ID: 925182742

View in Genome Browser
Species Human (GRCh38)
Location 2:1827471-1827493
Sequence AGGGGATCTCAGAGAGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 234}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925182732_925182742 -3 Left 925182732 2:1827451-1827473 CCCGCCACCCTCTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 234
925182730_925182742 18 Left 925182730 2:1827430-1827452 CCTGGCAATGTGGTCCTCATTCC 0: 1
1: 0
2: 0
3: 9
4: 121
Right 925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 234
925182731_925182742 4 Left 925182731 2:1827444-1827466 CCTCATTCCCGCCACCCTCTGCC 0: 1
1: 0
2: 6
3: 72
4: 748
Right 925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 234
925182738_925182742 -10 Left 925182738 2:1827458-1827480 CCCTCTGCCTAGAAGGGGATCTC 0: 1
1: 0
2: 1
3: 14
4: 210
Right 925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 234
925182726_925182742 30 Left 925182726 2:1827418-1827440 CCTGGAGGAGCCCCTGGCAATGT 0: 1
1: 0
2: 1
3: 16
4: 189
Right 925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 234
925182737_925182742 -7 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 234
925182728_925182742 20 Left 925182728 2:1827428-1827450 CCCCTGGCAATGTGGTCCTCATT 0: 1
1: 0
2: 2
3: 13
4: 147
Right 925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 234
925182734_925182742 -4 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 234
925182729_925182742 19 Left 925182729 2:1827429-1827451 CCCTGGCAATGTGGTCCTCATTC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925182742 Original CRISPR AGGGGATCTCAGAGAGTTGA GGG Intronic
901118020 1:6864608-6864630 AAGGGAGCTGAGAGTGTTGAAGG - Intronic
902241012 1:15089327-15089349 TGGGGCTCTCAGTGAGGTGAGGG - Intronic
902740964 1:18437729-18437751 TGGGGATTTCAGGGAGATGATGG - Intergenic
903557160 1:24202420-24202442 AAGGGATTTTACAGAGTTGAGGG - Intergenic
903950024 1:26991348-26991370 ATGGGAACTCAGAGAGTTGGAGG - Intergenic
904775682 1:32904775-32904797 AGGATATCACAGTGAGTTGATGG - Intergenic
904796309 1:33058773-33058795 AGGGGACTGCAGGGAGTTGAGGG - Intronic
904853631 1:33478635-33478657 AGGGGATAGCATAGAGTTGTTGG + Intronic
906016129 1:42581881-42581903 AGGGGACTTCAGAGAGTTTGTGG + Intronic
906483541 1:46217301-46217323 AGGGAAATTCAGAGAATTGAGGG + Intronic
906967272 1:50470434-50470456 AAAGGATCTCAGAGATATGAAGG - Intronic
907808473 1:57844707-57844729 AGGGAAGCTCAGAGAGGTCAAGG + Intronic
913125403 1:115782849-115782871 AGGGGATTTCAGAGACTGGGTGG - Intergenic
915930938 1:160060680-160060702 TTGGGATCCCAGAGACTTGAGGG - Intronic
916250263 1:162730999-162731021 GGAGAATCTCAGAGAGGTGAGGG - Intronic
917180513 1:172291600-172291622 AGGGTATATTAGAGATTTGAGGG + Intronic
