ID: 925182745

View in Genome Browser
Species Human (GRCh38)
Location 2:1827486-1827508
Sequence GTTGAGGGGACCTCTCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 100}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925182732_925182745 12 Left 925182732 2:1827451-1827473 CCCGCCACCCTCTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG 0: 1
1: 1
2: 0
3: 9
4: 100
925182739_925182745 4 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG 0: 1
1: 1
2: 0
3: 9
4: 100
925182734_925182745 11 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG 0: 1
1: 1
2: 0
3: 9
4: 100
925182731_925182745 19 Left 925182731 2:1827444-1827466 CCTCATTCCCGCCACCCTCTGCC 0: 1
1: 0
2: 6
3: 72
4: 748
Right 925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG 0: 1
1: 1
2: 0
3: 9
4: 100
925182737_925182745 8 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG 0: 1
1: 1
2: 0
3: 9
4: 100
925182738_925182745 5 Left 925182738 2:1827458-1827480 CCCTCTGCCTAGAAGGGGATCTC 0: 1
1: 0
2: 1
3: 14
4: 210
Right 925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG 0: 1
1: 1
2: 0
3: 9
4: 100
925182740_925182745 -2 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG 0: 1
1: 1
2: 0
3: 9
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925182745 Original CRISPR GTTGAGGGGACCTCTCTGGT TGG Intronic
900456747 1:2778606-2778628 GTTGATGGGAGCTCTGTGGGGGG + Intronic
906940022 1:50247824-50247846 GATGAGGGGCCCTCTTTGGAGGG + Intergenic
908931502 1:69321540-69321562 GCAGAGGTGGCCTCTCTGGTGGG + Intergenic
911126207 1:94343379-94343401 GTTGAAGGGCCCTCTCTGCAGGG - Intergenic
912567068 1:110595346-110595368 GTTGAGGTGGCCTGTCTGGATGG - Intronic
916388086 1:164299474-164299496 GTGGAGGGCACCTCTCAGGGAGG + Intergenic
917370591 1:174289750-174289772 GTTGGGTGGAGCTCTCTTGTTGG + Intronic
918869345 1:189948615-189948637 GCTGATGGGACCTCTCTGCAGGG + Intergenic
921829372 1:219710305-219710327 GCTGAAGGGAGCTGTCTGGTGGG - Intronic
922720243 1:227896567-227896589 GGTGAGGGGACCTCTGAGATGGG + Intergenic
1062925139 10:1310678-1310700 CTGGAGGGGATCTCTGTGGTTGG + Intronic
1066260798 10:33727946-33727968 GTGGAGGAGAACTCACTGGTGGG + Intergenic
1067077411 10:43196148-43196170 GATGAGGAGGCCTCACTGGTTGG - Exonic
1068958568 10:62844078-62844100 CTGGAGGTCACCTCTCTGGTAGG - Intronic
1072662799 10:97372996-97373018 GAGGAGGGGAGCTCTCAGGTGGG - Intronic
1073086782 10:100896157-100896179 GCTGAGGGGACTTCTCTGAGTGG - Intergenic
1073134128 10:101210481-101210503 GTGGAGGGGGCATCTCTGGGAGG + Intergenic
1076754916 10:132564363-132564385 GTTGTGAGCACGTCTCTGGTGGG + Intronic
1077114456 11:877045-877067 GATGAGGGGACTTCTCAGCTGGG + Intronic
1080704978 11:34682025-34682047 GTTGAGAGGGACTCTCAGGTAGG + Intergenic
1081736507 11:45408228-45408250 GTTGAGGAGAGCACTCTAGTTGG - Intergenic
1083463044 11:62827534-62827556 GTTGAGAGAAGCTTTCTGGTGGG - Intronic
1084352192 11:68610291-68610313 GGTGAGGAGACCCCTCTGTTCGG - Intronic
1087539103 11:99492087-99492109 GTTGAGGGGAGCCATCTGTTGGG + Intronic
