ID: 925182747

View in Genome Browser
Species Human (GRCh38)
Location 2:1827493-1827515
Sequence GGACCTCTCTGGTTGGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925182734_925182747 18 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 162
925182739_925182747 11 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 162
925182737_925182747 15 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 162
925182740_925182747 5 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 162
925182732_925182747 19 Left 925182732 2:1827451-1827473 CCCGCCACCCTCTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 162
925182738_925182747 12 Left 925182738 2:1827458-1827480 CCCTCTGCCTAGAAGGGGATCTC 0: 1
1: 0
2: 1
3: 14
4: 210
Right 925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 162
925182731_925182747 26 Left 925182731 2:1827444-1827466 CCTCATTCCCGCCACCCTCTGCC 0: 1
1: 0
2: 6
3: 72
4: 748
Right 925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925182747 Original CRISPR GGACCTCTCTGGTTGGGAAA AGG Intronic
904000293 1:27335120-27335142 ACACCTCGCTGGTTGGGAACAGG - Intronic
904990759 1:34590740-34590762 GGTGCTCTCTGGGAGGGAAAGGG - Intergenic
906076940 1:43058791-43058813 ATACCGCTCTGGCTGGGAAAGGG + Intergenic
906265077 1:44422474-44422496 GCATCTCTGTGGTTAGGAAAGGG - Intronic
906533606 1:46538915-46538937 AGCCCTGGCTGGTTGGGAAAGGG - Intergenic
906719531 1:47995612-47995634 GGATTTTTCTGGTTGGAAAATGG - Intronic
911391244 1:97246616-97246638 TAGCCTCTCAGGTTGGGAAATGG + Intronic
911509689 1:98795979-98796001 GGACCATTATGGTTGGAAAAGGG + Intergenic
911912174 1:103650729-103650751 GGAACTCTAAGGTTGGTAAACGG + Intergenic
911916280 1:103701219-103701241 GGAACTCTAAGGTTGGTAAACGG - Intronic
911919589 1:103744867-103744889 GGAACTCTAAGGTTGGTAAACGG + Intronic
912345212 1:108957368-108957390 GGAATTCCCTGGTTGGGAGAGGG - Intronic
912410905 1:109480124-109480146 GGACCTCTCTGGTTCACACATGG - Exonic
913076993 1:115348683-115348705 GGCCCACCCTGGTTTGGAAAGGG + Intergenic
914880850 1:151545642-151545664 GGAACTCTCTGGTTTGGGCAAGG + Intronic
915297219 1:154929786-154929808 GGACCCCTCTGCTTGGAAAGGGG - Intronic
918508973 1:185289427-185289449 GGACCTCTCTTAGTAGGAAATGG + Intronic
923354227 1:233137979-233138001 GGGCTTCTCTGGTTTAGAAAAGG + Intronic
1062925143 10:1310685-1310707 GGATCTCTGTGGTTGGGACGGGG + Intronic
1064105605 10:12498474-12498496 GGAACTCTCTGGCTGAGATATGG + Intronic
1067048144 10:42997432-42997454 GGTCCTGTCTTGCTGGGAAAGGG + Intergenic
1067326621 10:45274645-45274667 ACATGTCTCTGGTTGGGAAAGGG + Intergenic
1069977872 10:72230063-72230085 GGAACTCTCAGGTTGGGAGGAGG + Intronic
