ID: 925182752

View in Genome Browser
Species Human (GRCh38)
Location 2:1827506-1827528
Sequence TGGGAAAAGGGGAGCATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925182738_925182752 25 Left 925182738 2:1827458-1827480 CCCTCTGCCTAGAAGGGGATCTC 0: 1
1: 0
2: 1
3: 14
4: 210
Right 925182752 2:1827506-1827528 TGGGAAAAGGGGAGCATCCAGGG 0: 1
1: 1
2: 2
3: 23
4: 292
925182740_925182752 18 Left 925182740 2:1827465-1827487 CCTAGAAGGGGATCTCAGAGAGT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 925182752 2:1827506-1827528 TGGGAAAAGGGGAGCATCCAGGG 0: 1
1: 1
2: 2
3: 23
4: 292
925182739_925182752 24 Left 925182739 2:1827459-1827481 CCTCTGCCTAGAAGGGGATCTCA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 925182752 2:1827506-1827528 TGGGAAAAGGGGAGCATCCAGGG 0: 1
1: 1
2: 2
3: 23
4: 292
925182737_925182752 28 Left 925182737 2:1827455-1827477 CCACCCTCTGCCTAGAAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 925182752 2:1827506-1827528 TGGGAAAAGGGGAGCATCCAGGG 0: 1
1: 1
2: 2
3: 23
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925182752 Original CRISPR TGGGAAAAGGGGAGCATCCA GGG Intronic
900789297 1:4668749-4668771 TGGGAGACGGGGCACATCCAGGG + Intronic
901653250 1:10755128-10755150 TGGGAACGTGGCAGCATCCAGGG + Intronic
901827143 1:11869688-11869710 TGGGGAGAAGGGAGCATCCCAGG + Intergenic
902097732 1:13960458-13960480 TGGGAAAACGGCACCTTCCAAGG - Intergenic
902678911 1:18029439-18029461 TGAGAGAAAGGGAGCATCCCAGG - Intergenic
902725705 1:18334742-18334764 TGGGAGGAGGGGAGCATTTATGG - Intronic
903462098 1:23527291-23527313 TGGGAAAAGGGGAAAGTTCAAGG + Intronic
904259388 1:29279726-29279748 AGGGAAATGGGGGGCATCCTGGG + Intronic
905141008 1:35844404-35844426 TGAAAAAACGGCAGCATCCAAGG - Intronic
905209143 1:36361465-36361487 TGCTACCAGGGGAGCATCCAAGG + Intronic
905404981 1:37726500-37726522 GGGGAGAAGGGGAGGATACATGG + Intronic
905476996 1:38236013-38236035 AAGGAGAAGGGGAGCATTCAGGG - Intergenic
906224812 1:44112929-44112951 AATGAAAAGGGGAGCATCTAAGG - Intergenic
906535289 1:46547939-46547961 TGGGGAGAGGGGAGCATCCCAGG + Intronic
906645324 1:47470459-47470481 TGGGGACAGGGGTGCATCCTGGG + Intergenic
907868267 1:58419699-58419721 TGGGAGAAAGGGAGAAGCCAGGG + Intronic
909493189 1:76247998-76248020 TGGGAAAAGCGTAGTACCCAGGG + Intronic
910132315 1:83922889-83922911 TTGGAACAGGGGAGCAACAAAGG + Intronic
910555021 1:88522103-88522125 TGGGTAAAGGGGAGAATGAAAGG - Intergenic
911042364 1:93600788-93600810 TGGGAACTGGGGAACAGCCAGGG + Intronic
912433130 1:109640209-109640231 TAGGAAAAGGTGAGCCTCCTGGG + Intergenic
912515451 1:110213884-110213906 TGGGGAAAGGGGACAAACCAGGG + Intronic
913228798 1:116723869-116723891 TAGGACAAGGGAAGCTTCCAGGG - Intergenic
913387112 1:118270258-118270280 TAGGAAAAAAGGAGCAACCATGG - Intergenic
917586034 1:176426845-176426867 TAGGAAAAGGGCTGAATCCAGGG - Intergenic
919004997 1:191886829-191886851 TGGGGAAAGGGAAACATTCAGGG + Intergenic
