ID: 925182740

View in Genome Browser
Species Human (GRCh38)
Location 2:1827465-1827487
Sequence ACTCTCTGAGATCCCCTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925182740_925182749 7 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182749 2:1827495-1827517 ACCTCTCTGGTTGGGAAAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 220
925182740_925182746 -1 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182746 2:1827487-1827509 TTGAGGGGACCTCTCTGGTTGGG 0: 1
1: 0
2: 2
3: 11
4: 97
925182740_925182752 18 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182752 2:1827506-1827528 TGGGAAAAGGGGAGCATCCAGGG 0: 1
1: 1
2: 2
3: 23
4: 292
925182740_925182753 27 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182753 2:1827515-1827537 GGGAGCATCCAGGGAGCGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 256
925182740_925182745 -2 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG 0: 1
1: 1
2: 0
3: 9
4: 100
925182740_925182751 17 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182751 2:1827505-1827527 TTGGGAAAAGGGGAGCATCCAGG 0: 1
1: 0
2: 2
3: 30
4: 330
925182740_925182747 5 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 162
925182740_925182748 6 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 172
925182740_925182744 -6 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182744 2:1827482-1827504 GAGAGTTGAGGGGACCTCTCTGG 0: 1
1: 1
2: 2
3: 18
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925182740 Original CRISPR ACTCTCTGAGATCCCCTTCT AGG (reversed) Intronic
900602238 1:3507968-3507990 ACACTCTGAGACCCCTTCCTAGG + Intronic
900970426 1:5989680-5989702 CCTCTCTGAAATCCCCACCTGGG - Intronic
903621413 1:24700956-24700978 ACCCGCTGAGATCCACTTCCTGG + Intergenic
904320470 1:29694883-29694905 ACTCTCTGAGCTTCTCCTCTGGG + Intergenic
904437259 1:30506889-30506911 CCTCTCTGAGCTTCTCTTCTGGG - Intergenic
904493204 1:30872824-30872846 GCTCACTGAGATCTCCTTTTTGG - Intronic
907074608 1:51566883-51566905 GCTCTCTGAGATCCTCCTCTGGG - Intergenic
907276034 1:53317102-53317124 ACACTCTCAGAGCCCTTTCTCGG - Intronic
908783332 1:67711711-67711733 ATTCTCTGAGCTCCCCTTATCGG - Intronic
911043450 1:93609720-93609742 ACTCCCTGTGCTCCCCTTCCAGG + Intronic
912401011 1:109392846-109392868 ACTCTGTAGGATCTCCTTCTTGG - Intronic
915078944 1:153338124-153338146 CCTTTCTGGGATCCCCATCTTGG + Intronic
915731148 1:158055393-158055415 TCTCTCTCAAATCCCCTGCTTGG - Intronic
920687494 1:208120508-208120530 ACTCTCTGAGACTCCCTTTCAGG + Intronic
922088991 1:222377805-222377827 ACCATCTGAGATCCCATACTAGG + Intergenic
1065774703 10:29108615-29108637 ACTCACTAATATCCCCTTCCTGG - Intergenic
1070494639 10:77010417-77010439 TCTCTCTTAGATGCTCTTCTCGG + Intronic