1071542574 10:86500589-86500611 GGAACTCCCAGTTTGGGAAAAGG - Exonic
1075275166 10:121086470-121086492 GGAGCGCTCTTGGTGGGAAAAGG + Intergenic
1078610411 11:12814471-12814493 GGACCTCTGTTGCTGGGCAAGGG + Intronic
1078741858 11:14073972-14073994 GGACCTCTGTGGAGGGGAAGGGG - Intronic
1080452758 11:32392283-32392305 GGACCTCTGTGGTTAAGGAATGG - Intronic
1081626978 11:44661954-44661976 GCACATCTGTGGGTGGGAAAGGG + Intergenic
1083151318 11:60793562-60793584 TGACCTTTCTGGTGGGGAAGGGG + Intronic
1083571649 11:63764648-63764670 GGACCCCTCTGAGTGGGCAAGGG - Intronic
1083789830 11:64977258-64977280 GGATCTCTGTGGTTGGGGAGGGG - Intergenic
1085319560 11:75565569-75565591 GGACCTTTCAGCTTGGAAAAGGG + Intronic
1085389995 11:76177433-76177455 GCCCCTCTCTGGTAGGGAGAGGG + Intergenic
1087113089 11:94493328-94493350 GGACCTGGCTAGTTTGGAAAAGG + Intronic
1089921296 11:122212035-122212057 GTATCTCTCTGTTTGGAAAAAGG - Intergenic
1090425897 11:126606879-126606901 GGAGGACTCTGGATGGGAAAGGG + Intronic
1091695637 12:2626329-2626351 GGACCTCTCTGTTTGGGGTTTGG + Intronic
1092285184 12:7124550-7124572 GGACCTATCTGGTTTGGACAAGG + Intronic
1093567668 12:20627572-20627594 AGGCCTCTCTGGCTGGGAAAGGG - Intronic
1096120945 12:49089205-49089227 GGTCCTCTCTGGATGGGAGACGG + Intergenic
1105239296 13:18595979-18596001 TGCCCTCTCTGGTGGGGAGAAGG - Intergenic
1108500272 13:51064011-51064033 TGACATCTCTGTTTGGGGAAGGG - Intergenic
1110360561 13:74620404-74620426 GGAACACTCCGGTGGGGAAAGGG + Intergenic
1110524870 13:76524609-76524631 GGAGCTCTTTTGTTGGCAAAGGG - Intergenic
1111768552 13:92566773-92566795 TGGCCTCTCTGATTGGGAATTGG - Intronic
1114064665 14:19051054-19051076 TGCCCTCTCTGGTGGGGAGAAGG - Intergenic
1114097596 14:19348948-19348970 TGCCCTCTCTGGTGGGGAGAAGG + Intergenic
1114808211 14:25862772-25862794 GGGCTTCCCTGGTTGGGCAAGGG + Intergenic
1119991395 14:79202007-79202029 GGACCTCTCTGGTGCAGTAATGG - Intronic
1120825173 14:88948636-88948658 GGACCTCTGTGGATAGGACACGG - Intergenic
1121013503 14:90535081-90535103 GGACCTCCCTCGGTGGGGAAAGG - Exonic
1123998211 15:25733574-25733596 TGACCTGTCTGGCTGGGAGAGGG + Intronic
1124236040 15:27990115-27990137 GGGCCTCTCTGGCAGGGACATGG - Intronic
1127832135 15:62760163-62760185 GGGCCTGTCTGGTGGGGGAAGGG + Intronic
1129113647 15:73352834-73352856 GGGTCTGTCTGGTTGGGGAATGG - Intronic
1131007767 15:88992442-88992464 GCAGCTCTCCGCTTGGGAAAAGG + Intergenic
1132093330 15:98963399-98963421 AGAACCCTCTGGTTGGGAAGGGG + Exonic
1132283604 15:100642721-100642743 GGGCCTCTCTGCTTTGAAAATGG + Intronic
1136342684 16:29655221-29655243 AGACTTCTCTGGTTGAGACAAGG - Intergenic
1140679120 16:77366963-77366985 GGACATCGCTGGTCTGGAAACGG + Intronic
1140772433 16:78217133-78217155 GGACATCTTTGGTTGGGAAATGG + Intronic
