ID: 925182748

View in Genome Browser
Species Human (GRCh38)
Location 2:1827494-1827516
Sequence GACCTCTCTGGTTGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925182738_925182748 13 Left 925182738 2:1827458-1827480 CCCTCTGCCTAGAAGGGGATCTC 0: 1
1: 0
2: 1
3: 14
4: 210
Right 925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 172
925182731_925182748 27 Left 925182731 2:1827444-1827466 CCTCATTCCCGCCACCCTCTGCC 0: 1
1: 0
2: 6
3: 72
4: 748
Right 925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 172
925182737_925182748 16 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 172
925182740_925182748 6 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 172
925182732_925182748 20 Left 925182732 2:1827451-1827473 CCCGCCACCCTCTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 172
925182734_925182748 19 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 172
925182739_925182748 12 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG 0: 1
1: 0
2: 0
3: 19
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925182748 Original CRISPR GACCTCTCTGGTTGGGAAAA GGG Intronic
902568739 1:17332926-17332948 GCACTCTCTGGATGAGAAAAGGG + Intronic
904586110 1:31581577-31581599 GACATCTCTGGATGTGCAAAAGG - Intronic
906076941 1:43058792-43058814 TACCGCTCTGGCTGGGAAAGGGG + Intergenic
906488775 1:46251440-46251462 TACCTCTGGGGATGGGAAAAGGG - Intronic
907984150 1:59514452-59514474 AACATCTCTGTTTAGGAAAAAGG - Intronic
908092011 1:60696268-60696290 GATCTGTCTGGTTGGCCAAATGG - Intergenic
908433543 1:64082387-64082409 AACCTCTCTAGTTTGGAATATGG + Intronic
909543604 1:76818521-76818543 GACCACTCTGGTGGGAAAAGTGG + Intergenic
910724963 1:90328498-90328520 GACTCCTCTGCTTGAGAAAAGGG + Intergenic
911343942 1:96674086-96674108 GACTTCTCTGCCTGGGGAAAGGG - Intergenic
911600546 1:99843797-99843819 GATTTCTCTGGTTGGGAAATTGG + Intergenic
912482553 1:109994925-109994947 GACCAAGCTGGTTGGGAACATGG + Intronic
912873072 1:113327811-113327833 GACTCCTCTGCCTGGGAAAAGGG - Intergenic
915143516 1:153780979-153781001 GACCTCTCATGTTGGGGAGAGGG - Intergenic
915716347 1:157948632-157948654 GACCCCTCTGGCTGTGAAGAAGG + Intergenic
915752891 1:158228463-158228485 GACCTCTGTGCTTGAGGAAAGGG + Intergenic
1063914455 10:10867323-10867345 GAAATCTCTGGTTGGGAAGATGG - Intergenic
1065567635 10:27030552-27030574 GAGCTCTTTGGGTGGGAAAGCGG + Intronic
1069633597 10:69912368-69912390 GTCCTCTCTGGTGTGGAAGATGG + Intronic
1069977873 10:72230064-72230086 GAACTCTCAGGTTGGGAGGAGGG + Intronic
1072958162 10:99905225-99905247 GACCTCTCTGGTTAGACTAAGGG + Intronic
1077801585 11:5544379-5544401 GACCTCTTTGCTTGTGAAATAGG - Intronic
1080183376 11:29450123-29450145 CACCTCTCTAGATGGGAATATGG + Intergenic
1084279905 11:68081453-68081475 GACCTCTATGAATGAGAAAAAGG + Exonic
1084935140 11:72582950-72582972 GGCCTCTCTGGTTTGGACACAGG + Intronic
1087113090 11:94493329-94493351 GACCTGGCTAGTTTGGAAAAGGG + Intronic