1070612479 10:77943073-77943095 ACTCTCTGAAATCCCTTCCCCGG + Intergenic
1073816614 10:107214411-107214433 ACTGTCTGCCATCCTCTTCTGGG - Intergenic
1075953402 10:126501609-126501631 ACTCTCTGAACTCCTCATCTGGG - Intronic
1076794176 10:132790743-132790765 ACTCTCTGAGCACCCCTTCAGGG + Intergenic
1077405882 11:2382330-2382352 ACTCTCAAAGCTCCCCTGCTGGG - Intronic
1083031925 11:59600495-59600517 ACTCTCTAAGATCCCCATGCCGG - Exonic
1084268518 11:68017078-68017100 ACTCTCTCTGAGCCTCTTCTGGG - Intronic
1084359549 11:68660640-68660662 CCTCTCTGCGATGCCCTTCCAGG - Intergenic
1084569087 11:69948909-69948931 ACTCTCTCAGATCCCCCTTTCGG - Intergenic
1085316362 11:75547649-75547671 ACACTCTGAGAACCACTGCTGGG + Intergenic
1085775504 11:79362548-79362570 ACTCTCTGACATCCAATCCTGGG + Intronic
1089412713 11:118260175-118260197 CTTCTCTGAGATCCACTTCCTGG - Exonic
1090062326 11:123474956-123474978 AATCTCTCAGAACCCCTTCTGGG + Intergenic
1092861394 12:12723239-12723261 ACTCTTTGAGAGCTCCTTTTGGG - Intergenic
1100225486 12:92551907-92551929 AATCTCTGAGAGCCCTGTCTAGG + Intergenic
1101560091 12:105848767-105848789 TCTCTATGACATCCCCTTCAGGG + Intergenic
1104384528 12:128339006-128339028 TCTCTCTGAGTGCCCCTCCTGGG + Intronic
1108516993 13:51212894-51212916 GCCCTCTGAGATCCCCGTGTCGG + Intergenic
1111076011 13:83236524-83236546 GCTCTCTGAAAACCCCTTGTGGG - Intergenic
1115630970 14:35245008-35245030 ATTCTTTGGGAGCCCCTTCTGGG + Intronic
1117146461 14:52841035-52841057 ACTCTCCTACTTCCCCTTCTGGG - Intergenic
1117868683 14:60175447-60175469 TCTCTCTGACATCTCCTTCCAGG - Intergenic
1120425611 14:84343510-84343532 ACTTTCTGTGATCTCATTCTAGG + Intergenic
1121211233 14:92209435-92209457 ACTCTCTGAGATCCCAGCCATGG + Intergenic
1121449738 14:93999485-93999507 ACCCTCTGTGATCTCCTGCTTGG - Intergenic
1121499523 14:94423245-94423267 ACTCTGTAAGTTCACCTTCTTGG - Intergenic
1121738509 14:96235427-96235449 CCTCTCTGAGAGGCCCTCCTGGG - Intronic
1121892062 14:97603601-97603623 ACTCTCTGAGCTCCAAATCTTGG - Intergenic
1122876882 14:104671576-104671598 ACACTGTGCGATCCCCTTTTAGG + Intergenic
1123149684 14:106169087-106169109 ACCCTCTGAGACCACCCTCTAGG - Intergenic
1123196011 14:106617384-106617406 ACTCTCTAAGACCACCCTCTAGG - Intergenic
1123223385 14:106877460-106877482 ACTCTCTCAGACCACCCTCTAGG - Intergenic
1124635950 15:31365402-31365424 CCTCGCTGAGCTCCCCTTCATGG - Intronic
1127258837 15:57313126-57313148 CCTCTCTGAGATGGCTTTCTGGG - Intergenic
1128584914 15:68839992-68840014 ACTCTCTGACACTCCATTCTAGG - Intronic
1129102310 15:73277407-73277429 ACTTTCTGAGGCCTCCTTCTGGG + Intronic
1131443484 15:92476441-92476463 ACTCTCTGGTCTACCCTTCTGGG + Intronic
1132935856 16:2480696-2480718 ACCCTCTGTGATCCCTTTCCCGG + Intronic
1133978446 16:10617000-10617022 ACTCTCAGAGCTGCCCCTCTGGG + Intergenic
