ID: 925182739

View in Genome Browser
Species Human (GRCh38)
Location 2:1827459-1827481
Sequence TGAGATCCCCTTCTAGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 178}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925182739_925182752 24 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182752 2:1827506-1827528 TGGGAAAAGGGGAGCATCCAGGG 0: 1
1: 1
2: 2
3: 23
4: 292
925182739_925182745 4 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG 0: 1
1: 1
2: 0
3: 9
4: 100
925182739_925182744 0 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182744 2:1827482-1827504 GAGAGTTGAGGGGACCTCTCTGG 0: 1
1: 1
2: 2
3: 18
4: 177
925182739_925182743 -10 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182743 2:1827472-1827494 GGGGATCTCAGAGAGTTGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 183
925182739_925182747 11 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 162
925182739_925182746 5 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182746 2:1827487-1827509 TTGAGGGGACCTCTCTGGTTGGG 0: 1
1: 0
2: 2
3: 11
4: 97
925182739_925182748 12 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 172
925182739_925182751 23 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182751 2:1827505-1827527 TTGGGAAAAGGGGAGCATCCAGG 0: 1
1: 0
2: 2
3: 30
4: 330
925182739_925182749 13 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182749 2:1827495-1827517 ACCTCTCTGGTTGGGAAAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925182739 Original CRISPR TGAGATCCCCTTCTAGGCAG AGG (reversed) Intronic
900990812 1:6097365-6097387 TGAGAGGCCCTGCTGGGCAGAGG + Intronic
902247995 1:15134426-15134448 TGATATCCTATTCTGGGCAGAGG + Intergenic
903469578 1:23576614-23576636 TGAGAAGCCCTGCTATGCAGAGG - Intergenic
906956101 1:50375842-50375864 TGAAAACCCCTTCTAGACATTGG + Intergenic
908742403 1:67342283-67342305 TGAGATTTCCTTCTTTGCAGTGG - Intronic
912438984 1:109684022-109684044 TGAGGTCCCGTTCCAGCCAGTGG + Intronic
912441506 1:109702467-109702489 TGAGGTCCCGTTCCAGCCAGTGG + Intronic
917249806 1:173046087-173046109 TGAAATCCACTTGAAGGCAGTGG + Intronic
917796206 1:178534547-178534569 TGGGATCCCCTGGGAGGCAGAGG - Intronic
919973396 1:202595158-202595180 TGAGGTCCCCTTGTGGCCAGAGG - Exonic
921131211 1:212221617-212221639 TGAGAACCCCTTCAAAGAAGGGG - Intergenic
1065990050 10:31000243-31000265 TGACATCACCATCTAGCCAGCGG + Intronic
1066094312 10:32057578-32057600 TGAGCTCTTCTTCAAGGCAGTGG - Intergenic
1066219248 10:33319474-33319496 TCAGGTCCCCTTCCAGGCTGTGG + Intronic
1066367221 10:34788845-34788867 GGAGGTCCCCTCCTTGGCAGAGG + Intronic
1067539276 10:47140023-47140045 TGGGGTCCCCTTCCAGGCTGTGG - Intergenic
1068128965 10:52873856-52873878 TAAGATCCCCTTGTGGGCAAAGG - Intergenic
1069896316 10:71682380-71682402 TGAGATGCCCGTCCAGACAGGGG - Intronic
1071037899 10:81269200-81269222 TGGGTTCCCCTTCCAGGCCGTGG + Intergenic
1071357712 10:84814608-84814630 TGAGATACCATTCTGGGCATAGG - Intergenic
1072232605 10:93425873-93425895 TGAAATGCCCTTCAAGGTAGAGG - Intronic
1074875541 10:117610485-117610507 GGTGAAGCCCTTCTAGGCAGGGG + Intergenic