1087313326 11:96576886-96576908 GACTTCTCTGCCTGGGGAAAGGG - Intergenic
1088960453 11:114658628-114658650 GATCCCTGTGGTTGGGAAAATGG + Intergenic
1089254333 11:117186402-117186424 GATCTCCCTGCTTGGGAAGAAGG - Intronic
1092285185 12:7124551-7124573 GACCTATCTGGTTTGGACAAGGG + Intronic
1093538245 12:20248321-20248343 GACCCCTCTGTCTGTGAAAAGGG + Intergenic
1095808087 12:46343226-46343248 GACTCCTCTGCTTGGGGAAAGGG - Intergenic
1097769978 12:63572326-63572348 GACCCCTCTGCCTGGGGAAAGGG + Intronic
1098152172 12:67557939-67557961 GACTTCTCTGGCTGTGAAACTGG + Intergenic
1098168307 12:67719868-67719890 GACAACTCTTGTTAGGAAAATGG + Intergenic
1101251925 12:102945539-102945561 GACCCCTCTGTTTGTGGAAAGGG - Intronic
1101607540 12:106258935-106258957 GACTTCTCTGCCTGGGGAAAAGG + Intronic
1101644396 12:106616029-106616051 CACCACTTAGGTTGGGAAAAAGG - Intronic
1102889616 12:116548234-116548256 GACCGCTCTGGGTGGGAGAACGG - Intergenic
1103166786 12:118776866-118776888 GACCTCTTTGAGTGGGAAAATGG + Intergenic
1105532318 13:21231042-21231064 GAACTCTCTGGGTGGTAGAAGGG - Intergenic
1106144707 13:27040595-27040617 CACTTCTCAGGTCGGGAAAATGG + Intergenic
1106445950 13:29831079-29831101 AACCCCTCTATTTGGGAAAAAGG - Intronic
1111423671 13:88051791-88051813 GAGGTCTCTGGCTGGCAAAATGG - Intergenic
1112412923 13:99179351-99179373 CACCTCTCAGGCTGGGCAAACGG - Intergenic
1113433854 13:110273572-110273594 TAACTGTCTGGTTGGAAAAAAGG + Intronic
1114064664 14:19051053-19051075 GCCCTCTCTGGTGGGGAGAAGGG - Intergenic
1114097597 14:19348949-19348971 GCCCTCTCTGGTGGGGAGAAGGG + Intergenic
1115877912 14:37881302-37881324 ATTCTCTCTGGTTGGGAACAAGG - Intronic
1118150257 14:63181410-63181432 TACATCTCTGGTTGGGGGAAGGG - Intergenic
1118367813 14:65110605-65110627 GACCTCACAGGCTGGTAAAAAGG - Intergenic
1118387687 14:65270052-65270074 GACCTCTCTGCTTGGAAGGAAGG - Intergenic
1123491949 15:20788108-20788130 GCCTTCTCTGGTGGGGAGAAGGG + Intergenic
1123548454 15:21357198-21357220 GCCTTCTCTGGTGGGGAGAAGGG + Intergenic
1123998212 15:25733575-25733597 GACCTGTCTGGCTGGGAGAGGGG + Intronic
1125230969 15:37454532-37454554 AACCTCTTTGGTTTAGAAAAAGG - Intergenic
1126285747 15:47008954-47008976 AACTTCTCTGCTTGAGAAAAGGG - Intergenic
1131843395 15:96462966-96462988 GCCCTCTTTGGTAAGGAAAATGG + Intergenic
1202956787 15_KI270727v1_random:84429-84451 GCCTTCTCTGGTGGGGAGAAGGG + Intergenic
1133677288 16:8086474-8086496 GTGCTCTCTGGTTATGAAAACGG - Intergenic
1134609944 16:15599970-15599992 GACATCAGTGGTTGGGAATAAGG - Intronic
1136040894 16:27578040-27578062 GACCTAACTGGTTTGGAAAGAGG - Intronic
1138200901 16:55087640-55087662 TACCTCTGTGGCTGGGAAACAGG - Intergenic
1139848370 16:69936028-69936050 GACGTCTCTGGGTGGGAAGCAGG + Intronic
1140772434 16:78217134-78217156 GACATCTTTGGTTGGGAAATGGG + Intronic
1142958433 17:3536260-3536282 GACCTCTCTGGCTGCAAAAGTGG + Intronic
1143775596 17:9196674-9196696 GACCTCTCTGGAGGGGGGAATGG - Intronic
