ID: 925182751

View in Genome Browser
Species Human (GRCh38)
Location 2:1827505-1827527
Sequence TTGGGAAAAGGGGAGCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 330}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925182738_925182751 24 Left 925182738 2:1827458-1827480 CCCTCTGCCTAGAAGGGGATCTC 0: 1
1: 0
2: 1
3: 14
4: 210
Right 925182751 2:1827505-1827527 TTGGGAAAAGGGGAGCATCCAGG 0: 1
1: 0
2: 2
3: 30
4: 330
925182734_925182751 30 Left 925182734 2:1827452-1827474 CCGCCACCCTCTGCCTAGAAGGG 0: 1
1: 0
2: 0
3: 35
4: 331
Right 925182751 2:1827505-1827527 TTGGGAAAAGGGGAGCATCCAGG 0: 1
1: 0
2: 2
3: 30
4: 330
925182740_925182751 17 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182751 2:1827505-1827527 TTGGGAAAAGGGGAGCATCCAGG 0: 1
1: 0
2: 2
3: 30
4: 330
925182737_925182751 27 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182751 2:1827505-1827527 TTGGGAAAAGGGGAGCATCCAGG 0: 1
1: 0
2: 2
3: 30
4: 330
925182739_925182751 23 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182751 2:1827505-1827527 TTGGGAAAAGGGGAGCATCCAGG 0: 1
1: 0
2: 2
3: 30
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925182751 Original CRISPR TTGGGAAAAGGGGAGCATCC AGG Intronic
900814137 1:4830396-4830418 CTGGGAAAGGGGGGGCATCCTGG - Intergenic
901987723 1:13089473-13089495 TTGGGAGATGGAGAGCATCCTGG - Intergenic
901994089 1:13137294-13137316 TTGGGAGATGGAGAGCATCCTGG + Intergenic
902435142 1:16393530-16393552 CCGGGAAGAGGAGAGCATCCTGG + Intronic
902715152 1:18267591-18267613 TTGGAAAAAGGGGAGCATGGAGG + Intronic
903487118 1:23698070-23698092 TTGGTGAAAGGGGAGAATCGTGG + Intergenic
903649146 1:24912484-24912506 GTGGGAGAAGGGGGGCTTCCTGG - Intronic
904259387 1:29279725-29279747 AAGGGAAATGGGGGGCATCCTGG + Intronic
904286556 1:29456391-29456413 GTGGGAAAAGGGGAGAGTCGAGG + Intergenic
904562724 1:31409677-31409699 TTGGGATTGGGGGAGCATCTGGG - Exonic
904584277 1:31570890-31570912 TTGAGATAAGGAGATCATCCTGG - Intergenic
906260564 1:44385446-44385468 TTGGGAGATGGAGACCATCCTGG + Intergenic
906510793 1:46409490-46409512 TTGGGCCAAGGGCAGGATCCAGG + Intronic
906531959 1:46528907-46528929 TTGGGAAAAAAGGGACATCCTGG - Intergenic
906645323 1:47470458-47470480 GTGGGGACAGGGGTGCATCCTGG + Intergenic
907594458 1:55706393-55706415 TGGGGAAAAGATGAGCAACCAGG + Intergenic
910255074 1:85239823-85239845 TAGAGAAAAGGGGAGGATCTTGG + Intergenic
910859310 1:91728243-91728265 TTGGGATAAGGGAAGCATGGTGG + Intronic
911124536 1:94328648-94328670 GTGGGTAAGGAGGAGCATCCAGG + Intergenic
911566545 1:99469069-99469091 TCGGGAAATGGAGACCATCCTGG - Intergenic
912433129 1:109640208-109640230 TTAGGAAAAGGTGAGCCTCCTGG + Intergenic
913228799 1:116723870-116723892 TTAGGACAAGGGAAGCTTCCAGG - Intergenic
913254887 1:116944544-116944566 TTGGGAAAACGTGCCCATCCGGG + Intronic
914851412 1:151317034-151317056 TTGGGAGATGGAGACCATCCTGG - Intronic
915592472 1:156878616-156878638 TGGGGAGAAGGCGGGCATCCTGG + Intronic
916494499 1:165333366-165333388 TTGGGAGATGGAGACCATCCTGG - Intronic
917019321 1:170569141-170569163 TTGGGAAAAGCGTAGTATCTGGG - Intergenic
917586035 1:176426846-176426868 TTAGGAAAAGGGCTGAATCCAGG - Intergenic
918067757 1:181113043-181113065 TTGGGGGAAGGGGAGCTGCCTGG + Intergenic
918162370 1:181913290-181913312 TTGGGAAAACAGAAGTATCCAGG + Intergenic