1136093869 16:27939737-27939759 ATTCTCTGACATCCCTTCCTCGG - Intronic
1136680375 16:31957707-31957729 ACCCTCTGAGACCACCCTCTAGG + Intergenic
1136780719 16:32899252-32899274 ACCCTCTGAGACCACCCTCTAGG + Intergenic
1136889693 16:33960417-33960439 ACCCTCTGAGACCACCCTCTAGG - Intergenic
1138414683 16:56864932-56864954 CCTCTCTGACAACTCCTTCTTGG + Intergenic
1138718628 16:59052931-59052953 ATTCTCTGAAGTCCCCATCTGGG - Intergenic
1140195711 16:72853609-72853631 AATCTCTGAGATCTGGTTCTTGG + Intronic
1141888459 16:86909987-86910009 AATCTCTGAGACAGCCTTCTTGG + Intergenic
1143532230 17:7512201-7512223 ATTCTCAGAGACCCCCTTCATGG - Exonic
1144615831 17:16771060-16771082 ACTATCTCAGACCCCGTTCTAGG + Intronic
1146081983 17:29788679-29788701 TCTCTATGAGATACCCTTTTTGG + Intronic
1147160942 17:38569150-38569172 ACTCTCTGGCTTCCCATTCTAGG - Intronic
1149114078 17:53070586-53070608 ATCTTCTGAGATCCCCTTCTTGG - Intergenic
1156615256 18:38775551-38775573 AGTCTCTTATATACCCTTCTAGG + Intergenic
1157032516 18:43929584-43929606 ACTTTTTGAGATCTCATTCTTGG - Intergenic
1157179676 18:45485641-45485663 ACAGTCTGAAATCCACTTCTTGG + Intronic
1161114058 19:2487183-2487205 ACTCACCGAGAACCCCCTCTGGG - Intergenic
1161527898 19:4768871-4768893 ACTCTCTCCAATCCCCTCCTGGG - Intergenic
1161944108 19:7423917-7423939 CTTCTATGAGATCCACTTCTGGG - Intronic
1165735597 19:38173634-38173656 AGTCCCTGGGATGCCCTTCTGGG + Intronic
1166202225 19:41245400-41245422 GGCCTCTGAGATCCCCTCCTCGG - Intronic
1167782062 19:51605114-51605136 ACTTTCTGAGATCCCCCTTTGGG + Intergenic
1168148897 19:54434539-54434561 AGCCTCTGAGATGACCTTCTCGG + Intronic
925182740 2:1827465-1827487 ACTCTCTGAGATCCCCTTCTAGG - Intronic
925851695 2:8088182-8088204 ACTCATTAAGATCCTCTTCTTGG - Intergenic
926146647 2:10400503-10400525 GCTCTCTGAGATGCCCGCCTGGG - Intronic
930108584 2:47658834-47658856 GTTCTCTGAGCTCCCCTTATCGG - Intergenic
933526749 2:83450631-83450653 ACAGTCTGAGATCATCTTCTAGG - Intergenic
934528556 2:95069490-95069512 ACGATCTGTGATCCCCTTCCTGG + Intergenic
935853878 2:107254468-107254490 ACTCTCTGATCTCCCCTCATCGG - Intergenic
935866043 2:107388821-107388843 AGTCTGTGATATTCCCTTCTAGG + Intergenic
935881933 2:107573742-107573764 AATCTCTAAAATCCCCTTGTAGG - Intergenic
947382869 2:229562286-229562308 ACTCCATCACATCCCCTTCTCGG + Intronic
1170083822 20:12507069-12507091 ACTCTCTGGGGTAACCTTCTTGG - Intergenic
1170098846 20:12676353-12676375 ACTGACTCAGATCCCATTCTAGG + Intergenic
1175081679 20:56425840-56425862 ACTCACTGAGGGTCCCTTCTGGG - Intronic
1176688709 21:9879107-9879129 AATCTCTGAGATTCTTTTCTTGG + Intergenic
1177741445 21:25158779-25158801 TCTCCCAGAGATTCCCTTCTGGG - Intergenic
1177864241 21:26493745-26493767 ACTCTTTGTGATACCTTTCTGGG - Intronic