1144322914 17:14147955-14147977 GATCTCTCTGGAAGGAAAAAGGG + Intronic
1145107723 17:20133833-20133855 GACTGGTCTGGTTGGGAATACGG - Intronic
1147360110 17:39925009-39925031 CGCCTCTCTTGTGGGGAAAAGGG - Intronic
1147861797 17:43528213-43528235 GTTCTCTGTGGTTGGGGAAAAGG + Exonic
1148469169 17:47882910-47882932 GACCTATCTCATAGGGAAAATGG + Intergenic
1151285462 17:73107814-73107836 GACAGCTCTGGATGGGAACAAGG + Intergenic
1153401423 18:4687542-4687564 GACCTCTTTTGTAGGAAAAAAGG + Intergenic
1154449498 18:14462659-14462681 GCCCTCTCTGGTGGGGAGAAGGG + Intergenic
1156515844 18:37679602-37679624 GGCCTGTCTGGTGGGGCAAAAGG - Intergenic
1157975627 18:52323913-52323935 AAGCTCTTGGGTTGGGAAAAAGG - Intergenic
1159242675 18:65762948-65762970 GACCTCCCTGATTGGAAATAGGG - Exonic
1159260268 18:66004634-66004656 GACTCCTCTGCTTGTGAAAAGGG + Intergenic
1159478728 18:68959732-68959754 GACATTTCTGCTTGAGAAAAAGG - Intronic
1161734582 19:5983599-5983621 CTCCTCTCTTGCTGGGAAAAGGG - Intergenic
1166152300 19:40882944-40882966 CCCATCTCTGGTTGGGAAAGGGG + Intronic
1167012831 19:46820235-46820257 GACCTTTCTGTTGGGGACAAGGG + Intergenic
1167037222 19:47001602-47001624 GAACCCTCTTCTTGGGAAAACGG - Exonic
1168597215 19:57687406-57687428 GAACTCTCTGGTGTCGAAAAAGG - Exonic
1168647416 19:58068807-58068829 AACATCTCTGGTTTGGAATACGG - Exonic
925182748 2:1827494-1827516 GACCTCTCTGGTTGGGAAAAGGG + Intronic
926675262 2:15613261-15613283 CAGCTCTCTGTTTTGGAAAATGG + Exonic
928078814 2:28289941-28289963 TACCTCTGTGGGTGGGGAAAAGG - Intronic
928748294 2:34441616-34441638 GAAGTCTCTGGTTGAGTAAAAGG + Intergenic
930328448 2:49950939-49950961 CAGCTGTCTGCTTGGGAAAAAGG + Intronic
932206123 2:69884578-69884600 GACATCTGTGGTGGGGAAAGGGG - Intergenic
933140699 2:78789469-78789491 GACATTTATGGTTTGGAAAATGG + Intergenic
934906019 2:98204327-98204349 GCCCTTTATGATTGGGAAAAAGG - Intronic
938481943 2:131670085-131670107 GCCCTCTCTGGTGGGGAGAAGGG - Intergenic
941745913 2:169087221-169087243 GACTCCTCTGCTTGTGAAAAGGG - Intronic
943358698 2:186892514-186892536 GACCTCTTCAGTGGGGAAAAAGG - Intergenic
945959877 2:216121874-216121896 AACCTCTTTGGTTTGTAAAAGGG - Intronic
947113998 2:226749708-226749730 GAACTCTCAGGTGGGAAAAATGG - Intronic
1170907105 20:20526257-20526279 AACCTCTCTGCCTCGGAAAATGG - Exonic
1172119545 20:32589664-32589686 GACCTCTCAGGTTGGGTCAGGGG + Intronic
1172586361 20:36087968-36087990 GACCTCTCAAGTTGAAAAAATGG - Intergenic
1172766366 20:37353240-37353262 GCTCTCTCTGCTTGGGCAAATGG + Intronic
1173475427 20:43355817-43355839 GACATCTCTGATGGTGAAAAAGG + Intergenic
1178337525 21:31756809-31756831 GAACTCTGTAGTTGGGAAAGAGG + Intergenic
1179148515 21:38789981-38790003 GACATCTCTGGGAGTGAAAAGGG + Intergenic
1179631983 21:42684366-42684388 GTCCTGTCTTGGTGGGAAAATGG + Intronic
1180177103 21:46096206-46096228 GGCCTCTCTGGTTGCTGAAAAGG - Intergenic
1180483152 22:15773675-15773697 GCCCTCTCTGGTGGGGAGAAGGG - Intergenic