918356204 1:183708263-183708285 CAGGGAAAAGGAGACCATCCTGG + Intronic
920030569 1:203035189-203035211 TGGGCAAAAAGGGAGCCTCCAGG - Intronic
920525866 1:206665757-206665779 TTGGCAAGAGGGGTGCCTCCAGG + Intronic
920541904 1:206785075-206785097 ATGGGAAAAGGCGAGCAGGCAGG + Intergenic
920859585 1:209694516-209694538 TTGGGGCAAGGGGAGGTTCCTGG + Intronic
921158581 1:212456855-212456877 TTGGGATGAGGGGAGAAGCCTGG + Intergenic
922380089 1:225014128-225014150 ATGGGAAAAGTGTAGCATCTGGG + Intronic
922686277 1:227640833-227640855 CAGGGAAAAGGAGACCATCCTGG + Intronic
1064377340 10:14809214-14809236 TCGGGAAATGGAGACCATCCTGG - Intergenic
1066749530 10:38638804-38638826 TCAGGAGAAGGAGAGCATCCTGG - Intergenic
1069744288 10:70705252-70705274 TTAGGAGCAGGAGAGCATCCAGG - Intronic
1069929719 10:71874273-71874295 TGGGGAAAAGAGAAGGATCCCGG - Intergenic
1070587548 10:77777993-77778015 CTGGGAAAAGGGGAGGCTTCAGG - Intergenic
1071878174 10:89865390-89865412 TTGGGGATGGGGGAGCAGCCAGG + Intergenic
1072694259 10:97591154-97591176 CAGGGAAGAGGGGAGCAGCCAGG + Intronic
1072953637 10:99870165-99870187 AAGGGAAAAGGGTAGTATCCGGG + Intergenic
1073301360 10:102473035-102473057 TCGGGAAATGGAGACCATCCTGG - Intronic
1074365033 10:112850881-112850903 TTGGGGAAAGGGGCAGATCCAGG - Intergenic
1074674336 10:115831164-115831186 TAGGGAAAAGGGAAGCAAACCGG - Intronic
1075077200 10:119359373-119359395 ATGGCAAGAGGGGAGCCTCCGGG + Intronic
1075324387 10:121519066-121519088 TTGGGAAAAGATGACCAACCTGG - Intronic
1075672587 10:124272746-124272768 GTGGCAAAAGGAGAGCAACCAGG + Intergenic
1076160219 10:128237761-128237783 TTGGAGAAAGGGGAGGGTCCTGG + Intergenic
1076406773 10:130217453-130217475 TTGGGAAGAAGGAAGCATTCTGG - Intergenic
1077376293 11:2206241-2206263 TTGGGAGAAGGGGCTTATCCGGG + Intergenic
1077457446 11:2689400-2689422 TTGGGAAATGGGGAGCATAGGGG + Intronic
1077517260 11:3009476-3009498 TTGGGAAAAGGGAAGAGTTCTGG + Intronic
1078128429 11:8592050-8592072 TTGGAAGAAAGAGAGCATCCAGG - Intronic
1078343736 11:10524202-10524224 TTGGGAAATGGAGACCGTCCTGG + Intronic
1078675258 11:13406168-13406190 TTTGGAGAAGGAGAGCATGCAGG - Intronic
1080884752 11:36356424-36356446 GTGAGAAAAGGGAAGCCTCCAGG + Intronic
1081689697 11:45069474-45069496 CTGGGTAAAGCAGAGCATCCAGG - Intergenic
1081788641 11:45767041-45767063 TCGGGAGAAGGGGAGCATCTTGG - Intergenic
1082059992 11:47851727-47851749 TGGGGAAAAGAGGAGCATCTAGG - Intergenic
1082782088 11:57295681-57295703 TTGGTAAAAGGAGAGCATCCTGG - Intergenic
1083368445 11:62158062-62158084 TTGGGAAAAGTGCAGTATCTGGG - Intergenic
1083619412 11:64041595-64041617 ATGGAAAAAGGGGTGCAGCCAGG + Intronic
1084366117 11:68700509-68700531 TTGGGAGATGGAGACCATCCTGG + Intergenic
1084994716 11:72964998-72965020 TTGGGAAATTGAGACCATCCTGG - Intronic
1085527541 11:77172992-77173014 TTGGGGAATGGGGGGCACCCCGG + Intronic
1086937659 11:92762776-92762798 TTGGGATCAGGGGAGCACACTGG - Intronic
1087311990 11:96555874-96555896 TTTGGAAAAGGGCAGTATTCGGG - Intergenic
1087696907 11:101389722-101389744 TTAGGAAAAGAGGATCATGCAGG - Intergenic
1089128821 11:116195813-116195835 TTTCGTAAAGGGGAGCAGCCAGG + Intergenic
1089727713 11:120497119-120497141 TTGGGAGATGGAGACCATCCTGG + Intergenic
1091048450 11:132347015-132347037 CCGGGAAAAAGGCAGCATCCAGG - Intergenic
1091663107 12:2399094-2399116 TTGTGGGAAGGGGAGCATGCAGG + Intronic