1147044798 17:37744425-37744447 GGACTTCTCTGGTGGGAAACGGG + Intronic
1147499767 17:40951542-40951564 GGAACTCTGTGGTTGCAAAATGG - Intergenic
1153006085 18:500073-500095 GGACCGCTCGGGCCGGGAAACGG + Intronic
1154449497 18:14462658-14462680 TGCCCTCTCTGGTGGGGAGAAGG + Intergenic
1158186196 18:54774657-54774679 TGACCTCTCTGGATTGTAAAGGG - Intronic
1159242676 18:65762949-65762971 GGACCTCCCTGATTGGAAATAGG - Exonic
1160187559 18:76687411-76687433 GGCCCTCACTGGGTGGGAGAGGG - Intergenic
1161347968 19:3777492-3777514 GGACCCCATGGGTTGGGAAAGGG + Intergenic
1164707023 19:30327334-30327356 GGACCTCTCTGGATGGGGCAGGG - Intronic
1165520560 19:36311084-36311106 GGGCCCCTCTGGATGGGAATTGG - Intergenic
1165623511 19:37267500-37267522 GGGCCCCTCTGGATGGGAATTGG + Intergenic
1166100618 19:40569582-40569604 GGACCTGTCTGGCTGGGCAGAGG - Intronic
1166152298 19:40882943-40882965 GCCCATCTCTGGTTGGGAAAGGG + Intronic
1166171183 19:41028455-41028477 GACCATCTCTGGTTGGCAAAGGG + Intergenic
1166177869 19:41087718-41087740 GCCCATCTCTGGCTGGGAAAGGG - Intergenic
1166366687 19:42281535-42281557 GGGCCTCCCTAGTTGGAAAAAGG - Intronic
1167012830 19:46820234-46820256 GGACCTTTCTGTTGGGGACAAGG + Intergenic
1168568805 19:57446948-57446970 GGACCCCTCTGGTTGAGTCAGGG + Intronic
925182747 2:1827493-1827515 GGACCTCTCTGGTTGGGAAAAGG + Intronic
927503885 2:23600735-23600757 GGACCCATCAGGTTGGGAGAGGG + Intronic
928383878 2:30847292-30847314 AGACTCCTCTGGTTGAGAAAAGG + Intergenic
929349879 2:40937714-40937736 GCACCCCACTGGTTGGGGAAAGG + Intergenic
929820438 2:45269180-45269202 GGAACTTCCTGGGTGGGAAAGGG + Intergenic
929928567 2:46234681-46234703 TGCCCTGTGTGGTTGGGAAAAGG + Intergenic
932206124 2:69884579-69884601 TGACATCTGTGGTGGGGAAAGGG - Intergenic
932368348 2:71167261-71167283 AGAACTCTCTGGCTGGGAGAGGG - Intergenic
934798085 2:97120008-97120030 CTACCTCTGTGGTTGGGAAGTGG + Intronic
934835338 2:97583430-97583452 CTACCTCTGTGGTTGGGAAGTGG - Intronic
936508730 2:113128841-113128863 GGGCCTCTCTGGTTGAGAGCAGG - Intronic
937215832 2:120313037-120313059 GGACTGCTCCGGTTGGGAGATGG + Intergenic
938209673 2:129457412-129457434 GGTCCTCTCTGGGTGAGAACAGG - Intergenic
938481944 2:131670086-131670108 TGCCCTCTCTGGTGGGGAGAAGG - Intergenic
944879227 2:203994485-203994507 GAACTTCTCAGGGTGGGAAAAGG + Intergenic
946418835 2:219553681-219553703 GGACCTCTGGGGGTGGGAGAGGG + Exonic
1168936732 20:1672015-1672037 TGCCCTCTCTTGTTGGGAATAGG - Intergenic
1172061936 20:32192471-32192493 GAACCTGTCTGATTGGGAAACGG - Intergenic
1172119544 20:32589663-32589685 TGACCTCTCAGGTTGGGTCAGGG + Intronic
1172778333 20:37421131-37421153 AGGCCTCTCTTCTTGGGAAACGG - Intergenic