918025744 1:180744125-180744147 GGAGGATCTCAGTGACTTGAGGG - Intronic
919447382 1:197725705-197725727 AGGTGAGGTCAGAGAGTTAAGGG + Intronic
920372298 1:205486792-205486814 AAGGGAGGACAGAGAGTTGAGGG - Intergenic
923461597 1:234214065-234214087 AGGGCTTCTCAGAGAGGTGGTGG + Intronic
923685905 1:236153776-236153798 AGGGGGACTCACAGAGATGAAGG - Intronic
1063449036 10:6139170-6139192 AGGAGATCTCAGAGGGTTAGAGG - Intergenic
1066397585 10:35041242-35041264 AGTGGGTCTGAGAGAGGTGAAGG + Intronic
1067972384 10:50987521-50987543 AGTGGATCTCAGAGAAGTTAAGG + Intergenic
1068455705 10:57251026-57251048 AGGGGCTCCCAGAGAGATCATGG + Intergenic
1069210260 10:65749132-65749154 AGGAGTTGTCAGAGAGGTGAAGG + Intergenic
1069522766 10:69138033-69138055 AGGGGTTGTCAGAGACTGGAAGG - Intronic
1069956750 10:72056800-72056822 TGGAGAGCTCAGAGAGGTGAGGG - Intergenic
1071619449 10:87105840-87105862 CTGGGGTCTAAGAGAGTTGAAGG - Intronic
1072285507 10:93910587-93910609 TGGGGATCTCACAGACTTGATGG - Intronic
1074692944 10:116023476-116023498 TGAGAATCTCAAAGAGTTGAGGG - Intergenic
1074864712 10:117537934-117537956 TGGGGATCTCAGTGGGTTGGAGG + Intergenic
1077294023 11:1815648-1815670 AGGAGATCTCAGAGTCATGAGGG + Intergenic
1077571756 11:3345561-3345583 AGGGCATCTTATAGAGATGAGGG - Intronic
1078145219 11:8717803-8717825 AGGAGTTCTCAGACAGTTGCTGG + Exonic
1079562476 11:21839579-21839601 AGGGGATCCCAAAGGGCTGAGGG + Intergenic
1079775764 11:24524595-24524617 AAGGGATCTAAAAGAGTTAATGG - Intronic
1080844756 11:36016915-36016937 AGGGGACCTCAGAAAGTTTGTGG + Intronic
1084440106 11:69167930-69167952 CGGGAATCTGAGAGAGTTGCCGG + Intergenic
1084962877 11:72726560-72726582 AGAGGATCCCAGAGGGTAGATGG - Intronic
1086864843 11:91968284-91968306 AGGGGACCTCAAAAAGTTCATGG - Intergenic
1087208065 11:95417880-95417902 AGGGGAGCTCAAAGTGTAGAGGG - Intergenic
1087622800 11:100561809-100561831 GGGGTATCTCATAGAATTGAGGG + Intergenic
1089201045 11:116724920-116724942 AGGGCATCTCAGAGGCATGAAGG - Intergenic
1092522961 12:9292371-9292393 AGGGGATCTCAGAGTATCCAGGG - Intergenic
1092544330 12:9439526-9439548 AGGGGATCTCAGAGTATCCAGGG + Intergenic
1092902440 12:13072392-13072414 AGGGGACTTCAGAAAGTTCATGG + Intronic
1092937017 12:13373705-13373727 AGTGGATCTCAGACATTTGAAGG + Intronic
1092946473 12:13458656-13458678 AGGGGATATCTAAGAGCTGATGG - Intergenic
1094508617 12:31082541-31082563 AGGGGATCTCAGAGTATCCAGGG - Intronic
1095578378 12:43765682-43765704 AGGGGTTTTCAAAGAGTTCATGG - Intronic
1096674869 12:53221049-53221071 GGGGGTTCCCAGAGAGTTCACGG - Intronic
1096797143 12:54085061-54085083 AGGGGTCCCCAGAGAGTTGAGGG - Intergenic
1099005870 12:77234044-77234066 TGGGGATCTCAGAAAAGTGAAGG + Intergenic
1100157217 12:91814379-91814401 AGGTGATCTCACAGACTTGAGGG + Intergenic