1093282550 12:17211938-17211960 TTGGGAGATGGAGACCATCCTGG - Intergenic
1094061143 12:26316479-26316501 ATGGGAAAAGCGAAGTATCCGGG + Intergenic
1095472996 12:42556296-42556318 TGGGGCAAAGGGGAGGAGCCAGG - Intronic
1095674179 12:44897586-44897608 TTGGGAAAAGCAGAGTATCTGGG - Intronic
1095749779 12:45697328-45697350 GTGGGAGAAGGGGGGCTTCCCGG + Intergenic
1097959654 12:65520138-65520160 TTGGAAATAGTGGAGCCTCCTGG + Intergenic
1099130326 12:78821163-78821185 TGAGGAACAGGGAAGCATCCAGG + Intergenic
1099551096 12:84043954-84043976 TTGGGAAAAGTGTAGTATCTGGG + Intergenic
1099554714 12:84097389-84097411 ATGGGAAAAGTGCAGCATCTGGG - Intergenic
1104669381 12:130669999-130670021 TTGAGATGAGGAGAGCATCCTGG + Intronic
1104740263 12:131166793-131166815 TTGAGATAGGGAGAGCATCCTGG + Intergenic
1104791961 12:131488672-131488694 TTGAGATAGGGAGAGCATCCTGG - Intergenic
1105023732 12:132835073-132835095 TTGAGATGAGGGGAGGATCCTGG - Intronic
1105524790 13:21167246-21167268 ATGGGAAAAGGGGATGATCTAGG - Intronic
1105769352 13:23594069-23594091 ATGGGAAAAGCGTAGTATCCGGG - Intronic
1106335141 13:28777047-28777069 TTGGGAAAAGTGTAGTATCTGGG + Intergenic
1106487115 13:30181665-30181687 TAGGGAGAAGGGCTGCATCCTGG - Intergenic
1107869627 13:44734926-44734948 GTGGGAAGAGGGGAGGACCCAGG - Intergenic
1111950938 13:94708418-94708440 TTGGGAAAAGGGGAGGGGGCGGG + Intergenic
1112106482 13:96245885-96245907 GTGGGAATAGGGGAACATCCTGG + Intronic
1112817261 13:103287397-103287419 TCAGGAAATGGGGACCATCCTGG - Intergenic
1113120735 13:106921472-106921494 TGGGGAAATGCGGTGCATCCTGG + Intergenic
1114534057 14:23412077-23412099 GTGGGAAGAAGGGAGCACCCTGG + Intergenic
1114726204 14:24940619-24940641 TTTGGAAAAGGTTTGCATCCAGG - Intronic
1115061268 14:29192941-29192963 TTGGGAAAAGGGTAGCTACCAGG + Intergenic
1115911627 14:38263280-38263302 TTGGGAGATGGAGACCATCCTGG - Intergenic
1116922890 14:50599433-50599455 TTGGGAAAATGGGAACACTCAGG + Intronic
1117390584 14:55258632-55258654 TTGGGAGATGGAGACCATCCCGG + Intergenic
1117829084 14:59732783-59732805 CTAGGAAAAGGGCAGAATCCAGG + Intronic
1119031238 14:71194302-71194324 TTGGGAACAGGTGGGAATCCAGG + Intergenic
1119176343 14:72570326-72570348 GTGGGAAAAGGGGACAGTCCTGG + Intergenic
1120869119 14:89321364-89321386 TTGGGAGATGGAGACCATCCTGG + Intronic
1121824811 14:97001454-97001476 TTGTGAAAAGGTGAGAATGCTGG + Intergenic
1122130635 14:99603110-99603132 CTGGGAAAAGGGCTGCAGCCAGG + Intronic
1122308987 14:100782986-100783008 TTGAGATAAGGGGAGCATCAGGG + Intergenic
1124103630 15:26717531-26717553 TTTGGACAAGGGGAGAATTCAGG - Intronic
1124152461 15:27193566-27193588 TTGGGAAAAGTGCAGTATTCGGG + Intronic
1127535083 15:59882683-59882705 TCAGGAAATGGAGAGCATCCTGG + Intergenic
1128724225 15:69975884-69975906 TTGAGAAAAGCAGAGAATCCAGG - Intergenic
1129227489 15:74178631-74178653 TTGGGGATGGGGGAACATCCAGG - Intergenic
1130081530 15:80738141-80738163 TTGGGAAAAAGGGAGAAGCTGGG + Intronic
1132954073 16:2581782-2581804 TTGTGAACACGGGAGCCTCCAGG - Intronic
1132960272 16:2618381-2618403 TTGTGAACACGGGAGCCTCCAGG + Intergenic
1133063159 16:3188512-3188534 TTCGGAGAAGGGGAGAATACCGG + Intergenic
1133259180 16:4537705-4537727 TTGGGAAACGGGCAGATTCCTGG - Intronic
1133590078 16:7233640-7233662 TTGTTGAAAGGGCAGCATCCAGG - Intronic
1134477461 16:14588263-14588285 TTGGAAAAAGGAGAGCAACAAGG + Intronic