1180898487 22:19354172-19354194 GCCTTCTCTGGTTGGCAAAGAGG - Intronic
1183497259 22:38153999-38154021 GACTTCTCTGCTTGTGGAAAGGG + Intronic
1183958917 22:41399165-41399187 GCCCTCTCTGGCTGGGAAGAAGG - Exonic
949970391 3:9398160-9398182 GATCTCTCTCCCTGGGAAAATGG - Intronic
954502422 3:51030898-51030920 TAAATCTCTGATTGGGAAAATGG + Intronic
956304260 3:67806452-67806474 GAGCACTGAGGTTGGGAAAAAGG + Intergenic
957320355 3:78622611-78622633 TACCTCTCTTGATGGGAGAATGG - Intronic
960067375 3:113387949-113387971 GACTTCTCTGCTTGTGGAAAAGG + Intronic
960298018 3:115967934-115967956 GACTCCTCTGCTTGGGAAAAAGG - Intronic
966722956 3:183082642-183082664 GTCTTCTCTGGTTGGGAAAGAGG - Intronic
967610155 3:191495757-191495779 AACCTCACTGGTGGGGACAAGGG - Intergenic
968172154 3:196519267-196519289 GACCTCACTGTGTGGGAAAGGGG - Intergenic
970477591 4:16439412-16439434 TACCTCCCAAGTTGGGAAAATGG + Intergenic
972643114 4:40943301-40943323 GCACTCTCTGGCTGGGAAGATGG + Intronic
973036528 4:45414420-45414442 GAAACCTCTGGTGGGGAAAAAGG - Intergenic
974770323 4:66403571-66403593 AACTCCTCTGCTTGGGAAAAGGG - Intergenic
978458458 4:108922906-108922928 GATCTCTCTGGCAGGAAAAATGG + Intronic
979775416 4:124583309-124583331 AAGCTCCCTGGGTGGGAAAAGGG + Intergenic
980693064 4:136320701-136320723 GGCCTCTCTGCTTGTGGAAAGGG + Intergenic
981181094 4:141745939-141745961 GACCTGTCTGTGAGGGAAAAGGG - Intergenic
983083088 4:163412089-163412111 GGCCTCTCTAGCTGGGAAGAAGG + Intergenic
984327434 4:178271644-178271666 GACCTCTCTGCTAGGGGAAGGGG - Intergenic
984539382 4:181018867-181018889 GAAACATCTGGTTGGGAAAATGG - Intergenic
984922706 4:184779699-184779721 CACCTCTGTGGTTAGAAAAATGG - Intronic
986547949 5:8919365-8919387 GAACTCTCTTGTGGGGAAATGGG + Intergenic
988936877 5:36092691-36092713 CACCCCTATGGTTGGGAAAATGG - Intergenic
988939396 5:36127672-36127694 GACTCCTCTGCTTGTGAAAAGGG + Intronic
992783855 5:80151943-80151965 GATCTCTCTCCTTGGGAAAGAGG - Intronic
995242566 5:109901550-109901572 GTCCTATTTGTTTGGGAAAAAGG + Intergenic
999817290 5:155189931-155189953 GACATCTGTGGTAGGGACAATGG + Intergenic
1000626328 5:163543585-163543607 GACGGCTCTGGTTGGGAATTAGG - Intergenic
1001562279 5:172677524-172677546 GCCTTCTCTGGTTGGCAGAAGGG + Intronic
1002616179 5:180457912-180457934 GACCTTTCTGGCTGGGGAGAAGG - Intergenic
1003580390 6:7334841-7334863 AACCTCTCTGGATGGAAAAATGG - Intronic
1004961139 6:20790525-20790547 GAGGTCTCTGGTTGGCAAAGTGG - Intronic
1007001592 6:38318999-38319021 GACCCCTCTGGCTGGGGCAAGGG - Intronic
1008641975 6:53473774-53473796 GACTGCTCTGGTTGTGGAAAAGG - Intergenic
1010276000 6:73969100-73969122 GGCCTCACCGGTTGGCAAAAGGG + Intergenic
1012892166 6:104908620-104908642 GACTTCTCTGCTTGTGGAAAGGG + Intergenic
1013609344 6:111779541-111779563 GACCTCACTGGTTGTGAGGATGG + Intronic
1014186899 6:118445262-118445284 GGCTTCTCTGGCTGTGAAAAAGG - Intergenic