1100433058 12:94547440-94547462 AGTGGAACTCAGAGAGTTGGGGG - Intergenic
1101270383 12:103137397-103137419 AGGGGAACTCAGAGTGTTGATGG + Intergenic
1101821292 12:108186063-108186085 AGGGGATTGGAGAGAGATGAAGG - Intronic
1105274868 13:18911277-18911299 AGGGCCTATCAGAGAGTGGAGGG - Intergenic
1107619633 13:42212987-42213009 AGGAAATCTCAGAGAGTTTGGGG + Intronic
1108088380 13:46819165-46819187 AGAAGAGCTCAGAGAGATGAGGG + Intergenic
1110565348 13:76952178-76952200 AGGGAAGCACAGAGAGTTGTGGG - Intronic
1111149419 13:84229631-84229653 AGATGATCTCAGAGAGCTCAAGG - Intergenic
1112013386 13:95310897-95310919 AGGGGATTTCAAAAAGTTCATGG - Intergenic
1116941189 14:50792619-50792641 AGGGGAGCTGAGGGGGTTGATGG - Intronic
1118426830 14:65674268-65674290 AGGGGATCTGAGGGAGAGGAAGG + Intronic
1120297853 14:82666924-82666946 AGGAGATCTCAGATTGTTTAAGG + Intergenic
1120779743 14:88476377-88476399 AGAGGACCCCAGAGAGTTGTTGG - Intronic
1122217720 14:100214766-100214788 CTGGGATCACAGGGAGTTGATGG + Intergenic
1123896916 15:24838844-24838866 ATGGGATCTCACAGTGTTGGGGG - Intronic
1124095019 15:26641366-26641388 AAGGCATCCCAGAGAGGTGAGGG - Intronic
1126010224 15:44295446-44295468 AGGGAATCTCAGAGAAGTGGGGG - Intronic
1129900192 15:79141901-79141923 TGGAGTTCTCAGAGAGCTGATGG - Intergenic
1131798107 15:96041288-96041310 TGGGCCTCTCAGAGAGTGGAGGG + Intergenic
1133094717 16:3435349-3435371 AGGGGAGCTGAGATAGGTGAGGG - Exonic
1134634448 16:15781616-15781638 AGGGGAACTCTGAAAGTGGATGG - Intronic
1135045123 16:19149110-19149132 GCGGGATCTGAGAGAGTTGGGGG + Intronic
1135535926 16:23294470-23294492 AGGGGGGTTCAGAGAGGTGATGG - Intronic
1135789315 16:25379065-25379087 AGGGAAGCTCAGAGAACTGAAGG - Intergenic
1136366092 16:29809835-29809857 AGGGGATCTCAGGAAGGCGAGGG + Intronic
1139479336 16:67220502-67220524 AGGAGCTCTCAGAGAGAGGAGGG - Intronic
1140017433 16:71201093-71201115 AGGGGATGTCAGAGAGGTCAAGG - Intronic
1141031102 16:80589498-80589520 AGGACATCTCAGAAAGGTGAAGG + Intergenic
1143762709 17:9116514-9116536 AGGGGAAATCAGAGAGATGTGGG - Intronic
1146541950 17:33703750-33703772 AGGGGAGCTTACAGAATTGAGGG - Intronic
1146680861 17:34807112-34807134 AGGGTCACACAGAGAGTTGATGG + Intergenic
1146716991 17:35094749-35094771 ATGGGATCTCAGTGAGGTTAAGG - Intronic
1149486054 17:57043817-57043839 AGGCGACCACAGAAAGTTGAAGG + Intergenic
1149701677 17:58660492-58660514 AGGGGAGCTCAGGGAGGGGAAGG + Intronic
1151401305 17:73857716-73857738 AGGGGTCCTGATAGAGTTGAGGG + Intergenic
1153259498 18:3209560-3209582 AGAGGATGTCAGAAAGGTGATGG - Intronic
1153263548 18:3246824-3246846 AGGTGAGGTCAGAGAGCTGAGGG + Intergenic
1155608315 18:27633478-27633500 ATGGGGTTTCAAAGAGTTGAGGG + Intergenic
1157069302 18:44387266-44387288 ATGGCCTCTCACAGAGTTGATGG - Intergenic
1157802138 18:50629483-50629505 AGAGGAAGTCAGAGAGTTGGAGG + Intronic