1134647021 16:15877061-15877083 TTAGGAAATGGAGACCATCCTGG - Intronic
1135534656 16:23283991-23284013 GTGGGACAAGGGGAGGAGCCAGG - Intronic
1137071764 16:35910000-35910022 CAGGGAAAAGGAGATCATCCTGG + Intergenic
1137883035 16:52072518-52072540 TTGGGAAAAAGAGAGAATCCTGG - Intronic
1138104424 16:54280111-54280133 TGGGGAGCGGGGGAGCATCCCGG - Intergenic
1138565893 16:57832636-57832658 TTGGGGAAAGGGCAGTATGCTGG - Intronic
1139823753 16:69740840-69740862 TTGGGAGATGGAGACCATCCTGG + Intergenic
1141363251 16:83417299-83417321 TTGGGGAAAGGGGAGAAAACCGG - Intronic
1142683907 17:1566126-1566148 TTGGGAAATAGGGAACATGCCGG + Intergenic
1142751476 17:1990963-1990985 TGGAGAAAATGAGAGCATCCAGG + Intronic
1143201983 17:5119604-5119626 TTGGGAAGAGGGGCTCCTCCAGG - Intronic
1143524402 17:7463658-7463680 TTGGAGAAAGGGGAGCCTCCGGG + Exonic
1144490126 17:15701162-15701184 CTTGGAAATGGGGAGAATCCTGG - Exonic
1144910837 17:18680797-18680819 CTTGGAAATGGGGAGAATCCTGG + Exonic
1145391945 17:22461911-22461933 GTGGAAAAAGGGGAGGCTCCAGG - Intergenic
1146458624 17:33026058-33026080 TTAGGGAAAGGGGTGCCTCCTGG + Intronic
1146746394 17:35334099-35334121 TTGGGAAAAGTGTAGTATCAGGG + Intergenic
1147041329 17:37721594-37721616 ATGGGAAAAGAGAAGCAGCCGGG - Intronic
1147258412 17:39195470-39195492 TTGGGCACAGGGGAGAAGCCAGG - Intronic
1147671266 17:42178196-42178218 TTGGTAGAAGGGGAGCCACCTGG - Exonic
1147793185 17:43025656-43025678 TTGGGAGAACCAGAGCATCCGGG + Intronic
1147793240 17:43025820-43025842 TTGGGCAAAGGGGAGATCCCGGG - Intronic
1149530864 17:57394171-57394193 TTGGAAAAAGGGGAGGATTGAGG - Intronic
1152411336 17:80124858-80124880 GTGGGAAGAGCAGAGCATCCGGG + Intergenic
1152912250 17:83011678-83011700 TTGGGAAAAGAGGAGGCACCTGG + Intronic
1153054469 18:932571-932593 TTGGGATAAGATGAGCCTCCTGG - Intergenic
1153094473 18:1384658-1384680 TGGGGAGAATGGAAGCATCCTGG + Intergenic
1154153253 18:11924151-11924173 TTGGGAGATCGAGAGCATCCTGG - Intergenic
1154226843 18:12512881-12512903 GTGAGGAAAGGAGAGCATCCGGG - Intronic
1155704881 18:28796795-28796817 CAGCGAAAAGGGGAGCGTCCAGG - Intergenic
1156571076 18:38253959-38253981 TTGAGATAAGGGCACCATCCTGG + Intergenic
1156582310 18:38392525-38392547 ATGGGAAAAGTGTAGTATCCAGG - Intergenic
1157383846 18:47246783-47246805 GTCGGAGAAGGGGAGCAGCCGGG - Intronic
1159010724 18:63057052-63057074 ATGGGAAGAGGGCAGCATGCTGG - Intergenic
1160375382 18:78407552-78407574 TTCGGAAGAGGGGGGCCTCCTGG - Intergenic
1162009918 19:7806701-7806723 TTGGAAAAATGAGAGCAGCCTGG - Intergenic
1162138483 19:8570909-8570931 TTCGGAAAATGGGAACATCGAGG + Intronic
1162339815 19:10085862-10085884 CTGTGAAATGGGGAGAATCCTGG - Intergenic
1162402488 19:10454404-10454426 TGGGGAAAAGGGGGGCAAGCCGG - Intronic
1162888234 19:13712483-13712505 GTTGGAAATGGGGAGCATCTGGG - Intergenic
1163079473 19:14926838-14926860 TGGGGAAAAGTTGAGCATCATGG + Intergenic
1164236861 19:23345205-23345227 CAGGGAAAAGGGGACCATCCTGG - Intronic
1164770360 19:30803664-30803686 TTGGTACAAAGGGAGCTTCCTGG + Intergenic
1164899112 19:31903197-31903219 TTGGGAAATTGGGAGCCTTCTGG + Intergenic
1166091532 19:40512578-40512600 CCAGGAGAAGGGGAGCATCCAGG - Intronic
1166223985 19:41383726-41383748 TTGGGCCAAGGGGGACATCCAGG + Exonic
1167236606 19:48319447-48319469 TTTGGAGATGGGGAGCATACGGG - Exonic
1167353113 19:48988011-48988033 TCGGGAAATGGAGATCATCCTGG - Intronic