1173058890 20:39642984-39643006 GAACCTATTTGGTTGGGATAGGG - Intergenic
1175200425 20:57273185-57273207 GGGGCTCTCTAGTTGGGACACGG - Intergenic
1175986780 20:62768030-62768052 GGAGGCCTGTGGTTGGGAAAGGG - Intergenic
1179148514 21:38789980-38790002 GGACATCTCTGGGAGTGAAAAGG + Intergenic
1180483153 22:15773676-15773698 TGCCCTCTCTGGTGGGGAGAAGG - Intergenic
1184533646 22:45072015-45072037 GGAACTGTCTGGCTGGGAATGGG - Intergenic
1185077690 22:48692030-48692052 GGGCCTCTCTGATTGGGGACAGG - Intronic
952008839 3:28875744-28875766 AGACTTCTCTGCTTGAGAAAAGG - Intergenic
953025880 3:39144687-39144709 GTATCTGTCTGGTTAGGAAAGGG - Intronic
954688403 3:52382960-52382982 GGAGCTCTGGGGTTGGGACAGGG - Intronic
955735146 3:62031025-62031047 GAACCTTTATGGCTGGGAAAAGG + Intronic
956487331 3:69736975-69736997 GGACTTCTCTGCTAGGGCAATGG - Intergenic
956623501 3:71244733-71244755 GCACCTCTCTGTTTGGGAGGGGG + Intronic
957512338 3:81205463-81205485 GGACTTATATGGTTAGGAAAAGG - Intergenic
960814944 3:121662811-121662833 GGATCCCTCTGGGTGGGAATGGG - Intergenic
961150540 3:124634110-124634132 GGACCTCCAGGGTTGGGGAAGGG - Intronic
961179657 3:124866684-124866706 CGACCTTTCTGGCTGGGATATGG + Intronic
968172155 3:196519268-196519290 TGACCTCACTGTGTGGGAAAGGG - Intergenic
969542696 4:7803541-7803563 GGTCCTCTGTGGTTGGGGATCGG - Intronic
969542734 4:7803656-7803678 GGTCCCCTGTGGTTGGGAATCGG - Intronic
969884779 4:10205699-10205721 GGACCTTTCTGTTAGGGAAGGGG + Intergenic
982793141 4:159615626-159615648 GCATATCTCTGGTTGGGGAAGGG + Intergenic
983833846 4:172365305-172365327 GCATGTCTCTGGTTGGGGAAGGG + Intronic
984327435 4:178271645-178271667 GGACCTCTCTGCTAGGGGAAGGG - Intergenic
984380879 4:178990977-178990999 AGCCCTCTTTGGTTGGAAAATGG + Intergenic
986547948 5:8919364-8919386 GGAACTCTCTTGTGGGGAAATGG + Intergenic
988316165 5:29631988-29632010 GAATCTGTGTGGTTGGGAAAAGG - Intergenic
992747647 5:79835250-79835272 GGACCAGGCTGGTGGGGAAATGG - Intergenic
993891767 5:93483193-93483215 GGAGCGCTCTGGCTGGGATATGG + Intergenic
995018581 5:107341630-107341652 AGCCCTCTCTGGATGGGGAAAGG + Intergenic
1001172121 5:169429349-169429371 GGCCATCTCTGGTTGGGTGAGGG - Intergenic
1001955383 5:175845194-175845216 GGAGCTTTCTGGTTTGGAAAAGG - Intronic
1002270693 5:178070022-178070044 GGGACACTCTGGTTGGGAACTGG + Intergenic
1002567292 5:180119174-180119196 GGACCTCTGAGGTGGGGACATGG + Intronic
1002840001 6:897272-897294 GGACCTGTCTGCTTGGAAAATGG - Intergenic
1003137379 6:3444191-3444213 GGACCTATTTGTCTGGGAAAGGG - Intronic
1005301888 6:24479102-24479124 GCACGTCTCTGGTTGGGGAGGGG - Intronic
1005886011 6:30098297-30098319 GGGCCACTCTGGTGGGGGAAGGG + Intergenic
1011253885 6:85401869-85401891 GGTCCTCATTGGTAGGGAAATGG - Intergenic