1160025662 18:75213237-75213259 AGATGCTCTCAAAGAGTTGAAGG + Intronic
1161652419 19:5493398-5493420 AGGGGTGCTCAGAGAGTGAAAGG + Intergenic
1162983028 19:14250978-14251000 AAGCGATATCAGAGAGTTAATGG - Intergenic
1163915873 19:20240009-20240031 AGGGGATCTCCCAGAGTGGATGG - Intergenic
1163935754 19:20441653-20441675 ATGGGATCTCCCAGAGTGGATGG - Intergenic
1164121151 19:22266321-22266343 TGGGGGTCTCACACAGTTGAGGG - Intergenic
1165556619 19:36638325-36638347 TGGTTATCTCAGAGATTTGAGGG + Exonic
1166116468 19:40658430-40658452 AGGGGAATTCAAAAAGTTGATGG + Intergenic
1166158491 19:40933846-40933868 AGGAGAAGTCAGAGAGGTGATGG + Intergenic
1167114676 19:47482114-47482136 AGATAATCTGAGAGAGTTGATGG - Intronic
1168311563 19:55463487-55463509 AGGGGATCCCCGAGGGTTGGGGG - Intergenic
925117151 2:1389220-1389242 AGGGCGTCTCAGAGAGCAGAGGG + Intronic
925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG + Intronic
926142744 2:10377898-10377920 AGGGCATTTCAGAGAGTGCAAGG + Intronic
927187502 2:20492284-20492306 GGGGGCCCTCAGAGAGTGGAAGG - Intergenic
936666974 2:114608142-114608164 AGGGGATCTGAGTGAGATGTTGG + Intronic
936837786 2:116728433-116728455 AGGCGACTTGAGAGAGTTGAGGG - Intergenic
940052865 2:149482565-149482587 ATGGGAGCTCAGAGAATGGAAGG - Intergenic
940405585 2:153298061-153298083 AGGTTATCTCAGAGAATTAAAGG + Intergenic
943104678 2:183529607-183529629 AAGGGACCTCAGTCAGTTGAAGG + Intergenic
943293581 2:186108145-186108167 AGGGGACTTCAGAAAGTTCACGG - Intergenic
943563689 2:189492677-189492699 AGGGTTTCTCACAGAGTTGCCGG - Intergenic
944722026 2:202433304-202433326 AGGGGACCTCAGAAAGTTCATGG + Intronic
945704627 2:213213799-213213821 AGGGGAAATCTGAGAGATGATGG - Intergenic
945958967 2:216112332-216112354 AGGGGATACCAGAGCGGTGAAGG - Intronic
946779651 2:223179892-223179914 AGGGGACCTCAAAAAGTTTATGG + Intronic
947740317 2:232481881-232481903 TGGGGCTCTCAGAGGGTGGAGGG - Intronic
1169914430 20:10672450-10672472 TGGGGATCCCAGAGGGTTTATGG - Intronic
1171848995 20:30294918-30294940 AGGGGTCCCCAGAGAGTTGAGGG - Intergenic
1172136469 20:32689921-32689943 AGGAGGTCCCAGAGAGCTGAGGG + Intergenic
1172554513 20:35829164-35829186 AGGGAATCTGAGAGAGTGCAGGG + Intronic
1172582002 20:36055692-36055714 AGAAGAGCTCAGAGAGTGGAAGG - Intergenic
1173381815 20:42551687-42551709 AGGTTTTCTCAGAGAGTTCAAGG - Intronic
1175298247 20:57924031-57924053 AGGTGATCTTAGAGAGTGGGAGG + Intergenic
1178018886 21:28386186-28386208 AGGGCATCTAAGAGTGTGGAAGG - Intergenic
1178142005 21:29694801-29694823 AGGGGATCATGCAGAGTTGATGG + Intronic
1178289918 21:31358368-31358390 AGGGGATCTCCAAGAGTTGTAGG - Intronic
1179502949 21:41821361-41821383 AGGGACTCTCAGAGGCTTGATGG + Intronic
1179841161 21:44074813-44074835 TGGGGAACTCAGGGAGGTGAAGG + Intronic