919633392 1:199980855-199980877 TGGGAAAACGGGAGCTTGGATGG - Intergenic
919788081 1:201272875-201272897 TGGGAAAAGTGAAGCGGCCATGG - Intergenic
920525867 1:206665758-206665780 TGGCAAGAGGGGTGCCTCCAGGG + Intronic
920541905 1:206785076-206785098 TGGGAAAAGGCGAGCAGGCAGGG + Intergenic
921006758 1:211101172-211101194 AGGGGAACGGGCAGCATCCACGG - Intronic
921884745 1:220294322-220294344 TGTGAAAAAGGGATCATCAATGG + Intergenic
921894795 1:220388751-220388773 TGGGAAAAGAGAACAATCCAGGG - Intergenic
922399664 1:225239149-225239171 TAGGAAAAGGGCTGGATCCAGGG - Intronic
923021349 1:230166704-230166726 TGGGAAAAGGGAAGAAAGCAAGG - Intronic
923298647 1:232619814-232619836 TGGGATAAGGGGTTCTTCCATGG - Intergenic
1064878679 10:20024708-20024730 TGGGAAAAGGTGGGGATCAAGGG - Intronic
1066630426 10:37454382-37454404 TGGGAGGTGGGGAGCATCCACGG - Intergenic
1067238626 10:44472176-44472198 AGGGCAAAGGGAAGCATCAAAGG - Intergenic
1070388948 10:75952031-75952053 TGGGAAGAGGAAAGCCTCCATGG + Intronic
1070796289 10:79218808-79218830 AGGTAGAAGGGGAGCATGCACGG + Intronic
1071515567 10:86294537-86294559 TGGGAAGAGGGGAGAGTGCAGGG + Intronic
1075086893 10:119419694-119419716 TGGGAGAAGGGGATTGTCCAGGG - Intronic
1075296348 10:121279049-121279071 TGGGCAAAGGGAATAATCCAAGG - Intergenic
1075502003 10:122983492-122983514 CTGGCACAGGGGAGCATCCAGGG - Intronic
1077660748 11:4066400-4066422 GGAGAAAAGGGGAGAATGCAGGG - Intronic
1080884753 11:36356425-36356447 TGAGAAAAGGGAAGCCTCCAGGG + Intronic
1081689696 11:45069473-45069495 TGGGTAAAGCAGAGCATCCAGGG - Intergenic
1081706353 11:45184015-45184037 TGGGAAAAAGTGAACAACCAGGG + Intronic
1081788640 11:45767040-45767062 CGGGAGAAGGGGAGCATCTTGGG - Intergenic
1082306247 11:50579929-50579951 GGGGAAAAAGGGAACATCAAAGG - Intergenic
1082573234 11:54768352-54768374 TGCGAAAAAGAGAACATCCATGG + Intergenic
1082782087 11:57295680-57295702 TGGTAAAAGGAGAGCATCCTGGG - Intergenic
1083360984 11:62107957-62107979 TGGGTAAAGGGTAAAATCCAGGG + Intergenic
1084665584 11:70574517-70574539 TGTGAAAATGGGAGGAGCCATGG - Intronic
1085335253 11:75688365-75688387 TGGGAAAAGTGTAGAATCCCAGG + Intergenic
1087696906 11:101389721-101389743 TAGGAAAAGAGGATCATGCAGGG - Intergenic
1088704459 11:112448957-112448979 TGGGAAAGGGGGAACAAACAGGG - Intergenic
1089380920 11:118030818-118030840 TGGGATTAGGAGGGCATCCATGG + Intergenic
1089536500 11:119163589-119163611 TGGGAAGAGAGGAGAAGCCAAGG - Intergenic
1090021640 11:123133848-123133870 TGGGAAAAGGGTATGATCTAAGG - Intronic
1091030449 11:132182726-132182748 TAGGAAATGAGGACCATCCAAGG - Intronic
1091268364 11:134288270-134288292 TGGGAAGAGGGGAACATTCCTGG + Intronic
1095281537 12:40357066-40357088 TGGGAGAAGGGGAGGATGAAGGG - Intronic
1095749780 12:45697329-45697351 TGGGAGAAGGGGGGCTTCCCGGG + Intergenic
1095773206 12:45985382-45985404 TGGGGTAAGGGGTGCATCCCAGG - Intronic