1180211452 21:46297465-46297487 ACTCTCTGGGGTCGCCTCCTCGG - Intronic
1182760442 22:32718224-32718246 ATTCTCCCACATCCCCTTCTAGG + Intronic
1184606962 22:45579771-45579793 TCTGTCTGAGATCTCCTCCTTGG + Intronic
950503153 3:13377114-13377136 ATTCTCTGAGGTCCCCAGCTTGG + Intronic
952716712 3:36487127-36487149 AGTCTCTGAGAACCCCTCCCAGG - Intronic
953109689 3:39921913-39921935 GCTGTCTGACTTCCCCTTCTGGG + Intronic
953147263 3:40290314-40290336 ACTCTCTCACATCACCTGCTTGG + Intergenic
960140903 3:114151084-114151106 CCTCTCTTAAATCCCCTCCTTGG + Intronic
960991370 3:123313794-123313816 AATCTCTGAGGTCCCCTCCAGGG + Intronic
962270752 3:133976403-133976425 CCTCCCTGAGATCCCCTTCGGGG - Intronic
962282019 3:134059304-134059326 ACTCCCTGAGAAGCCCTTCAAGG + Intergenic
964373107 3:156022162-156022184 GCTCCCAGATATCCCCTTCTGGG - Intergenic
964974108 3:162599627-162599649 ACACTGTGGGATCCCCTTCCTGG + Intergenic
967318147 3:188169802-188169824 AATGTCTGAGTACCCCTTCTGGG - Intronic
969143148 4:5097574-5097596 AGCTTCTGAGCTCCCCTTCTTGG - Intronic
973316690 4:48767926-48767948 GCCCTCAGAGATCCCCTTGTGGG + Intronic
973569979 4:52228572-52228594 ACTCTCTGTCACCCCCTTTTGGG + Intergenic
975047453 4:69823416-69823438 CCTCCCAGAGATCCCCCTCTCGG - Intronic
976330645 4:83827467-83827489 ACTCTCTGAATTCCTCTTCTGGG - Intergenic
976342763 4:83963688-83963710 ACTGGCTGAGATTCCCTTCCTGG - Intergenic
980352096 4:131696917-131696939 AGTCTCTGAGATTCTTTTCTTGG + Intergenic
980748226 4:137050634-137050656 ATTCTCTGAAATGACCTTCTAGG - Intergenic
984848485 4:184130009-184130031 ACTTCCTGAGGTCCCCTTGTGGG + Intronic
985999043 5:3615811-3615833 ACTCTCAGAGATGCCCTTCCTGG - Intergenic
987041715 5:14069007-14069029 ACTGTTTGAGCTCCCATTCTGGG - Intergenic
988529810 5:32017527-32017549 TCTCTCTGCTATGCCCTTCTGGG + Intronic
989421961 5:41250668-41250690 ACTCTATGTGATCTCATTCTAGG - Intronic
993886598 5:93422409-93422431 ACTCTTTCAGATCCACTTCAAGG - Intergenic
995200286 5:109417488-109417510 ACTCACAGAGTTACCCTTCTGGG + Intergenic
998008429 5:138673552-138673574 ACTCTCTGAGGACTCATTCTGGG + Intronic
998174945 5:139895965-139895987 GGGCTCTGGGATCCCCTTCTTGG - Intronic
1005804511 6:29461949-29461971 CCTCTCTGACCTCTCCTTCTTGG + Exonic
1006861238 6:37172632-37172654 AGTCTATGAGATACCTTTCTTGG + Intronic
1006982212 6:38155597-38155619 TCTCTTGGAGACCCCCTTCTTGG - Intergenic
1007077330 6:39076127-39076149 TCTCTCTGAGACCTCCTTCCAGG - Intronic
1007077499 6:39077260-39077282 TCTCTCTGAGACCTCCTTCTAGG + Intronic
1008390481 6:50945608-50945630 TCTCTCTGATATCTTCTTCTAGG - Intergenic
1008493214 6:52107155-52107177 ACTTTCTCAGATCCCATACTTGG - Intergenic
1008879069 6:56362577-56362599 TCCCTCTGACATCTCCTTCTCGG + Intronic
1011762736 6:90586578-90586600 ACTCTCTGAGCTCAACTGCTCGG - Intronic