1014840750 6:126217990-126218012 GACTCCTCTGCTTGTGAAAAGGG - Intergenic
1015823816 6:137291195-137291217 GGTCTCTCTGGTTTGGAAGAGGG + Intergenic
1019832087 7:3341424-3341446 TTCCTCTCAGGTTGGGAACAAGG + Intronic
1021036139 7:15801497-15801519 GAACTTTTTGGTTGGGAGAATGG - Intergenic
1022366921 7:29730440-29730462 GACCCCTCTGCCTGGGGAAAGGG - Intergenic
1026315243 7:69221917-69221939 GACCTCTCTGCCTGGGTAGATGG + Intergenic
1026807260 7:73436128-73436150 GTCCTCTCTGGCTGGGAAGGGGG + Intergenic
1026937923 7:74269764-74269786 GACCTCAATGATTGGGAAAATGG + Intergenic
1029128619 7:98312959-98312981 GAGCACTCTGGTTGGGAAAGGGG + Intronic
1029825345 7:103187015-103187037 GACCACTCTGCCTGGGGAAAGGG + Intergenic
1030273405 7:107694022-107694044 GATCTCTGTTGTTGGGAAAGGGG + Intronic
1033780269 7:144660827-144660849 GACCTGTCTAGTTGGAGAAAAGG + Intronic
1035753997 8:2017635-2017657 GACTTCTCTGCCTGTGAAAATGG - Intergenic
1037408098 8:18565228-18565250 GACTTCTCTGGTGGGCAGAAAGG + Intronic
1037637028 8:20709348-20709370 GACTTCTCTAGTTGGGTATAGGG - Intergenic
1037671299 8:21017429-21017451 GAGCTCCCTGGTTGGTAGAATGG - Intergenic
1037685017 8:21131182-21131204 GACTTCTCTGGCAGGGAAAGAGG + Intergenic
1041532908 8:58891617-58891639 GACCCTTCAGGATGGGAAAAAGG + Intronic
1042747878 8:72127181-72127203 GAGATCTCAGGTTGGGCAAATGG + Intergenic
1043214985 8:77574389-77574411 GACTCCTCTGCTTGTGAAAATGG + Intergenic
1044883540 8:96749606-96749628 GAGGACTCTGGATGGGAAAAAGG + Intronic
1045986853 8:108258897-108258919 GAACTCACTGGTTGGTAGAAGGG + Intronic
1046760385 8:118014326-118014348 GACCTTTTTGGGTGGGATAAAGG - Intronic
1047352373 8:124088266-124088288 GACCCCTCTGCTTGAGGAAAGGG - Intronic
1051980951 9:23015646-23015668 GACTTCTGTGGTTGGGACATAGG + Intergenic
1052072040 9:24093332-24093354 GGCATCTCTGGGTGGCAAAAAGG + Intergenic
1056190113 9:84176585-84176607 GACCTCTGGGGTTGGCTAAAGGG + Intergenic
1057281540 9:93715937-93715959 GCCCTCTGAGTTTGGGAAAAGGG - Intergenic
1059393387 9:114015517-114015539 TACCTTTCTGGTTGGGATGATGG + Intronic
1059394114 9:114020864-114020886 GAACTCTATGATTGGGAACATGG - Intronic
1059937743 9:119328409-119328431 TCCCTCTCTGGTAGGGAGAAAGG - Intronic
1060660799 9:125404157-125404179 GAACTCTCTCCTTGGGCAAAGGG - Intergenic
1061199529 9:129129056-129129078 GCCCTCTCGGTTTGGGAATAAGG + Exonic
1186157725 X:6742989-6743011 GACTTCTTTGTTTGGAAAAATGG + Intergenic
1187254668 X:17631231-17631253 GGTCTATTTGGTTGGGAAAAGGG + Intronic
1188651259 X:32634101-32634123 GACATCTCTGTTTGTGGAAAGGG - Intronic
1189848629 X:45158105-45158127 GACCCCTGTGGCTGGGAAGAGGG + Intronic
1189875635 X:45433502-45433524 GACCCCTCTGCTTGAGGAAAAGG - Intergenic
1193052352 X:77115010-77115032 GACTCCTCTGCCTGGGAAAAGGG - Intergenic
1193807752 X:86014618-86014640 GAGGTCTCTGGTTGGCAAAGTGG + Intronic
1195136548 X:101912419-101912441 AACATCTCTGGTTTGGAATACGG - Intronic
1197201013 X:123748547-123748569 GACCTCTTTGCTAGGGGAAATGG - Intergenic