1097970979 12:65632737-65632759 TTGTAAGAGGGGAGCATCCAAGG - Intergenic
1098381414 12:69873631-69873653 TGGAAAAAGGGGATGATTCATGG + Intronic
1098658894 12:73068369-73068391 TAGGAAAATGGCAGAATCCAGGG - Intergenic
1098863277 12:75733332-75733354 TGGGAGATGGGGAGCAAACAAGG - Intergenic
1098960192 12:76731895-76731917 GTGGAAAAGGGGAGGCTCCATGG - Intergenic
1100014883 12:89997046-89997068 TAGATAAAGGGGAGCATCTATGG + Intergenic
1100037794 12:90274861-90274883 GGGGAAAAGGAGAGCTACCAAGG - Intergenic
1101055199 12:100905295-100905317 TGGGGAAGGGAGAGCATCAAGGG + Intronic
1101249450 12:102917427-102917449 TGGGTAAAGGGAAGAAGCCAGGG + Exonic
1101584948 12:106077563-106077585 TGGGAAAAGGAAAGGATTCAGGG + Intronic
1101721670 12:107355565-107355587 TTGGAAAATTGGAGCATTCAAGG - Intronic
1102044419 12:109821011-109821033 TGGAAAAAGGGGCCCATCCTCGG + Intronic
1104070902 12:125344591-125344613 TAGGAAGAGGGGAGAACCCAGGG - Intronic
1105456364 13:20544773-20544795 TAGGCAAAGGGGAACATCAAGGG + Intergenic
1105634321 13:22202762-22202784 GGGGACAAGGGAAGCATACATGG - Intergenic
1106586793 13:31064308-31064330 TGGGAAGAGGTGGACATCCATGG + Intergenic
1107697635 13:43015981-43016003 TAAGGAAAGGGGAGGATCCAAGG - Intergenic
1108839029 13:54589188-54589210 TGGGAGAAGGGGAACAGCAATGG - Intergenic
1110701571 13:78554762-78554784 TTGGAAAAGAGAAGCATCCCAGG + Intergenic
1111930509 13:94508457-94508479 TGGGGAAAGGGGAGTAGGCATGG + Intergenic
1112106483 13:96245886-96245908 TGGGAATAGGGGAACATCCTGGG + Intronic
1114265296 14:21069993-21070015 CGGGAAAAGAGGGGCATCCTCGG + Intronic
1114534058 14:23412078-23412100 TGGGAAGAAGGGAGCACCCTGGG + Intergenic
1115145299 14:30219312-30219334 CTGGAAAAGAGAAGCATCCATGG - Intergenic
1117546397 14:56797776-56797798 GGGGAAAAGGGGATGAGCCAAGG + Intergenic
1117829085 14:59732784-59732806 TAGGAAAAGGGCAGAATCCAGGG + Intronic
1121325275 14:93016162-93016184 TGGGGAGAGGGAAGCAGCCAAGG + Intronic
1122130636 14:99603111-99603133 TGGGAAAAGGGCTGCAGCCAGGG + Intronic
1124008992 15:25820239-25820261 TGGGAAAAGGGGTTTGTCCACGG + Intronic
1124103629 15:26717530-26717552 TTGGACAAGGGGAGAATTCAGGG - Intronic
1127631852 15:60834827-60834849 GGGGAAAAGGGGAACAAGCAAGG - Intronic
1127697810 15:61469032-61469054 TGGGAAAAGGGGAGCAGGCAAGG + Intergenic
1129940929 15:79496016-79496038 TGGGAAAAGAGAAGCTTCCCTGG + Intergenic
1130039866 15:80397472-80397494 TGGGGAATGGGGAGCAACTATGG + Intronic
1131829690 15:96346051-96346073 TGGGAAAGGGGGAGCTGCCTAGG + Intergenic
1133590077 16:7233639-7233661 TGTTGAAAGGGCAGCATCCAGGG - Intronic
1134477462 16:14588264-14588286 TGGAAAAAGGAGAGCAACAAGGG + Intronic
1135534655 16:23283990-23284012 TGGGACAAGGGGAGGAGCCAGGG - Intronic
1135653200 16:24225180-24225202 TGGGAACAGGGGACCATCTCTGG - Intergenic
1136738478 16:32487711-32487733 TGGAAAAAGGGGAATATCCCAGG + Intergenic
1140378209 16:74462391-74462413 TGGGAAAACGGGAGCAAGCTAGG + Intronic