1015272403 6:131350600-131350622 AATCTCTGAGATCCTATTGTAGG - Intergenic
1018202444 6:161408111-161408133 ACTCTCTAACTTCCTCTTCTAGG + Intronic
1018706878 6:166469941-166469963 ACTGTCAGAGAACCCCATCTTGG - Intronic
1018926962 6:168213236-168213258 AATCTCTGAGAGCCCCTCGTGGG + Intergenic
1021188475 7:17593057-17593079 AATCTCTCAGAGCACCTTCTAGG - Intergenic
1021381473 7:19972187-19972209 AGTCTCAGAGAATCCCTTCTGGG + Intergenic
1022982484 7:35617591-35617613 AATCTATGAGAGCCCTTTCTAGG + Intergenic
1025003781 7:55339797-55339819 ACCCTCTGCCCTCCCCTTCTGGG - Intergenic
1026726288 7:72872199-72872221 ACTCTCTGAGATTCTATACTGGG + Intergenic
1028027719 7:85867120-85867142 ACTATGTGAGATCCCCCTGTAGG + Intergenic
1028106781 7:86888038-86888060 AATTTCCTAGATCCCCTTCTGGG - Intronic
1030584880 7:111405643-111405665 ATTCTCTGAGTTTCCCTCCTAGG + Intronic
1030881242 7:114882559-114882581 ACTGTCTGAGATCCCAGGCTTGG + Intergenic
1036652401 8:10653851-10653873 ACTGTCTGAGATGCATTTCTGGG + Intronic
1038334916 8:26638275-26638297 CCTCTCTGAGACTCCCTTCTGGG - Intronic
1038409638 8:27348203-27348225 CCACTCTGAGATACTCTTCTTGG + Intronic
1039333117 8:36560822-36560844 ACACTCTGATCTCCTCTTCTGGG - Intergenic
1040372809 8:46794269-46794291 ACACCCTGAGATCACATTCTAGG + Intergenic
1041776908 8:61533293-61533315 AATTTCTGAGAGCCCTTTCTGGG + Intronic
1041815035 8:61961211-61961233 ACTCCCTGAGTTCTCCTTCTTGG + Intergenic
1041866522 8:62581206-62581228 ACTCCATGAAACCCCCTTCTAGG - Intronic
1047546258 8:125820212-125820234 ACTCCCTGAGATGTCATTCTTGG + Intergenic
1047994395 8:130319651-130319673 ACTTACTGAGATCCCTTCCTGGG + Intronic
1048169096 8:132088108-132088130 AGTCTCTGAGGTCAGCTTCTAGG + Intronic
1048276278 8:133068326-133068348 AGTGTATGAGATCCCCTCCTGGG - Intronic
1050313284 9:4374560-4374582 TCTCTCTCACATCCCTTTCTTGG + Intergenic
1050519919 9:6486637-6486659 ACTCTGTGAGACTCACTTCTTGG + Intronic
1050519923 9:6486705-6486727 ACTCTGTGAGACTCACTTCTTGG + Intronic
1050626725 9:7511812-7511834 AGTATCTGAGATGCCTTTCTGGG - Intergenic
1050626851 9:7513297-7513319 GCTCTCTGATATCCAGTTCTTGG + Intergenic
1053780620 9:41602801-41602823 AATCTCTGAGATTCTTTTCTTGG - Intergenic
1054168564 9:61812958-61812980 AATCTCTGAGATTCTTTTCTTGG - Intergenic
1054668967 9:67767860-67767882 AATCTCTGAGATTCTTTTCTTGG + Intergenic
1056000346 9:82209949-82209971 GTTCTCTCACATCCCCTTCTAGG - Intergenic
1185475864 X:414975-414997 AGTCTTTGAGCTCCTCTTCTCGG - Intergenic
1188110441 X:26192120-26192142 GCTCTGTGAGACCCCCTTTTTGG - Intergenic
1189638748 X:43043947-43043969 ACTGTCTGTGATTCCCCTCTAGG + Intergenic
1195909918 X:109878773-109878795 ACTTTCTGAGATCCAATCCTTGG - Intergenic
1196047504 X:111271574-111271596 GGTCTCTGAGATCTCCTTCTTGG + Intergenic