1179959623 21:44760755-44760777 AGGGGATCTCAGAGGGATTCGGG - Intergenic
1181462515 22:23094114-23094136 AGGGCCTGTCACAGAGTTGATGG + Intronic
1181621357 22:24093666-24093688 TGGGGATCTCAGAGACTAGCGGG + Intronic
1181887193 22:26030672-26030694 CTGGGATTCCAGAGAGTTGATGG + Exonic
1184659172 22:45958016-45958038 AGGAGACCTCAGGGAGTTGTAGG + Intronic
1185107988 22:48885203-48885225 AGGTGATTGCAGAGATTTGAGGG - Intergenic
952654698 3:35771173-35771195 ATGGGAAGTCAGAGTGTTGATGG + Intronic
952953878 3:38544769-38544791 AAGGGGTCTGAGAGAGTGGAGGG + Intergenic
953515472 3:43586768-43586790 AGAGGACCTCTGAGAGCTGAAGG + Intronic
955390381 3:58518337-58518359 AGGGGCTCTCACAGGGTTGATGG - Intronic
956829438 3:73031043-73031065 AGAGGTTGTCAGAGGGTTGAGGG + Intronic
957124707 3:76143808-76143830 TGGGGACCTAGGAGAGTTGATGG + Intronic
957524853 3:81367052-81367074 TGCTGATCTCGGAGAGTTGAAGG + Intergenic
958703339 3:97621254-97621276 GGGGCCTCTCAGAGAGTGGAGGG + Intronic
959147402 3:102565504-102565526 AGGGAAAATCAGAGACTTGAAGG - Intergenic
960087739 3:113608808-113608830 AAGGGATCACAGAGAAATGAAGG - Intronic
960280110 3:115771828-115771850 AGGTGACCTAAGAGAGATGAAGG + Intergenic
968222637 3:196949695-196949717 AGGGGAGCTCAGAGTGCAGAGGG + Intronic
969149638 4:5158407-5158429 AGGGGAACAAAGAGAGGTGATGG - Intronic
969175531 4:5396036-5396058 AGGAGAGCTGATAGAGTTGAGGG - Intronic
970166006 4:13239192-13239214 AGGGGAAGTCAGAGATTCGAAGG - Intergenic
970972734 4:22003561-22003583 AGTGGATCTCAGAGGTTTGGGGG + Intergenic
971525779 4:27616699-27616721 AGGTGATCTCAGATAGTTTTGGG + Intergenic
971552110 4:27970430-27970452 AGGTGAGCTCAGAGAGATCATGG - Intergenic
971684718 4:29749106-29749128 ATGGTATCTCAAAGAATTGATGG + Intergenic
977483690 4:97614073-97614095 AGGGGATTTCAAAAAGTTCATGG + Intronic
977499789 4:97824123-97824145 AGGGGAAATTTGAGAGTTGACGG + Intronic
977987610 4:103402475-103402497 AGGTGATTACAGAGAGTAGAAGG - Intergenic
978442571 4:108749490-108749512 TGGGGATCTCAGTGACCTGAAGG - Intronic
978725856 4:111968525-111968547 GAGAGTTCTCAGAGAGTTGAAGG - Intergenic
980003942 4:127519613-127519635 AGGAGATATCTGAGATTTGAGGG + Intergenic
980820538 4:138010295-138010317 AGGGGACTTCAGAAAGTTCATGG + Intergenic
980831477 4:138133922-138133944 AGTGGATTTCAGAGAAGTGAAGG - Intergenic
982053998 4:151529347-151529369 AGGGCAACTCAGAGAGTAGCAGG - Intronic
984114519 4:175663179-175663201 AGTAAATATCAGAGAGTTGATGG - Intronic
987741826 5:21918617-21918639 AGTGAGTCTCAGAGAGCTGATGG - Intronic
988925062 5:35981814-35981836 AGGGCATGCCAGAGAGTTCATGG + Intronic
990031653 5:51267768-51267790 AGGTCATCTCAGAGAGATCAAGG - Intergenic
990031767 5:51269733-51269755 AAGGGATCTCAGAGCCTTGGGGG - Intergenic
990509185 5:56474935-56474957 AGGGGATAACAGGGAGGTGAGGG + Intronic