1141184999 16:81780357-81780379 TGAGAATCGGGGCGCATCCATGG + Intronic
1203014734 16_KI270728v1_random:344081-344103 TGGAAAAAGGGGAATATCCCAGG - Intergenic
1203033069 16_KI270728v1_random:617240-617262 TGGAAAAAGGGGAATATCCCAGG - Intergenic
1142637449 17:1266937-1266959 TGGGGAGAAGGGAGCCTCCATGG - Intergenic
1142751477 17:1990964-1990986 GGAGAAAATGAGAGCATCCAGGG + Intronic
1142954634 17:3513326-3513348 GGGGAAAAGGAGACCATCCTTGG - Exonic
1143524403 17:7463659-7463681 TGGAGAAAGGGGAGCCTCCGGGG + Exonic
1144490125 17:15701161-15701183 TTGGAAATGGGGAGAATCCTGGG - Exonic
1144641820 17:16941414-16941436 TGGGATAAGGAGAACTTCCAAGG - Intronic
1144910838 17:18680798-18680820 TTGGAAATGGGGAGAATCCTGGG + Exonic
1146884395 17:36461532-36461554 TGGGAAACGGGGACCATTCCAGG + Intergenic
1147041328 17:37721593-37721615 TGGGAAAAGAGAAGCAGCCGGGG - Intronic
1147413792 17:40273826-40273848 TGGGGGAGGGGGAGCATCCCTGG - Exonic
1148469066 17:47882411-47882433 AGGGAAATGGGGAGCAGCCTCGG - Intergenic
1148973460 17:51505515-51505537 TGGGAAAAGGGGAGGAAGTAGGG - Intergenic
1149530863 17:57394170-57394192 TGGAAAAAGGGGAGGATTGAGGG - Intronic
1150601012 17:66651037-66651059 TGGGAGAAGGGGAGCCTCAGTGG + Intronic
1151097214 17:71511951-71511973 TGGGCAAAGGGCAGAAGCCATGG + Intergenic
1151559950 17:74864698-74864720 TGGAAGAAGGGGAGCAGTCAGGG - Intronic
1155049629 18:22135256-22135278 TGGGTAAAGGGGAGAATCAGAGG + Intergenic
1155566422 18:27140242-27140264 AGGGATAAGGGGCGTATCCAAGG - Intronic
1155761790 18:29576952-29576974 ATGGAAAAGTGGAGCAGCCACGG + Intergenic
1156367448 18:36442140-36442162 TGGGAGAAGGGGAGCAGGGAGGG - Intronic
1156657202 18:39302878-39302900 TAGTAAAATGAGAGCATCCAAGG - Intergenic
1157709222 18:49837769-49837791 TTGGAAAATGAGAGCATTCAGGG - Exonic
1158667956 18:59449815-59449837 GGGGAATAGGGGAGCATCTCTGG - Intronic
1159010723 18:63057051-63057073 TGGGAAGAGGGCAGCATGCTGGG - Intergenic
1159349968 18:67259656-67259678 TGGGGAATGTGGAGCATCCCAGG + Intergenic
1162138484 19:8570910-8570932 TCGGAAAATGGGAACATCGAGGG + Intronic
1162565638 19:11444801-11444823 TGGGAGATGGGGAGGATACAGGG - Intronic
1162788932 19:13053222-13053244 CGGAAAAAGGGCAGCACCCAAGG - Intronic
1162888233 19:13712482-13712504 TTGGAAATGGGGAGCATCTGGGG - Intergenic
1163818608 19:19483174-19483196 TGGGGAAAGGAGAGCAGGCAGGG + Intronic
1164236860 19:23345204-23345226 AGGGAAAAGGGGACCATCCTGGG - Intronic
1164261224 19:23570006-23570028 TGGGAAATGGTGAGTATGCAGGG - Intronic
1166223986 19:41383727-41383749 TGGGCCAAGGGGGACATCCAGGG + Exonic
1166375057 19:42323402-42323424 AGGGAAAAGGTGAGGGTCCAGGG + Intronic
1166783018 19:45352126-45352148 TGGGGAGTGGGGAGAATCCAAGG + Intronic
1167386230 19:49165843-49165865 TGGGGAAAGGGGACCGTCCTCGG + Intronic
1167514807 19:49917046-49917068 TGGGGAAAGGGGAGGTCCCACGG - Intronic
1167743742 19:51339466-51339488 TGGGAAAAGGGGAGGCTTCTCGG - Intronic
1168071936 19:53958372-53958394 TTGGGAAAGGGGAGCATTCCTGG + Intergenic