1076242157 10:128916745-128916767 TGAGTTCCCCCTCTGGGCAATGG + Intergenic
1078361078 11:10668081-10668103 GGGGATGGCCTTCTAGGCAGAGG - Intronic
1078524404 11:12089683-12089705 TGGGAACCCCATCTGGGCAGTGG + Intergenic
1079306069 11:19323874-19323896 TGAAATAGCCTTTTAGGCAGTGG + Intergenic
1080865009 11:36186189-36186211 TGAGTTCCCCATCTATGAAGTGG + Intronic
1083016298 11:59457634-59457656 TGAGATCCCACTCTGGGGAGGGG + Exonic
1083049038 11:59760765-59760787 TGAGATCCCCATCTGGGAAGTGG + Intronic
1083539146 11:63499946-63499968 TGAGGTCCCGTTCCAGCCAGTGG + Intergenic
1083751601 11:64763898-64763920 TGAGGTCCTCTCCTGGGCAGAGG - Intergenic
1083968133 11:66055442-66055464 TGAGATCCTCTTCCAGTCAAGGG - Intronic
1084346383 11:68552560-68552582 TGAGAGCACCTTCTAAGCAGGGG - Intronic
1084723832 11:70927547-70927569 TGAGTTCCCCATCTCTGCAGGGG + Intronic
1085852601 11:80139325-80139347 TGGGGTCCCCTTCCAGGCTGTGG + Intergenic
1088102836 11:106174004-106174026 TGAGGTCCCGTTCCAGCCAGTGG - Intergenic
1089223350 11:116894267-116894289 TGAGCTCACTTTTTAGGCAGTGG - Intronic
1089786786 11:120913276-120913298 TGAGATGTCCTTCCAGACAGAGG + Intronic
1090062327 11:123474962-123474984 TCAGAACCCCTTCTGGGCATAGG + Intergenic
1090757111 11:129802324-129802346 TCAGGTCCCCTTCTATGCTGTGG - Intergenic
1091592862 12:1855659-1855681 AGAGGTCCACTTCTAGACAGTGG + Intronic
1092030378 12:5278665-5278687 AGAGAGCCCTTTCTGGGCAGAGG - Intergenic
1092630587 12:10372042-10372064 TGAGGTCCCGTTCCAGCCAGTGG + Intergenic
1093076681 12:14766174-14766196 TGAGGTCCCGTTCCAGCCAGTGG + Intergenic
1094310029 12:29070105-29070127 TCAGAACCCCATCTAGGGAGTGG + Intergenic
1094349788 12:29511373-29511395 TCATATCCCCTGCTAGGCACTGG - Intronic
1096478799 12:51924471-51924493 TGAGGTCTACTTGTAGGCAGGGG - Intergenic
1100312748 12:93412649-93412671 TGAGATCCCGTTCCAGCCAGTGG - Intronic
1104369748 12:128213467-128213489 TCAGAAACCCTTCTAGGCACTGG - Intergenic
1104495210 12:129230608-129230630 TGAGATCATCTTCTAGGGTGTGG - Intronic
1104739175 12:131160193-131160215 TGAAATCTCCTTGAAGGCAGGGG + Intergenic
1106034540 13:26031832-26031854 TCAGGTCCCCTTCTACGCTGTGG - Intergenic
1109506289 13:63306710-63306732 TCAGGTCCCCTTCTATGCTGTGG + Intergenic
1109826833 13:67732508-67732530 TGGGAGCACCTTCCAGGCAGAGG - Intergenic
1109826852 13:67732635-67732657 TGGGAGCACCTTCCAGGCAGAGG - Intergenic
1111250538 13:85595513-85595535 TGAGGTCCCCTTCCATGCTGTGG + Intergenic
1112929503 13:104716274-104716296 TGAGGTCCCGTTCCAGCCAGTGG + Intergenic
1118235933 14:64005016-64005038 AGAAATAGCCTTCTAGGCAGAGG + Intronic
1122876885 14:104671582-104671604 TGCGATCCCCTTTTAGGAAGGGG + Intergenic
1124507220 15:30288929-30288951 TGAGAGCCCCTCCAAGCCAGTGG - Intergenic
1124711428 15:32015916-32015938 TGAGAGCCCCTTCTGGGCACTGG - Intergenic
1124736336 15:32249730-32249752 TGAGAGCCCCTCCAAGCCAGTGG + Intergenic
1130415850 15:83694078-83694100 TCAGGGCCCCATCTAGGCAGTGG - Intronic
1135229687 16:20694215-20694237 TGAGGTCCCGTTCCAGCCAGTGG + Intronic
1136923639 16:34351248-34351270 TGAGATCTCCATCTGGGGAGGGG - Intergenic