991483201 5:67105951-67105973 GGAGGATGTCAGTGAGTTGAGGG - Intronic
991540677 5:67724382-67724404 AAGGGATCACAGACATTTGAAGG - Intergenic
993097816 5:83500752-83500774 ATGAGATATCAGAGATTTGAGGG - Intronic
993929281 5:93917979-93918001 AGAGGACATCAGAGGGTTGAGGG - Intronic
994530040 5:100957263-100957285 GGGGGATCTCACTGACTTGAAGG + Intergenic
995376824 5:111483477-111483499 AGAGGATCTCAGAGAGCAGCTGG + Intronic
997663145 5:135604662-135604684 AGGGTAACTCAGAGAGCTGGAGG + Intergenic
998215556 5:140236087-140236109 AGGGAATCTCAAATAGTTTATGG - Intronic
998390129 5:141781995-141782017 AGGGGCTCTCAGACAGTTGCTGG - Intergenic
998666070 5:144298774-144298796 AGAGGACTTCAGAGAGATGAAGG - Intronic
998813295 5:145987558-145987580 ATGGGAGGTCAGAGACTTGAGGG - Intronic
999154374 5:149447869-149447891 AGGAGAGCTCAGAGAGATGCCGG - Intergenic
1001584773 5:172826397-172826419 AGGGGAGCCCAGAGTATTGAGGG - Intergenic
1001687155 5:173602284-173602306 AGGGTATCTGAGAGACTGGAGGG + Intergenic
1003225091 6:4197068-4197090 AGGGGACTTCAGAAAGTTCATGG - Intergenic
1003268935 6:4590471-4590493 ATGGGATGTAAGAGAGATGAGGG - Intergenic
1005075516 6:21902795-21902817 AGGGGATCTGAAAGAGTGGGAGG - Intergenic
1006358315 6:33573544-33573566 AGGAGGTCCCAGAGAGCTGAGGG + Exonic
1007270811 6:40635540-40635562 AGATGATTTCAGAGAGTGGAGGG - Intergenic
1007595674 6:43049852-43049874 AGTGGAGGTCAGAGAGTGGAAGG - Intronic
1007979657 6:46138595-46138617 AGGGGAGCTGACAGATTTGAGGG - Intronic
1008343197 6:50392279-50392301 TGGGGATCTAAGACAGTAGATGG + Intergenic
1011930806 6:92709877-92709899 AGGGGACTTCAGAAAGTTCATGG - Intergenic
1012137115 6:95572287-95572309 AGGGCCTCTCAGTGTGTTGAAGG - Intergenic
1013392020 6:109695080-109695102 AGGGGATTTCAAAAAGTTCATGG + Intronic
1014906021 6:127028706-127028728 CAGGGATCTCAGAGAATTGTGGG - Intergenic
1015014259 6:128391305-128391327 AGGGGAACTGAGAGATTTGGTGG - Intronic
1018194183 6:161340347-161340369 AGGTGTTCTGTGAGAGTTGAAGG - Intergenic
1018745636 6:166759904-166759926 AGGGGATTTCTGAGTGTCGAAGG + Intronic
1018767288 6:166944517-166944539 AGGACATCTCGGAGAGCTGATGG - Intronic
1021335762 7:19399778-19399800 AGCGGAGGTCAGAGATTTGAAGG + Intergenic
1021525681 7:21584417-21584439 AGGGGATGTCAGGGAGTGGGGGG + Intronic
1022362483 7:29675409-29675431 AGGGTAACTTAGAGAATTGAAGG - Intergenic
1022428804 7:30294913-30294935 AGGGTAACTTAGAGAATTGAAGG + Intronic
1022698916 7:32738384-32738406 AGGGTAACTTAGAGAATTGAAGG + Intergenic
1023119708 7:36897080-36897102 AGGGGCTGTCACAGAGATGATGG + Intronic
1024001809 7:45194806-45194828 GGGGGATCTCAGGGAGTCCAAGG + Intergenic
1024924610 7:54599805-54599827 AGGGGCTCTCAGAAAGATGTGGG - Intergenic
1025249577 7:57342987-57343009 ATGTGAGCTCAGAGAGGTGAAGG - Intergenic