925182752 2:1827506-1827528 TGGGAAAAGGGGAGCATCCAGGG + Intronic
925381638 2:3431405-3431427 TGGGTAAAGGCTGGCATCCATGG - Intronic
925582460 2:5425150-5425172 TCGTAAGAGTGGAGCATCCACGG - Intergenic
927200322 2:20574446-20574468 TGGGAAAAAGGAGGCAGCCATGG - Intronic
928136725 2:28693489-28693511 TGGGAGGAGGGGAGAAGCCAGGG - Intergenic
928732728 2:34251402-34251424 TGGGAAAATGAGGACATCCAAGG - Intergenic
929460190 2:42097657-42097679 TGGGAAAGGAGGACCTTCCAGGG - Intergenic
929924114 2:46195215-46195237 TTGGAAAGGGGGAGCAGCTAGGG + Intergenic
932371403 2:71191713-71191735 TGGGAAAGGGAGAGCACCAAAGG - Intronic
933608317 2:84407431-84407453 TGGGAAACGGGGGGATTCCATGG - Intergenic
936812011 2:116413654-116413676 AGGGAGAAGGGTAGCATGCAGGG - Intergenic
937683509 2:124669758-124669780 TGGGAAAAAGAGAGGAACCAAGG - Intronic
938683754 2:133717189-133717211 TAGCAAAAAGGGAGCATCTAGGG + Intergenic
939175322 2:138741209-138741231 TGGGACCAGGGAAGCATGCAGGG + Intronic
941729036 2:168895523-168895545 TGGGGAAATGGGAGGATCCTGGG + Intronic
942533003 2:176932989-176933011 TGGGAAACGGGGAGTGTTCATGG - Intergenic
943459407 2:188152739-188152761 TGGCAGAAGTGCAGCATCCATGG + Intergenic
944326149 2:198406236-198406258 TGGGAGAACGAGAGCCTCCAGGG + Intronic
945052258 2:205835227-205835249 TGGGAAATGGGGTGCATCAGGGG + Intergenic
946832104 2:223737440-223737462 TGGGAAAAGGGCAGGGCCCAGGG - Intergenic
947144110 2:227048571-227048593 TGGGAAAAAGTGAGAAACCATGG + Intronic
947807054 2:232976301-232976323 TGTGAAATGGGGAGCATGGAGGG + Intronic
948247585 2:236499407-236499429 TGGGAAAGGGAGAGCAGGCATGG - Intronic
1168802127 20:650372-650394 TGGCAGAAGGGGTGAATCCAAGG + Intronic
1169694721 20:8374471-8374493 TGTGCAGAGGGTAGCATCCAAGG - Intronic
1170210303 20:13840783-13840805 TGGGAAGAGGGGAGGAAACAGGG + Intergenic
1171080453 20:22177299-22177321 TGGGAAAGGAGGAGGAGCCAGGG - Intergenic
1171085989 20:22238949-22238971 TGGGAAAAGTGGGGCAGGCATGG + Intergenic
1171174612 20:23042070-23042092 TGGGAAAAGGGGAGGAATTAGGG + Intergenic
1172285260 20:33735819-33735841 TGGGAGAAGGGGAGGATTTAGGG - Intronic
1173002926 20:39118395-39118417 AGTGAACAGGGGAGCCTCCACGG + Intergenic
1173010268 20:39175854-39175876 TGAGCAAAGGGGACCATCCAAGG - Intergenic
1173106660 20:40143519-40143541 TGTGAAAAGGGGAAAAACCATGG + Intergenic
1173540580 20:43848035-43848057 TGGGCAAGAGGGAACATCCAGGG + Intergenic
1175053575 20:56177454-56177476 GGGGATCAGGGGAGCATCCGGGG + Intergenic
1175578041 20:60077517-60077539 TGGGCAAAAGGGAGCCTCAAGGG - Intergenic
1176266565 20:64212362-64212384 TGGGAGAAGGGTAGCACACAGGG - Intronic
1177665068 21:24145960-24145982 TTGCAAAAGTGAAGCATCCAAGG + Intergenic
1177769474 21:25498334-25498356 GGAGAAAAGGGGAGCAGGCAGGG + Intergenic
1178234185 21:30822512-30822534 TGGGAAAAGGAGAGCACCCTGGG + Intergenic
1178893589 21:36541054-36541076 TGAGAAAAGAGGAGAAACCAAGG + Intronic