1136980934 16:35060558-35060580 TGAGATCTCCATCTGGGGAGGGG + Intergenic
1143345791 17:6248035-6248057 TGGGAGCCCCTTGAAGGCAGAGG - Intergenic
1143737227 17:8920505-8920527 TGCGATCCTCATCTATGCAGAGG - Intronic
1146061212 17:29608299-29608321 TGAGAACACATTCCAGGCAGGGG - Intronic
1150219579 17:63488583-63488605 TGAGCTCCCCTTACAAGCAGAGG + Intronic
1151596952 17:75083998-75084020 TGACATCCCCTGCTAGGATGAGG - Intergenic
1153979586 18:10297633-10297655 TGAGATGCCCTGCTGGGCAGGGG + Intergenic
1154293985 18:13134235-13134257 TGAGGTCCCCTTCCAGGGTGTGG - Intergenic
1154960368 18:21302423-21302445 TGAGAGCTCCTACTAGGCAATGG + Intronic
1158266498 18:55665287-55665309 TGGGGTCCCCTTCTACGCTGTGG + Intergenic
1159459808 18:68710584-68710606 TGACCTCCCCTTCTTGCCAGTGG - Intronic
1162271885 19:9622588-9622610 TGAGGTCCCATTCCAGCCAGTGG - Intronic
1164319597 19:24131446-24131468 TGAGGTCCCATTCTAGCCAATGG - Intergenic
1165109196 19:33491639-33491661 TGGGGTCCCGTTCCAGGCAGTGG - Intronic
1168602335 19:57727739-57727761 TGAGCTATCCTTCAAGGCAGGGG + Intronic
925182739 2:1827459-1827481 TGAGATCCCCTTCTAGGCAGAGG - Intronic
926425366 2:12734705-12734727 TGAGTTCCCCAACTAGGCACTGG - Intronic
930650737 2:53961893-53961915 TGAGGTCCCGTTCTAGCAAGTGG - Intronic
931536307 2:63280890-63280912 AGAGAAACCCTTCTAGACAGTGG + Intronic
931629035 2:64283066-64283088 TGAGTTCCCATTCTATGGAGTGG - Intergenic
932017281 2:68043980-68044002 GGAAATATCCTTCTAGGCAGAGG - Intronic
932374316 2:71222022-71222044 TGGGGTCCCCTTCCAGGCTGTGG + Intronic
933067434 2:77815624-77815646 TGGGGTCCCCTTCTAGACTGTGG - Intergenic
935787211 2:106560105-106560127 TGAAGTCCCATTCTAGCCAGTGG + Intergenic
936877917 2:117214633-117214655 TGTGATCTCCTTCAGGGCAGTGG - Intergenic
937050432 2:118883904-118883926 TGGGATCCCCTTCTATGCTGTGG - Intergenic
938126945 2:128681271-128681293 TGAGGTCCCCTTCCAGCCAATGG + Intergenic
940090102 2:149905675-149905697 TGACATACCCATCTAGGGAGAGG + Intergenic
940854711 2:158720932-158720954 AGAGATGACCTTCTTGGCAGGGG - Intergenic
940865727 2:158816151-158816173 TGAGTTCTCCTTGAAGGCAGAGG + Intronic
945053584 2:205848925-205848947 TGCGCTGCCCTTCTAGGCAGGGG + Intergenic
945950336 2:216033580-216033602 TGAAATCCCCTTCTTGACTGAGG - Intronic
948201321 2:236131364-236131386 TGAGATGCATTTCTAGGCAGGGG + Exonic
1170788161 20:19485838-19485860 AGAGATCCCCCTCTAGACAACGG + Intronic
1172864499 20:38085303-38085325 TGAATTCCAGTTCTAGGCAGGGG + Intronic
1173472429 20:43334152-43334174 TGAGGTCCCATTCTAGCCAATGG + Intergenic
1175321956 20:58094495-58094517 AGGGAGCCCCTTCTAGGCTGTGG - Intergenic
1177197833 21:17921420-17921442 TGTGTGCCCCTTATAGGCAGGGG + Intronic
1178271600 21:31194844-31194866 TGAGAGCTCCCTCTGGGCAGTGG - Intronic
1178703751 21:34855870-34855892 TAAGAACCCATTCCAGGCAGAGG + Intronic
1179016316 21:37596887-37596909 TGAGGTTCCCTTCCAGCCAGTGG + Intergenic
1180729834 22:17973007-17973029 TGAGGGCCCCTTGTAGCCAGAGG - Intronic
1180853681 22:19033754-19033776 TCAGGACCCCTCCTAGGCAGAGG - Intergenic
1181107540 22:20583959-20583981 AGAGAGACCCTTCTAGACAGGGG - Intronic