1089009794 11:115123080-115123102 GGTGAGGGCACCTTTCTGGTGGG + Intergenic
1089637290 11:119823362-119823384 GGTGAGGGGAGCTCTCTGGGAGG + Intergenic
1092656483 12:10690114-10690136 GTTGAGGGGACCACTTCTGTGGG + Intergenic
1095914353 12:47461120-47461142 GTTGAGGAGACTTTTCTGGGAGG + Intergenic
1096054600 12:48640993-48641015 CTTGAGGGGACCTCTAAGGTTGG - Intergenic
1104564154 12:129865158-129865180 GTGGAGGCGACCTCTCTCATTGG + Intronic
1112296038 13:98188130-98188152 GTTGAGTGGACTTTCCTGGTGGG + Intronic
1113627499 13:111857647-111857669 GATGGGGGGACGTCTCTGGTGGG + Intergenic
1125037054 15:35137143-35137165 GTTGTGGGGACCCCACTGATAGG - Intergenic
1126686262 15:51251293-51251315 GTTCAGGGGGCCTCTCTGGCTGG - Intronic
1127385065 15:58460443-58460465 GTTGAAGGCTACTCTCTGGTTGG - Intronic
1130984348 15:88834878-88834900 GTTGAGAGCACTGCTCTGGTGGG + Intronic
1133930994 16:10231986-10232008 GTTGTGGGGACCTGTCAAGTTGG - Intergenic
1135384127 16:22021209-22021231 GTTGAGGGGACCTCTATGGTTGG + Intronic
1144214315 17:13041723-13041745 GTTTAGGGGAGTTCTCTGGTTGG + Intergenic
1145720654 17:27068820-27068842 GTGGTGGGGACCTATCTGGATGG + Intergenic
1146077000 17:29740139-29740161 GGAGAGTGGACCTCTGTGGTTGG - Intronic
1146480343 17:33200101-33200123 GCTGAGGGGTCCTCTCTAGAAGG + Intronic
1146812204 17:35913003-35913025 GTTGAGGTCTCCTCTGTGGTTGG + Intergenic
1147921964 17:43923148-43923170 GTTGAGGTCTCCTCTGTGGTTGG + Intergenic
1148173919 17:45548099-45548121 GTTGAGGTCTCCTCTGTGGTTGG + Intergenic
1149514735 17:57272027-57272049 AATGAGGTGACCGCTCTGGTGGG + Intronic
1150129164 17:62657650-62657672 CTGGAGGGGCCCTCTCTGGATGG + Intronic
1155152439 18:23134115-23134137 GTTGGCGGCACCTCTCTGGACGG + Intergenic
1157524817 18:48372811-48372833 GTAGACGGGACCTCTCAGGTGGG - Intronic
1158254195 18:55527154-55527176 AGTGAGGGGACCTTTGTGGTGGG - Intronic
1159395138 18:67846588-67846610 GCAGAGGGGGCCTCTCTGCTGGG - Intergenic
1159493849 18:69174596-69174618 CTTGAGGGGCCGTGTCTGGTCGG - Intergenic
1161495726 19:4584704-4584726 GTTGGGGGGTCCTCGCTGCTAGG + Intergenic
1162927018 19:13935889-13935911 GTGGAGGGGACAGCTCTGCTGGG - Intronic
1166935391 19:46329426-46329448 GCTGAGGGGTCCCCTCTGGAAGG - Exonic
925182745 2:1827486-1827508 GTTGAGGGGACCTCTCTGGTTGG + Intronic
927391888 2:22605366-22605388 GCTGATGGGACCTCTCAGGGAGG - Intergenic
931263471 2:60639808-60639830 TTTGAGAGGATCTCTCTGGGAGG + Intergenic
932852214 2:75198789-75198811 ATTGTGGTGACCTCTGTGGTGGG - Exonic
935759199 2:106303005-106303027 GAAGAGGGGAGCTCTCTCGTTGG - Intergenic
937037998 2:118797723-118797745 ACTGAAGGGGCCTCTCTGGTGGG - Intergenic
939177952 2:138772025-138772047 GGTGAGGGAACCTGTCTAGTAGG - Intronic
941157791 2:162000370-162000392 GTTGATGGGAGCTCTCTCCTTGG - Intronic
944861943 2:203823498-203823520 GCTGAGGGGTGCTCTCTGGAGGG - Intergenic
946280587 2:218663076-218663098 GTCGAGGGGCCATCTCTGTTGGG + Intronic
947925528 2:233918833-233918855 GTGGAGGAGATCTCTCTGGATGG + Intronic
1170561305 20:17560823-17560845 GTTGTGGCAAGCTCTCTGGTTGG - Intronic