1179954080 21:44728157-44728179 TGGGAACAGTGGAGCCTGCATGG + Intergenic
1180641875 22:17305369-17305391 AGAGAAAAGGGGAGCCTCCCTGG - Intergenic
1180699028 22:17771839-17771861 TGGGAAAGGGGAAGCTTCCGGGG - Intronic
1180842826 22:18967245-18967267 TGGGAAGAAGGGACCTTCCAAGG + Intergenic
1181142520 22:20816923-20816945 CAGGAAAAGGGAAGCCTCCAAGG + Intronic
1182250149 22:28993615-28993637 TGGGAGAGGGGGAGCATGTAAGG + Intronic
1182310042 22:29397941-29397963 TGGGAAGTGGGAAGAATCCATGG + Intronic
951583658 3:24192794-24192816 TGGGAAAAGGGCTTCATTCATGG + Intronic
951825466 3:26863617-26863639 TGGGAAGAAGGGAGAAGCCAGGG - Intergenic
952123207 3:30268846-30268868 TTGGAGAAGGAGAACATCCAAGG - Intergenic
953288373 3:41635977-41635999 ATGGAAAATGGGACCATCCAGGG - Intronic
954374623 3:50187859-50187881 TGGGAAGAGGGCAGCATGGACGG - Exonic
955999558 3:64714726-64714748 TGGGGGAAGGGGTGCATTCATGG - Intergenic
956138241 3:66119964-66119986 TGAGAAAAAGAGAGCATGCAAGG + Intergenic
956778912 3:72589110-72589132 TGCTAAGAGGGGAGCATCAAGGG + Intergenic
957597498 3:82287169-82287191 TGGGAAATTGGGAGGAGCCAGGG + Intergenic
958159028 3:89792297-89792319 TGTGAAAAGGAGAGAATGCAAGG - Intergenic
958584555 3:96069452-96069474 TGGGATAAGGGGGACTTCCAGGG + Intergenic
959685392 3:109140439-109140461 TGGGAGAAGGGGTGGACCCACGG - Intergenic
960827130 3:121800554-121800576 TGGGACAGGGTGAGCATCCTAGG - Intronic
961810668 3:129519817-129519839 TGGGAGGAGGGGCACATCCATGG + Intronic
961908051 3:130283116-130283138 AGGGAAAAGAGGAGAAACCAGGG + Intergenic
962051034 3:131815762-131815784 TGGGGAAAGGGGAACAAACAAGG + Intronic
963730896 3:148970957-148970979 TGGGAAAATGTGAGCATGCCAGG - Intergenic
966706423 3:182920806-182920828 TGAGAAAAGGGGAGAATTTATGG + Exonic
968656213 4:1779519-1779541 TGGGGAGAAGGGGGCATCCATGG + Intergenic
969134795 4:5020970-5020992 GGAGGAAAGGGGAGCATCCTGGG + Intergenic
969459938 4:7323746-7323768 TGGGAAATGGGGAGAATCCAGGG - Intronic
971423388 4:26493669-26493691 TGGGAAGGGATGAGCATCCAGGG + Intergenic
972969331 4:44553098-44553120 TAGCAAAAAGGGAGCATACATGG - Intergenic
976264656 4:83179137-83179159 TAGGAAAAGGGCAGCATCCTAGG + Intergenic
976681390 4:87760009-87760031 GGGGAAAAGAGGAAAATCCAGGG - Intergenic
976872877 4:89817094-89817116 TGGGAAAAAGGGAGCAGCTGTGG - Intronic
978118389 4:105049700-105049722 TGGGAAAGGGGCTGAATCCAGGG + Intergenic
978857090 4:113405504-113405526 TGGGAAAAGAGAAGAAACCAGGG - Intergenic
980134923 4:128849577-128849599 TTGGAAATGGGGAGCATGCCTGG - Intronic
981724132 4:147830075-147830097 TGGGGAAAGGGGTGCAGCCGTGG - Intronic
981777426 4:148386019-148386041 AGGGATAAGGGGAGGACCCAAGG + Intronic
985961889 5:3308837-3308859 AGGGGAAAGGGGAGGCTCCAGGG - Intergenic
986256331 5:6103910-6103932 TGGAAAAAGGGTCACATCCATGG + Intergenic
987170049 5:15245725-15245747 TGGGAAAAGGGGAGAAAGGAAGG + Intergenic
990494287 5:56331781-56331803 TGGAAACTGGGGAGCACCCATGG - Intergenic