1167390615 19:49192352-49192374 TCAGGAGATGGGGAGCATCCTGG - Intronic
1167523752 19:49971596-49971618 CTGGGCAAAGGGAAGCGTCCTGG - Intergenic
1167756311 19:51415664-51415686 CTGGGTAAAGGGAACCATCCTGG + Intronic
1168047119 19:53802016-53802038 TTGGGAGATGGAGACCATCCTGG + Intronic
924967554 2:92270-92292 TTGGGAAAAGCAGAGTATCTGGG - Intergenic
925182751 2:1827505-1827527 TTGGGAAAAGGGGAGCATCCAGG + Intronic
928124088 2:28604159-28604181 TGGGGAGACGGGGAGCAGCCTGG + Intronic
928493979 2:31813119-31813141 TTGTGGAAAGGGGAGCACACAGG + Intergenic
932771217 2:74501925-74501947 GTGGGAAGAGGCGAGCACCCAGG - Intronic
932939017 2:76139899-76139921 CTGGGAAAAGTGTAGCATCTGGG + Intergenic
934037921 2:88104175-88104197 TTGGGAAATCGAGACCATCCTGG - Intronic
934670258 2:96208161-96208183 TTGGGACGAGGAGAGGATCCAGG - Exonic
934920834 2:98344132-98344154 TGGGGAAAAGAGTAGCACCCAGG - Intronic
938920696 2:135992058-135992080 TTGGGGAAAGAGGAGAGTCCAGG + Intergenic
939203914 2:139075121-139075143 TTGGGAAGAGGAGAGTCTCCTGG - Intergenic
940417880 2:153443221-153443243 GTGGGAAAAGTGGAGTATCTGGG + Intergenic
940654481 2:156471565-156471587 GTGGAGAAAGGGGAGCATCATGG - Intronic
941085057 2:161107816-161107838 AGGGGAAAGGGGGAGAATCCAGG + Intergenic
941682396 2:168413217-168413239 GTGGGAAAAGCGTAGCATCTGGG + Intergenic
941729035 2:168895522-168895544 CTGGGGAAATGGGAGGATCCTGG + Intronic
945052257 2:205835226-205835248 TTGGGAAATGGGGTGCATCAGGG + Intergenic
947311634 2:228809508-228809530 GTGGGAAAAGGGTAGTACCCGGG + Intergenic
947807053 2:232976300-232976322 TTGTGAAATGGGGAGCATGGAGG + Intronic
948393559 2:237628526-237628548 TTGGGAAAAGGGGAGCCAATAGG + Intronic
948483061 2:238262369-238262391 AGGGGAAAAGGGGAGCAAACAGG + Intronic
948666693 2:239539119-239539141 TTGAGACAAGGAGATCATCCTGG + Intergenic
1168809499 20:695166-695188 TTGTGAAAAGGGGAGGAGTCAGG - Intergenic
1170229455 20:14028595-14028617 ATGGGAAAAGCGTAGTATCCAGG + Intronic
1171264405 20:23759220-23759242 GTGAGAAAAGGGGAGGATCCCGG - Intergenic
1171369488 20:24652354-24652376 CTGGGATAAGGGGTGAATCCTGG - Intronic
1171427605 20:25058289-25058311 TTAGGAAGAGGGGAGCAGCGTGG + Intronic
1172466716 20:35160909-35160931 TTGGGAAAAGCGCAGTATCTGGG - Intergenic
1173852192 20:46226146-46226168 TTGGGAGAAGTGGAACAGCCTGG - Intronic
1174554905 20:51387233-51387255 TTGGGACAAGCTTAGCATCCTGG - Exonic
1174902130 20:54511209-54511231 ATGGGTAAATGTGAGCATCCAGG - Intronic
1175053574 20:56177453-56177475 AGGGGATCAGGGGAGCATCCGGG + Intergenic
1177559057 21:22727382-22727404 TTGGGAGATGAAGAGCATCCTGG + Intergenic
1178234184 21:30822511-30822533 CTGGGAAAAGGAGAGCACCCTGG + Intergenic
1178332730 21:31713494-31713516 TTGAGAAAAAGAGAGAATCCTGG + Intronic
1178925106 21:36768233-36768255 TTGGAAGGAGGGGAGCAGCCAGG + Intronic
1179051536 21:37892668-37892690 TTGGGAAAAGGGGTGCAGAATGG + Intronic
1179732246 21:43374409-43374431 TTGGGAAAAGCGGAGGGACCAGG - Intergenic
1180699029 22:17771840-17771862 GTGGGAAAGGGGAAGCTTCCGGG - Intronic
1181894575 22:26095798-26095820 TGGAGAGGAGGGGAGCATCCAGG + Intergenic
1182342179 22:29632319-29632341 TTGGGGAAAGAGGAGCAAGCAGG - Intronic
1182992554 22:34782032-34782054 TTGGGAAAAGATGAGCTCCCTGG - Intergenic
1183609111 22:38885263-38885285 TTGGGAAATTGAGACCATCCTGG - Intergenic
949319402 3:2791952-2791974 TTGAGATAAGGAGATCATCCCGG - Intronic