1181926992 22:26367736-26367758 GGAGATCACCCTGTAGGCAGTGG - Intronic
1182111618 22:27727545-27727567 TGAGAACTCCTTCCAGGCAGAGG - Intergenic
949770154 3:7569566-7569588 TGAGGTCCCCTTCCACGCCGTGG + Intronic
949789907 3:7781643-7781665 CGAGATCCCCCACTAGGCACTGG + Intergenic
950221465 3:11199609-11199631 TCTGTTCCCCTCCTAGGCAGAGG + Intronic
950641846 3:14353572-14353594 TGGGATCTCCTTAAAGGCAGAGG + Intergenic
950838272 3:15941446-15941468 TGAGGTCCCCTTCCATGCCGTGG - Intergenic
952849305 3:37714481-37714503 TGAGAGCCCCTTCTGAGCAGGGG - Intronic
953068866 3:39500054-39500076 TGAGCTCACCTTGTAGGTAGAGG - Intronic
954067018 3:48114931-48114953 TGAGGTCCCGTTCCAGCCAGTGG + Intergenic
954542926 3:51407444-51407466 TAACATCCGCTTCTAGGCAGTGG + Intronic
955493956 3:59511753-59511775 TGAGGTCCCCTTCCACGCTGTGG + Intergenic
956843314 3:73159407-73159429 TGAGGTCCCCTTCCACGCTGTGG - Intergenic
959274576 3:104262188-104262210 TGATATCCCATTTTATGCAGAGG + Intergenic
959840014 3:110964662-110964684 TGAGGTCCCATTCTAGCCAGTGG - Intergenic
962436261 3:135369900-135369922 TGAGATCATCATCTAGGCAAGGG - Intergenic
967318146 3:188169796-188169818 TGAGTACCCCTTCTGGGCTGTGG - Intronic
967367122 3:188699809-188699831 GGAGAACCCCTTCTGGCCAGGGG - Intronic
970612557 4:17739268-17739290 GCGGATCCCCTTCCAGGCAGAGG + Intronic
970684398 4:18549756-18549778 TGATATCCCCTTAAAAGCAGTGG + Intergenic
971258209 4:25032226-25032248 TGTGACCCCCTTGTAGCCAGTGG - Intergenic
971798632 4:31259799-31259821 TGAGGTCTCCTTCTATGCTGTGG + Intergenic
975369522 4:73568475-73568497 TGTCCTTCCCTTCTAGGCAGTGG + Intergenic
976833198 4:89339013-89339035 AGAGATCCAGTTCTAGTCAGGGG + Intergenic
977449919 4:97182342-97182364 TCAGATCCCCTTCCATGCTGTGG + Intergenic
979495667 4:121380244-121380266 AGAGATCCCCTGAAAGGCAGAGG + Intronic
979528377 4:121741266-121741288 GGGGAAGCCCTTCTAGGCAGAGG - Intergenic
980655546 4:135779334-135779356 GGAGATTCCATTCTGGGCAGAGG + Intergenic
980698884 4:136396263-136396285 TGGGCTCCCCTTCTATGCTGTGG + Intergenic
980894597 4:138850189-138850211 TCAGATACCCTTATAAGCAGTGG + Intergenic
982109399 4:152040148-152040170 TGACATCTGCTTCTTGGCAGGGG - Intergenic
982210818 4:153034199-153034221 TGAGAACTCCTTGTAGGAAGGGG + Intergenic
982971384 4:161992284-161992306 TGGGATATTCTTCTAGGCAGAGG + Intronic
983230523 4:165125459-165125481 TGGGGTCCCCTTCCAGGCTGTGG - Intronic
984930741 4:184845122-184845144 TGAGACAACATTCTAGGCAGAGG + Intergenic
984940053 4:184923104-184923126 TGAGGTCCCGTTCTAGCCAACGG + Intergenic
986661894 5:10066450-10066472 TCACATCCCCTTCCACGCAGTGG + Intergenic
987467203 5:18285952-18285974 TCAGGTCCCCTTCCAGGCTGTGG + Intergenic
988619131 5:32804543-32804565 TCAGATCCCCTTCCATGCTGTGG - Intergenic
990937817 5:61168878-61168900 TGAGATACCCTAGTAGGAAGAGG + Intergenic
992993832 5:82313183-82313205 TGAGAGGCCCTTCTGGGGAGAGG + Intronic
993464907 5:88233118-88233140 TCAGATACTCTGCTAGGCAGAGG + Intronic
993526868 5:88975859-88975881 AGGGACTCCCTTCTAGGCAGAGG + Intergenic
998859963 5:146432905-146432927 TGAGGTCCCGTTCCAGCCAGTGG - Intergenic
999678575 5:154032575-154032597 TGAGATCCTGTTCTAGGCAATGG + Intronic