993413927 5:87602282-87602304 TGGGAAAAGGGCTAAATCCAGGG - Intergenic
996426679 5:123320503-123320525 TGGGAAAAGTGTAGTATCCAGGG + Intergenic
997217900 5:132129611-132129633 CGGGAAAAGTGTAGTATCCAGGG + Intergenic
997351877 5:133236725-133236747 TGGGAGGAGGGGAGCATGCCTGG - Intronic
997374803 5:133390137-133390159 TGGAAAAAAGGGCTCATCCAGGG - Intronic
1000133039 5:158318528-158318550 TTGGAAAAGGTGAGCATTCTAGG - Intergenic
1003502467 6:6713747-6713769 TGGGAAGAGTGCTGCATCCACGG + Intergenic
1005583359 6:27253209-27253231 TGGGGAAAGGGGGCCATCCCTGG - Intronic
1005963062 6:30707047-30707069 TGGGAAAAAGGTAGCTTCCCAGG - Intronic
1006316822 6:33296327-33296349 TGGGAGAAGGGAATCAGCCAAGG + Intronic
1007113139 6:39325121-39325143 TAGGAACTGGGGAGCAGCCAGGG + Intergenic
1007666350 6:43515668-43515690 TGGGAAAAGACAAGCCTCCAGGG - Exonic
1007894484 6:45338800-45338822 TGAGACAAGGGAGGCATCCAGGG + Intronic
1008654813 6:53601208-53601230 TGGGAGAAGGGGAGAAAGCAGGG + Intronic
1010665933 6:78629772-78629794 TGGGAAAGGGGCTGAATCCAGGG - Intergenic
1010685642 6:78852188-78852210 TGTGAAAAGGGGCTGATCCAAGG + Intergenic
1011998060 6:93618465-93618487 TGAGAATAAGGGAGCATTCAAGG - Intergenic
1012701097 6:102458576-102458598 TGGGAAAAGTGTAGTATCCCGGG - Intergenic
1015603148 6:134929978-134930000 TGGGACCAGGGAGGCATCCATGG + Intronic
1018486510 6:164245893-164245915 TGGGAAAATGGAGGCATCAAAGG - Intergenic
1018717078 6:166541574-166541596 TGGGAGCAGGGGAACACCCATGG - Intronic
1020105297 7:5419909-5419931 AAGGAAGAGGGGAGCATCGAGGG + Intronic
1021378611 7:19939234-19939256 TGGCAAAATGGGAGAAGCCATGG - Intergenic
1022574454 7:31483950-31483972 GGGGAAGAGGGGGGCCTCCAGGG + Intergenic
1023771643 7:43561975-43561997 AGGGAAAAGGGGATCATCCCAGG - Exonic
1023971945 7:44998317-44998339 TGAAAAAAGGGAAGCCTCCAGGG - Intergenic
1024920306 7:54546819-54546841 TGGGGACAGGGGAGCGACCAGGG - Intronic
1025585343 7:62777831-62777853 GGGGAAAAAGAGAACATCCAAGG + Intergenic
1026569469 7:71516735-71516757 GGAGAAATGGAGAGCATCCATGG - Intronic
1027347181 7:77272671-77272693 TGGGGAAAGGGTACCATTCAAGG - Intronic
1027434990 7:78155286-78155308 TGAGAACAGGGAAGCATCCTGGG - Intronic
1027755693 7:82209204-82209226 TGGGAAATGGAGACCATTCATGG + Intronic
1029335554 7:99896682-99896704 TGGGATCAGGGGAGAATCCACGG + Intronic
1029597853 7:101547130-101547152 TGGGAAGAGCGGAGCGGCCAGGG - Intronic
1031077516 7:117226981-117227003 TGGGGAAAAGGGAGCATTTATGG + Intronic
1031194380 7:118593348-118593370 TTGGAAAAGGGGAGCATATTTGG - Intergenic
1032144365 7:129365783-129365805 TGGGAAAAGGGGGAAATCAAAGG + Intronic
1033323501 7:140361128-140361150 GCTGAAAAGGGGACCATCCAAGG + Intronic
1034394082 7:150807021-150807043 TGGGAGAAGGGGAGGAAGCAGGG - Intergenic
1036149772 8:6286564-6286586 TGGGAATATGGGACCATCCCTGG - Intergenic
1038578510 8:28726457-28726479 AGGGAAAAGGGGAACATCTTAGG + Intronic
1039173272 8:34773478-34773500 TGAGCATAGGAGAGCATCCAAGG - Intergenic