949844158 3:8353213-8353235 ATGGGAAAAGGGGATAGTCCTGG - Intergenic
950107767 3:10399070-10399092 GAGGGAAAAGGGGAGGATGCTGG - Intronic
950614726 3:14149378-14149400 GTAAGAAAAGGGGAGCAGCCGGG - Intronic
951080182 3:18444196-18444218 TGGGGAAAAGGGGAGCCTCTCGG - Intronic
953226513 3:41026498-41026520 TAGGGCATAGGGGAGCAGCCTGG + Intergenic
954653322 3:52178492-52178514 TGGGGAAAGGGGGAGCTGCCAGG + Intergenic
955033560 3:55243914-55243936 AAGGGAAAGGGTGAGCATCCAGG + Intergenic
956355660 3:68389829-68389851 TTGGGAAAAGCGTAGTATCTGGG - Intronic
956692021 3:71887373-71887395 TTGAGAAGAGGAGATCATCCTGG + Intergenic
956727439 3:72168151-72168173 TTCGGAAACGGGGTGCATCTTGG - Intergenic
957985788 3:87572159-87572181 TGGGGAAAAGGGGAGCAAAGAGG - Intergenic
958910473 3:99988284-99988306 TTGGGAGATGGAGACCATCCTGG + Intronic
959667226 3:108935477-108935499 TTAGGAAATGGAGACCATCCTGG + Intronic
959843667 3:111007612-111007634 TTGGAAAAAGGGGAAAATCTAGG + Intergenic
961501966 3:127342652-127342674 TTGGGAGAAAGGGCGGATCCAGG + Intergenic
962282226 3:134060624-134060646 TTAGGAAAAAGGGAGGACCCAGG - Intergenic
963111742 3:141694186-141694208 TGGGGAAAAGGGGAGCAATGAGG + Intergenic
964158058 3:153610877-153610899 TTAGGAGATGGAGAGCATCCTGG + Intergenic
964232426 3:154486749-154486771 ATGGGAAAAGTGTAGTATCCAGG - Intergenic
965356029 3:167673873-167673895 TCCGGAAAAGTAGAGCATCCTGG + Intergenic
965395927 3:168160432-168160454 TTGGGATAAGGGGAGAATAAAGG + Intergenic
966075437 3:175931378-175931400 TTGGGTAAAAGAGAGCATTCTGG + Intergenic
966424897 3:179770815-179770837 TCGGGAAATGGAGACCATCCTGG - Intronic
967343608 3:188428087-188428109 ATGGGAAAAGGGTAGTATCTGGG + Intronic
967371007 3:188745989-188746011 ATGGGAAAAGGGGAACATGCAGG - Intronic
968879165 4:3290327-3290349 TTGGGAAGATGGAAGCATTCTGG - Intergenic
969134794 4:5020969-5020991 AGGAGGAAAGGGGAGCATCCTGG + Intergenic
969348891 4:6586692-6586714 TTGGGAAGAGGAGAACATTCTGG + Intronic
969459939 4:7323747-7323769 CTGGGAAATGGGGAGAATCCAGG - Intronic
969593455 4:8134668-8134690 ATGGGAAAAGGGGGCCTTCCTGG - Intronic
970509572 4:16767952-16767974 TTGGGAACAGGAGAGAATCTAGG - Intronic
970606464 4:17686436-17686458 TTGGGTTAAGGGGAGCAGCCAGG - Intronic
971235112 4:24834559-24834581 TTAGGAAACGGGGAACATTCTGG + Intronic
971311076 4:25526146-25526168 GTGGGAAAAGGGAAAGATCCGGG + Intergenic
972335065 4:38100492-38100514 TTGGGAGGAGGAGAGCATCCTGG - Intronic
973051803 4:45607700-45607722 TAGGGAAAAGGAGACCGTCCTGG - Intergenic
974125872 4:57694468-57694490 TTGGGAAAGTAGGAGGATCCAGG + Intergenic
975764621 4:77654706-77654728 GTGGGAAAAGTGGAGTATCTGGG - Intergenic
976616072 4:87078544-87078566 TTGGGAGTAAGGGAGCATCAGGG + Intronic
976681391 4:87760010-87760032 TGGGGAAAAGAGGAAAATCCAGG - Intergenic
976963259 4:91004243-91004265 TTGGGAAAAGGGGAACATTACGG - Intronic
977371612 4:96144493-96144515 TTGGGAAGAGGGGAGCACTGTGG - Intergenic
978819335 4:112947390-112947412 TTTGGAAAAGCGAAGCATGCAGG + Intronic
979022925 4:115525458-115525480 ATGGGAAAAGGGTAGTATCTGGG + Intergenic
979310503 4:119197933-119197955 TTGGGAAAAGGGCAGTATTTGGG - Intronic
981098153 4:140802788-140802810 TTGTGACAAGGAGATCATCCTGG - Intergenic
982487068 4:155978689-155978711 TTGGGAGATGGAGACCATCCTGG + Intergenic
982649665 4:158072014-158072036 TTAGAAAAAGAGGAGCATCTTGG + Intergenic