1012892165 6:104908619-104908641 GGACTTCTCTGCTTGTGGAAAGG + Intergenic
1013351449 6:109309704-109309726 GGACCTCTCTGTTGGGGAGATGG + Intergenic
1013756488 6:113467779-113467801 AGCCCTCTCAGGCTGGGAAATGG - Intergenic
1016755185 6:147677192-147677214 GGACCTCTCTGTATTGGACAAGG + Intronic
1017750634 6:157487842-157487864 GGACCTGCCTGGATGGGAGAGGG - Intronic
1018083055 6:160275538-160275560 AGCCCTCTCTGGTTGGCAAGAGG + Intronic
1019090532 6:169528374-169528396 GGACTTCTCTGGATCAGAAAGGG - Intronic
1021691972 7:23239388-23239410 GGGCCTCTCTCAGTGGGAAACGG - Intronic
1026807259 7:73436127-73436149 AGTCCTCTCTGGCTGGGAAGGGG + Intergenic
1027139470 7:75646981-75647003 GGACCCTCCTGGTTAGGAAAGGG + Intronic
1029128618 7:98312958-98312980 AGAGCACTCTGGTTGGGAAAGGG + Intronic
1029196275 7:98807812-98807834 TGACCACTCTGGTTATGAAACGG + Intergenic
1030273404 7:107694021-107694043 TGATCTCTGTTGTTGGGAAAGGG + Intronic
1030309992 7:108059393-108059415 GGCCATCTCTAGTTGGGAGAAGG - Intronic
1032738071 7:134711008-134711030 GAACCTCTCTGGCTGAGATAAGG + Intergenic
1033541930 7:142365380-142365402 AGACTCCTCTGGTTGTGAAAGGG - Intergenic
1033945041 7:146706175-146706197 GAACCACTGTGGTAGGGAAATGG + Intronic
1035962011 8:4147835-4147857 AGACTTCTCTGGTCTGGAAATGG + Intronic
1040718020 8:50282126-50282148 GTATGTCTCTGGTTGGGGAAGGG - Intronic
1043629225 8:82307827-82307849 GGTCCAGACTGGTTGGGAAAAGG + Intergenic
1045986852 8:108258896-108258918 GGAACTCACTGGTTGGTAGAAGG + Intronic
1047719363 8:127625144-127625166 TGACCTGTCTGGTGGGTAAATGG - Intergenic
1049663823 8:143834046-143834068 GAACCTCTTTTGTTGGGGAAGGG - Exonic
1050992564 9:12172050-12172072 AGACCCCTCTGTTTGGGACATGG - Intergenic
1051587266 9:18740028-18740050 GGAGATCTCTGCATGGGAAATGG + Intronic
1052987988 9:34501962-34501984 GGCCCTCTCCCGTTGGGAAGGGG - Intronic
1057141981 9:92732053-92732075 GGACCTCACCTGTTGGGAGATGG - Intronic
1057443764 9:95099611-95099633 GCATCTCTCAGGCTGGGAAAGGG + Exonic
1060178873 9:121517948-121517970 GGACCTCTCTGAGTGGGGAAAGG + Intergenic
1060537323 9:124400533-124400555 GGAACTCTCTGGTGGTGGAAGGG + Intronic
1062563965 9:137155721-137155743 GGGCCTCTCTGGTTATGACAAGG - Intronic
1186108477 X:6230203-6230225 GTACCTATCTTGTTGGTAAAAGG - Intergenic
1187250232 X:17591335-17591357 GGAGCTCTCTGGTGGCCAAAGGG + Intronic
1192264151 X:69527365-69527387 GTACCTCCCTGCTTTGGAAAAGG + Intronic
1197456583 X:126683540-126683562 GTACCTCTCTGTCTAGGAAAAGG + Intergenic
1197522061 X:127511010-127511032 AGACCTCTCTGAATGGGCAAAGG + Intergenic
1197705815 X:129633809-129633831 GGAACTCTGTGGTAGGGAGAGGG + Intergenic
1201696994 Y:16837086-16837108 GGATCTCTGTGGTTGGTAAGCGG - Intergenic