1027963454 7:84976361-84976383 AGGGCATTTCAGAGGGTGGAGGG + Intergenic
1029196718 7:98810595-98810617 AGAGGATCCCAGAGAGCTGTGGG + Intergenic
1034101391 7:148453689-148453711 AGGGCCTATCAGAGAGTGGAGGG + Intergenic
1035291643 7:157843168-157843190 AGGGGTTCTCACACATTTGAAGG - Intronic
1039850605 8:41361577-41361599 AGGGGATGGCAGAGAGTGGCCGG + Intergenic
1042103203 8:65296677-65296699 GGGGTATCTCACAGAATTGAAGG + Intergenic
1043328984 8:79089863-79089885 AGTGGGTCTCAGAGATATGAAGG - Intergenic
1043489267 8:80732166-80732188 AGGAGAGCACAGAGAGATGAAGG - Intronic
1045900449 8:107273070-107273092 TGGCCATCTCAGAGAGTTTATGG + Intronic
1046388566 8:113537244-113537266 TGGGGCTATCAGAGAGTGGAGGG - Intergenic
1046917357 8:119691887-119691909 AGGGTATGTCAGAGACATGATGG + Intergenic
1050508187 9:6368977-6368999 AAGGGAACTCAGTGACTTGAAGG + Intergenic
1053594463 9:39545849-39545871 AGGGCAGCTCAGAGAGATTATGG - Intergenic
1053786715 9:41657638-41657660 AGGAGTCCCCAGAGAGTTGAGGG - Intergenic
1053852245 9:42300882-42300904 AGGGCAGCTCAGAGAGATTATGG - Intergenic
1054158350 9:61656557-61656579 AGGGGTCCCCAGGGAGTTGAGGG + Intergenic
1054450400 9:65400859-65400881 AGGGGTCCCCAGAGAGTTGAGGG - Intergenic
1054478123 9:65587562-65587584 AGGGGTCCCCAGGGAGTTGAGGG + Intergenic
1054571795 9:66819118-66819140 AGGGCAGCTCAGAGAGATTATGG + Intergenic
1055601300 9:77921793-77921815 AGGGGATTTCAAAGAGGTGGTGG - Intronic
1055654170 9:78436954-78436976 AGGATGTCCCAGAGAGTTGATGG + Intergenic
1059432818 9:114260155-114260177 AAGGGAGCCCAGTGAGTTGAAGG - Intronic
1059552373 9:115242301-115242323 AGGGTAGCTCAAAGACTTGAAGG + Intronic
1060588960 9:124803986-124804008 AGGGGCCCTCAGGGAGTGGAGGG - Intronic
1061573631 9:131492774-131492796 AGGGGACCTGAGACAGTTGCTGG - Intronic
1061675606 9:132214012-132214034 CGGGGATTTCAGAGTGTTCACGG - Intronic
1062432602 9:136532741-136532763 AGGGGAGCTCAGAGAGGTGGTGG + Intronic
1062722587 9:138052118-138052140 AAGGACTCTCAGAGACTTGATGG - Exonic
1188114013 X:26222416-26222438 AGGGGGTCTCAGAGATGTGAGGG + Intergenic
1188245479 X:27831758-27831780 CTGGGATCACAGAGAGATGAGGG + Intergenic
1188441192 X:30216349-30216371 AGGTGGTCTCAGGGAGGTGAGGG + Intronic
1194725397 X:97389810-97389832 AGTGGATCTCGGAGAGTAGGGGG + Intronic
1194956724 X:100189655-100189677 AGGGGGTATCAGAGTGTGGAGGG + Intergenic
1195404030 X:104493039-104493061 TAGGAATCTCAGAGAGTTAATGG + Intergenic
1195574417 X:106433926-106433948 AGTGGATCCCAGAGAGGAGAAGG + Intergenic
1198654784 X:138901424-138901446 TGGGGAGCTCAGTGTGTTGAGGG + Intronic
1199634797 X:149805149-149805171 TGGGGATCACAGAGAAGTGAGGG + Intergenic
1200827213 Y:7657946-7657968 AGGGAACCTCAGTGAGTAGAAGG - Intergenic
1200951305 Y:8902345-8902367 AGGGAATCTCTGTGGGTTGATGG + Intergenic