983949513 4:173622732-173622754 ATGGGAAAAGGGTAGTATCTGGG + Intergenic
984644355 4:182203630-182203652 TTGGGAAAGAGGGAGGATACAGG - Intronic
985925930 5:3019096-3019118 TTGTGAAACGGGGAGCAATCTGG + Intergenic
986838869 5:11672778-11672800 TTGGGAAAAGGGCAGTATCTGGG + Intronic
988719147 5:33858977-33858999 ATGGGAAAAGTGTAGCATCTGGG - Intronic
990020696 5:51123931-51123953 TTGGGGAAATGGAAGCATTCTGG + Intergenic
992740681 5:79770476-79770498 ATGGGAAAAGCGTAGTATCCGGG + Intronic
993413928 5:87602283-87602305 TTGGGAAAAGGGCTAAATCCAGG - Intergenic
994267015 5:97729287-97729309 TCGGGAAATGGAGACCATCCTGG + Intergenic
996426678 5:123320502-123320524 GTGGGAAAAGTGTAGTATCCAGG + Intergenic
996929504 5:128869239-128869261 TTGGGAAAAGAGGAGAGTCAAGG - Intronic
997596208 5:135108979-135109001 TGGGTTACAGGGGAGCATCCTGG - Intronic
998927544 5:147142724-147142746 ATGGGAAAAGTGTAGTATCCAGG + Intergenic
999995536 5:157088898-157088920 TTGGGAAAAGGTGAGAATCTTGG - Intronic
1000297656 5:159926286-159926308 TGGGGAAAAGGGTGGGATCCAGG - Intronic
1002673475 5:180889665-180889687 TTGGGAAAAGTGTAGTATCTGGG - Intergenic
1002712978 5:181206004-181206026 TCGGGAAGGAGGGAGCATCCGGG - Intergenic
1006181078 6:32153842-32153864 TTGGGAAGTGGGGAGAATCAAGG + Intronic
1008683992 6:53903905-53903927 TGGGAGAAAGGTGAGCATCCTGG - Intronic
1010400129 6:75439153-75439175 GTGAGAAAAGGAGACCATCCTGG + Intronic
1010484163 6:76389949-76389971 TTGGGAAATTGAGACCATCCTGG - Intergenic
1011301505 6:85879079-85879101 TTGGGAAAAGTGTAGTATCTGGG + Intergenic
1011510892 6:88099566-88099588 TCGGGAAATCAGGAGCATCCTGG + Intergenic
1012431691 6:99170847-99170869 TGGGGAATAGGGCAGCATCTGGG - Intergenic
1012701098 6:102458577-102458599 GTGGGAAAAGTGTAGTATCCCGG - Intergenic
1013428034 6:110032765-110032787 TTGGGAATAAGGCAGCTTCCTGG - Intergenic
1013452933 6:110303129-110303151 ATGGGAAAAGCGTAGTATCCGGG - Intronic
1013860868 6:114633829-114633851 TTGGGAAAAGTGCAGTATTCAGG + Intergenic
1014069190 6:117161522-117161544 TTGAGAAATGCGCAGCATCCTGG - Intergenic
1014223604 6:118823280-118823302 ATGGGAAAAGCGTAGTATCCAGG + Intronic
1014283379 6:119466421-119466443 TTGAGATAAGGAGATCATCCTGG + Intergenic
1017029520 6:150208365-150208387 TGGGGATAAAGGGAGGATCCTGG - Intronic
1017995570 6:159529115-159529137 TTGGGGAAAAGGGAACATCATGG + Intergenic
1018380452 6:163253984-163254006 TTGGGGACAAGGGAGGATCCAGG + Intronic
1018807156 6:167270487-167270509 TAGGGGAAAGGGGAGCCTTCCGG + Intergenic
1020110781 7:5446765-5446787 TTGGGTAAAGGGGGGCATGGTGG - Intronic
1021574274 7:22093385-22093407 TTAGGACAGGGAGAGCATCCAGG - Intergenic
1021797183 7:24268016-24268038 TGGGGAAAAAGGGAGCATATTGG - Intergenic
1022030383 7:26487181-26487203 TTGGGAAACGGGGAGGAGCCTGG - Intergenic
1023043899 7:36195229-36195251 GTGGGGAAGGGGGAGCATGCGGG + Intronic
1026570479 7:71525415-71525437 TTGGGAGATGGAGACCATCCTGG - Intronic
1027434991 7:78155287-78155309 GTGAGAACAGGGAAGCATCCTGG - Intronic
1029553842 7:101253760-101253782 TTAGCAAAAAGGGAGCATGCTGG - Intergenic
1029988720 7:104943953-104943975 GAGGGAAAAGGCGAGCAGCCAGG - Intergenic
1030030203 7:105362394-105362416 TTGGGAGATGGAGACCATCCTGG + Intronic
1030486254 7:110172062-110172084 TTGGGAAAAGGGTAGCACTAGGG - Intergenic
1030686545 7:112492805-112492827 TGGGGAAAAGGGGAGAATCTTGG + Intergenic
1031967467 7:128037405-128037427 TTGAGATAAGGAGATCATCCTGG - Intronic