1000172946 5:158721756-158721778 TGAGATCCCCTTGCAGGAAAGGG - Intronic
1001292633 5:170474887-170474909 TGGGGTCCCCTTCTACGCGGTGG - Intronic
1002842265 6:916253-916275 TCAGGTCCCCTTCTCGGCTGCGG + Intergenic
1003097809 6:3156409-3156431 GCAGATGCCCTTCTAGGGAGAGG + Intronic
1003475591 6:6479199-6479221 TGAGGTCCCGTTCCAGCCAGTGG - Intergenic
1004755078 6:18601929-18601951 TGCCATCCCCCTCTAGCCAGAGG - Intergenic
1006412242 6:33880917-33880939 TGAGGTCCCGTTCCAGCCAGTGG + Intergenic
1008230697 6:48982964-48982986 TGGGATCCCCTTCCACGCTGTGG - Intergenic
1009347934 6:62639690-62639712 GGAGAACACATTCTAGGCAGGGG - Intergenic
1013640267 6:112069169-112069191 TAAGATCCCCTTCTTATCAGAGG - Intronic
1014111377 6:117621790-117621812 TAAGGTCCCGTTCTAGCCAGTGG + Intergenic
1016376581 6:143427389-143427411 CGAGGCCCCCTTCTGGGCAGAGG + Exonic
1017380396 6:153821677-153821699 TCAGATCCCCTTCCATGCTGTGG + Intergenic
1019640896 7:2103132-2103154 AGAGAGCCCGTTCCAGGCAGAGG - Intronic
1020657361 7:10943392-10943414 TGATATCTCCTTCTAGGTAGAGG - Intergenic
1021355988 7:19653979-19654001 TCAGATCCCCTTCCATGCTGTGG - Intergenic
1021392812 7:20115137-20115159 TGAGCTCCTCTTCTAGACTGAGG + Intergenic
1022544439 7:31173176-31173198 TGAGAAACCCTTGTAGGGAGAGG + Intergenic
1023477408 7:40595486-40595508 TGACATCACCTTAGAGGCAGAGG + Intronic
1028848758 7:95512735-95512757 TGAGTTCCCCTTCTAGCTATAGG - Intronic
1029176738 7:98670005-98670027 TGAGACCCCCTTCGAGGCCGTGG + Intergenic
1030747187 7:113180818-113180840 TGAGATCACCTTGAAGACAGGGG + Intergenic
1031077887 7:117230251-117230273 TGAGAACCCCTTATAGGCAGAGG + Intergenic
1034746281 7:153526797-153526819 TGAGATCCCCGACTATGTAGTGG - Intergenic
1034806876 7:154096999-154097021 TGTGCTCCCCTTGTAGGTAGAGG + Intronic
1035182022 7:157096482-157096504 TGCCATCCCCTTCCAGGCCGTGG - Intergenic
1038525095 8:28266222-28266244 TGAGGTCCCGTTCCAGCCAGTGG - Intergenic
1043165932 8:76902465-76902487 TGAGAACAACTTCTAGACAGAGG - Intergenic
1043916446 8:85927971-85927993 TTGGGTCCCCTTCTAGGCTGTGG + Intergenic
1053280304 9:36816281-36816303 TGGGATCCCCTTCTGTGCACTGG - Intergenic
1060778141 9:126391837-126391859 TGTGGTCCCCTTCTCAGCAGGGG + Intronic
1187579353 X:20591940-20591962 TGCCATTCCCTTCAAGGCAGTGG + Intergenic
1187675803 X:21715516-21715538 TGAGAAGCCCTCCTAGGCTGTGG - Intronic
1187773146 X:22724706-22724728 AGAAAACCCCTTCTAGGCATTGG + Intergenic
1188456284 X:30370226-30370248 TCAGATCCCATACTAGGCAGCGG - Intergenic
1189784305 X:44545553-44545575 TGAGGTCCCGTTCCAGCCAGTGG - Intergenic
1192482136 X:71494818-71494840 TCAGGTCCCCTTCCATGCAGTGG - Intronic
1198773859 X:140158909-140158931 TGAGATCCTCTTCTCTGCAAAGG - Intergenic
1199332156 X:146575014-146575036 TGAGATCCCATTCCAGCCAATGG - Intergenic
1200762446 Y:7052607-7052629 TGAGGTCCCATTCCAGCCAGTGG - Intronic
1200962193 Y:9005932-9005954 AGAGAGCCCCTGCTAGGCATAGG + Intergenic
1200981709 Y:9268570-9268592 AGAGAGCCCCTGCTAGGCATAGG - Intergenic
1202021346 Y:20467844-20467866 TGGGATCCCCTTCCAGGCTGTGG + Intergenic
1202128707 Y:21591154-21591176 AGAGAGCCCCTGCTAGGCATAGG + Intergenic