1170600123 20:17835642-17835664 GTTGAGGGGGCCTGGCTGGAGGG + Intergenic
1175247563 20:57591009-57591031 GTGGAGGGGACATCACTGGGAGG + Intergenic
1175532791 20:59685462-59685484 GTTGAAAGGACCCGTCTGGTAGG + Intronic
1177571482 21:22892651-22892673 GTTAAGGTGACTTCTCTGTTAGG + Intergenic
1178682968 21:34688710-34688732 GCTGAGCGGACCTCAGTGGTGGG + Intronic
1179954202 21:44728991-44729013 TTTGAGGGGAGCTGTCAGGTGGG + Intergenic
1181440825 22:22934536-22934558 GTGGAGGGGACCTGTATGGAGGG + Intergenic
1181440930 22:22934855-22934877 GTGGAGGGGACCTGTGTGGAGGG + Intergenic
1184113436 22:42408750-42408772 GGGGAGGGAACCTCTCTGCTGGG - Intronic
951134198 3:19084103-19084125 GCTGATGGCTCCTCTCTGGTGGG - Intergenic
954212855 3:49108261-49108283 GGTGTGGAGACCTCTCAGGTTGG - Intronic
954421451 3:50421096-50421118 GTTGAGGGGCCCTGTGTGCTGGG + Intronic
954745988 3:52787856-52787878 GTTGAGTGGACATCCCTGCTTGG + Intronic
955780701 3:62481380-62481402 GTGGAGGAAACCTCTTTGGTGGG - Intronic
968812467 4:2806187-2806209 ATAGAGCGGCCCTCTCTGGTGGG + Intronic
968935176 4:3605985-3606007 TCTGAGGAGACCTCTCTGCTGGG - Intergenic
969513218 4:7631559-7631581 GGTGAGGGGCCCTCTCTGCTCGG + Intronic
969884775 4:10205692-10205714 GATGAGAGGACCTTTCTGTTAGG + Intergenic
974081587 4:57219349-57219371 GTTTAGGTGAGCTCCCTGGTTGG - Intergenic
975132345 4:70842057-70842079 GATGTGGGGACCTCTCTTGGGGG - Intergenic
976160508 4:82193303-82193325 GTTGAGGGCTCCTCCCTGGAGGG + Intergenic
979421189 4:120507245-120507267 TTTGAGGGGACTTCACTGTTTGG - Intergenic
985145241 4:186889377-186889399 GCTAAGGGGACCTCTCCGTTTGG + Intergenic
992864250 5:80941526-80941548 GTTTAGAAGACATCTCTGGTAGG + Intergenic
999330634 5:150671657-150671679 GTGGAGGGGAGCTCCCTGGAAGG + Intronic
1001288331 5:170439401-170439423 GTCGAGGGGACCTGCCTGGAAGG - Intronic
1005092564 6:22073082-22073104 TTTGAGGAGGCCTCTCTGGCAGG + Intergenic
1010736007 6:79444271-79444293 GATGAGGGGACATCTTGGGTGGG + Intergenic
1013958396 6:115867824-115867846 GTAGGATGGACCTCTCTGGTGGG - Intergenic
1015190960 6:130471649-130471671 GTTCAGAGGAACTCTCTGATGGG + Intergenic
1015333936 6:132013490-132013512 CTTGAGAGGACCTCTTTGGAGGG - Intergenic
1017029449 6:150207903-150207925 GTCGAGGGGTCATATCTGGTTGG + Intronic
1018096374 6:160390505-160390527 GTTGTCGGGTCCTCTCTGCTTGG + Intronic
1022665399 7:32405749-32405771 GTTAAGGGAACCTCTCTTGGGGG - Intergenic
1026490481 7:70859010-70859032 GTTCAGGGGAGCACCCTGGTAGG + Intergenic
1028639407 7:93026475-93026497 GTTGAGGTGATCTTTCTGGAGGG + Intergenic
1029339289 7:99929876-99929898 GTGGAGAGGAACTCTCAGGTTGG + Intergenic
1054455010 9:65425991-65426013 TCTGAGGAGACCTCTCTGCTGGG + Intergenic
1055288807 9:74760994-74761016 GTGGAGGGAACATATCTGGTAGG - Intronic
1057488502 9:95505590-95505612 GTTGAAGGGACCTCTCAGAGGGG - Intronic
1060412733 9:123410780-123410802 GTTGTGGGGTACTCTTTGGTTGG + Intronic
1185857557 X:3550108-3550130 TTTGAGGGGACTTCTCTGTTGGG + Intergenic
1190506708 X:51133703-51133725 GTTGAGGGGAATACTGTGGTAGG + Intergenic
1191036501 X:56030721-56030743 GATTAGGGGGCCTCTCTGCTTGG + Intergenic