1038319325 8:26513611-26513633 ATGGGAAAAGGGGACAAGCCGGG - Intronic
1039182359 8:34880638-34880660 TTGTGACAAGGGGAGCCTACAGG + Intergenic
1040520155 8:48169558-48169580 TTGGGAAAAGCGTAGTATCTGGG + Intergenic
1041817780 8:61994585-61994607 ATGGGAAAAGTGCAGCATTCGGG - Intergenic
1042515687 8:69656454-69656476 TTGGGAGAAAGAGAGCATCAGGG - Intronic
1042955819 8:74249711-74249733 TTAAGAAAAGGGAAGCATCCTGG - Intronic
1045134522 8:99200043-99200065 CTGGGAAAATGGGAGGCTCCAGG - Intronic
1045392080 8:101725691-101725713 TTGTGAGATGGGGAGCATGCAGG - Intronic
1045392975 8:101733521-101733543 TAGGGAAAAGGTCAGCATCATGG + Intronic
1045439746 8:102197700-102197722 TGGGGACCAGGGGAGCAGCCAGG + Intergenic
1045773409 8:105772309-105772331 ATGGGAGAAGGTGAGCATACAGG + Intronic
1048047970 8:130791239-130791261 CAGGGAAAAGGGGAGAATGCTGG + Intronic
1048071424 8:131025817-131025839 TTGAGAAAAGTGAGGCATCCAGG - Intronic
1049051637 8:140201781-140201803 ATGGGAAAAGGGGAGCAGCCAGG + Intronic
1050425020 9:5503658-5503680 TGGGGAGAATGGGAGCAACCTGG + Intergenic
1050550055 9:6741184-6741206 TCAGGAGAATGGGAGCATCCTGG + Intronic
1051230404 9:14949700-14949722 ATGGGAAAAGGGTAGTATCTGGG - Intergenic
1051259430 9:15248019-15248041 TTTGGAAAATGGGAGCATTAAGG + Intronic
1051502960 9:17797889-17797911 GTGGGAATAGGGGAGCAGCAAGG + Intergenic
1053073777 9:35116076-35116098 CTGGGAAAAGCTGAGGATCCTGG - Intronic
1053445448 9:38149791-38149813 TTGGGAATGGAGGAGCATCCGGG + Intergenic
1053823596 9:41995522-41995544 TTGGGAAATCGAGACCATCCTGG + Intronic
1054606977 9:67191844-67191866 TTGGGAAATCGAGACCATCCTGG - Intergenic
1056003586 9:82243176-82243198 TTGGGAAAAGCGTAGTATCTGGG + Intergenic
1058755607 9:108080368-108080390 TTGGGAACAGAGAAGCATGCTGG - Intergenic
1060812729 9:126619096-126619118 TTGGCAGCAGGGGAGCATCGAGG + Intronic
1061361429 9:130144799-130144821 GTGGGGAGAGGGAAGCATCCAGG - Intergenic
1203787584 EBV:136575-136597 GTGGGAAAAGGGGGGCAGCGGGG - Intergenic
1185633541 X:1535089-1535111 TGGGAAAAGGGGCAGCATCCTGG + Intronic
1186843856 X:13511690-13511712 TTGGGGAAAGAGGAACACCCAGG + Intergenic
1187118837 X:16383657-16383679 ATGGGATTAGGGGAGTATCCTGG + Intergenic
1188211267 X:27428039-27428061 TTTAGAGAAGGGAAGCATCCAGG - Intergenic
1188562340 X:31483255-31483277 TTGGGAGATGGAGACCATCCTGG - Intronic
1189958984 X:46307069-46307091 ATGGGCAAAGGGGAGCAAACTGG + Intergenic
1191839598 X:65502181-65502203 TGGGGGAAATGGGAGGATCCTGG - Exonic
1194232578 X:91342206-91342228 TTAGGAAAACAGGAGCATCGGGG + Intergenic
1194637312 X:96361868-96361890 TTGTGAAAAGGTGACCATACTGG - Intergenic
1195365220 X:104117757-104117779 TTGAGAAAAGGTGAGCAGCAAGG - Intronic
1195519309 X:105812626-105812648 ATGGGAAAAGAGTAGTATCCTGG + Intergenic
1196925567 X:120630249-120630271 TTGGGTAAAGGAGAGCGTCCGGG - Intergenic
1197350187 X:125372925-125372947 GTGGGAAAAGTGTAGTATCCGGG + Intergenic
1198521801 X:137460607-137460629 TTGGGAATAGGGGAGGAGCAGGG + Intergenic
1199794712 X:151183064-151183086 GTGGGGAGAGGGGAGCATGCTGG + Intergenic
1199801155 X:151252682-151252704 GTGGGAAAAGCGTAGCACCCAGG - Intergenic
1202090960 Y:21188982-21189004 TTAGGAAATGGAGACCATCCTGG - Intergenic
1202343111 Y:23889745-23889767 TTGGGAAAAGTGCAGCATTTGGG - Intergenic
1202527657 Y:25780340-25780362 TTGGGAAAAGTGCAGCATTTGGG + Intergenic