGCTAGGCAGTGAGAGG + Intronic
983458743 4:167999942-167999964 ATACCCTTCAAGGAAGAGAGAGG + Intergenic
984958288 4:185068170-185068192 ACTCTCTCCTAGGCAGAGGGGGG - Intergenic
986532874 5:8757741-8757763 ATGCCCTTATAAGCAGAGGAAGG + Intergenic
986559992 5:9050845-9050867 GTCACCTTCCCGGCAGAGGGAGG + Intronic
986574689 5:9199422-9199444 ATCCCATCCTAGGAAGAGCGGGG - Intronic
988722412 5:33892045-33892067 CTCCCCTTTTAGGAGGAGGGAGG - Exonic
988811575 5:34790157-34790179 AACTGCTTCTAGGCATAGGGTGG + Intronic
990059920 5:51635094-51635116 ATCTCCATCTAAGCAGAGGAAGG + Intergenic
991707304 5:69369897-69369919 ATCCCCTTTTAGGCGAAGAGCGG - Exonic
1001292629 5:170474883-170474905 GTCCCCTTCTACGCGGTGGGGGG - Intronic
1001875394 5:175195737-175195759 TTTCCCTCCTAAGCAGAGGGCGG + Intergenic
1001917208 5:175571707-175571729 ATCCTCTGCAATGCAGAGGGAGG - Intergenic
1002463158 5:179386982-179387004 GTCCCCAGCTAGGCTGAGGGTGG - Intergenic
1003097811 6:3156413-3156435 ATGCCCTTCTAGGGAGAGGGTGG + Intronic
1004035793 6:11921386-11921408 ATCCCCTTCTTTGTAGATGGAGG - Intergenic
1004896857 6:20156415-20156437 ATTCCCTCCTGGGGAGAGGGTGG - Intronic
1006098993 6:31674020-31674042 ATCTCCAGCTAAGCAGAGGGTGG - Intergenic
1007408819 6:41649822-41649844 ATCCCCCTCCAGGCACAGGAAGG + Exonic
1011615401 6:89193452-89193474 ATCTGCTTTTAGGCACAGGGAGG + Intronic
1014358563 6:120444740-120444762 ATCCCCATCCAGGGAGAGGTGGG - Intergenic
1015894772 6:138006648-138006670 ATCAGCTCCCAGGCAGAGGGTGG - Intergenic
1016923531 6:149318082-149318104 AGCCCCTTCCAGACGGAGGGGGG - Intronic
1018861194 6:167712099-167712121 GGACCCTTCTAGGCAGAGGGAGG + Intergenic
1020104956 7:5418513-5418535 AGCCCCTCCTAGGCCGAGGGAGG - Intronic
1020875593 7:13689673-13689695 AGCTTCTTCTAGGCAGAGGATGG - Intergenic
1022294434 7:29036868-29036890 ATCCCATTTTAGGCACAAGGAGG + Intronic
1023306006 7:38827596-38827618 CTCCCCATCTTGGCAGTGGGAGG - Intronic
1023758517 7:43442517-43442539 ATTTCCTTCTAGGGATAGGGTGG + Exonic
1025638693 7:63348579-63348601 ACCCTCTCCTGGGCAGAGGGAGG + Intergenic
1025644003 7:63399510-63399532 ACCCTCTCCTGGGCAGAGGGAGG - Intergenic
1027357241 7:77369957-77369979 TTCCCCTTCTCGGCAGTGTGTGG - Intronic
1034381713 7:150701716-150701738 AGCCCCTTCCAGGCAGAAGCTGG - Intergenic
1035387348 7:158482971-158482993 ATTCCCCTCTGGGCATAGGGAGG - Intronic
1035399546 7:158555756-158555778 ATGGCCTGCTAGGCAGTGGGTGG - Intronic
1036700719 8:11012093-11012115 GTCCCCATCTAAGCAGATGGAGG + Intronic
1037076239 8:14722750-14722772 AAAACCTTCTAGGCAGAGGGAGG + Intronic
1037082071 8:14799638-14799660 TTCACCTACTAGGCAGAGGAAGG + Intronic
1037579247 8:20234953-20234975 ACCCCCTTCTTAACAGAGGGCGG + Intergenic
1047181290 8:122590676-122590698 ACCCCTTTCTAAGCAGAGAGTGG + Intergenic
1052550603 9:29942564-29942586 ATCCCCCTCTAAACTGAGGGGGG - Intergenic
1052841829 9:33298287-33298309 AGAGCATTCTAGGCAGAGGGAGG + Intronic
1052981372 9:34452211-34452233 AGCCCTTTTGAGGCAGAGGGGGG + Intronic
1053474173 9:38370158-38370180 ATGCCATTCCAGGCAGAGAGAGG + Intergenic
1057006437 9:91564885-91564907 TTAGCCTTCAAGGCAGAGGGAGG - Intronic
1057608924 9:96523390-96523412 GTCCCCTTCCAGCCAGAGGTTGG + Exonic
1059241174 9:112807149-112807171 ATCCCCTTGAACCCAGAGGGCGG - Intronic
1060922706 9:127433540-127433562 ATCCTCTGCTAGGTACAGGGCGG - Intronic
1186556550 X:10566098-10566120 ATCACTTTCTAGGCAGGGCGTGG - Intronic
1186574101 X:10747071-10747093 ATACCCAGCTACGCAGAGGGAGG + Intronic
1186889740 X:13948336-13948358 ATCCAAATCTAGGCTGAGGGTGG - Intergenic
1189633382 X:42978165-42978187 ATACACTTCTAGGCCGAGGTGGG - Intergenic
1192915528 X:75647199-75647221 ATCACCTTCTAATCAAAGGGAGG - Intergenic
1193606801 X:83579135-83579157 ATGCCCTCCTTGGCAGAGGTGGG + Intergenic
1194861536 X:99004753-99004775 ATCACTTGCTAGGCAGAGCGTGG - Intergenic
1195936556 X:110131205-110131227 ATTCCCTTCTTGGCAGATGGTGG + Intronic
1197298009 X:124742924-124742946 CTCCCCTTCTAGGCAGGAGTAGG + Intronic