1039884076 8:41645656-41645678 GGGGAAAAGGGGAGGGTGCAGGG - Exonic
1040132898 8:43818128-43818150 GGGGAAAAGTGGAATATCCACGG + Intergenic
1040328823 8:46375644-46375666 TGGGAAGAGTGGGGCATCCCTGG + Intergenic
1040743269 8:50605784-50605806 TGGGGAGAGGGGATTATCCACGG + Intronic
1041325545 8:56659506-56659528 TGGGAAAAGGGAAGGCTCCCAGG - Intergenic
1042386744 8:68184879-68184901 TGTGAAAAAGTGAGCATCCCTGG + Intronic
1044368451 8:91378172-91378194 TGGAAAAAAGGGAGCAAACAAGG + Intronic
1045773410 8:105772310-105772332 TGGGAGAAGGTGAGCATACAGGG + Intronic
1047413965 8:124648755-124648777 TGAGAAAATGTGAGAATCCAAGG + Intronic
1048071423 8:131025816-131025838 TGAGAAAAGTGAGGCATCCAGGG - Intronic
1048954651 8:139525876-139525898 TGGGAGAAGGGGAGAAACCATGG - Intergenic
1049051638 8:140201782-140201804 TGGGAAAAGGGGAGCAGCCAGGG + Intronic
1049129111 8:140820869-140820891 AGGGACATGGGGAGCAGCCAGGG + Intronic
1049252034 8:141594357-141594379 TTGGAAGTGGGAAGCATCCATGG - Intergenic
1049397645 8:142409032-142409054 GGAGAATAGGGGAGCATTCAGGG - Intergenic
1050759558 9:9050378-9050400 TGGGGAAAGGGAAACGTCCATGG - Intronic
1052264102 9:26551713-26551735 TGGGAAAAGGGAAGAATAAAAGG + Intergenic
1052493206 9:29192982-29193004 TGGTAAAAAGTGAGCATCCCTGG - Intergenic
1053010675 9:34631088-34631110 TGGGGAAAAGGGAGCAAGCAGGG - Intergenic
1053073776 9:35116075-35116097 TGGGAAAAGCTGAGGATCCTGGG - Intronic
1053334256 9:37250202-37250224 TGGGACAAGGTGATCATCCCAGG - Intronic
1054331571 9:63762196-63762218 TTGGAAAATGAGAGCATTCAGGG - Intergenic
1058383596 9:104407278-104407300 TGGGAACAGGGGAAAAACCATGG + Intergenic
1059193957 9:112353240-112353262 TGGTGAAAGGAGAGAATCCATGG - Intergenic
1059534753 9:115070315-115070337 TGGGAAAAGAGTGGTATCCAGGG + Intronic
1059764818 9:117374141-117374163 TGGAAAATGGGAAGAATCCAGGG - Intronic
1060195087 9:121618236-121618258 TGGGGAAAGGGGAGTCCCCAAGG + Intronic
1060743266 9:126113406-126113428 TGGGGAAAGGGTGGCCTCCAGGG + Intergenic
1060987586 9:127828570-127828592 TCGGGAAGGGGGAGGATCCATGG + Intronic
1061939130 9:133874714-133874736 TGGGAAGAGGGAAGGGTCCAAGG - Intronic
1062045394 9:134422420-134422442 TAGGGAGAGGGGAGCGTCCAGGG - Intronic
1062306846 9:135912119-135912141 TGGGGAGAGGGGAGAGTCCAGGG + Intergenic
1062447761 9:136602757-136602779 TGGGAAAAGGGCAGGAGCCATGG + Intergenic
1188342520 X:29021664-29021686 GGAGAAAAGGGCAGGATCCAAGG - Intronic
1190421761 X:50291721-50291743 TGGGAAAAGAGGTGCATTCATGG - Intronic
1195365219 X:104117756-104117778 TGAGAAAAGGTGAGCAGCAAGGG - Intronic
1197133318 X:123031376-123031398 TGGGAAAAAGGAAACAGCCAAGG - Intergenic
1199608112 X:149592773-149592795 TGGCAAAAGGGCAGCATGCCAGG + Exonic
1199631008 X:149776587-149776609 TGGCAAAAGGGCAGCATGCCAGG - Exonic
1199794713 X:151183065-151183087 TGGGGAGAGGGGAGCATGCTGGG + Intergenic
1199801154 X:151252681-151252703 TGGGAAAAGCGTAGCACCCAGGG - Intergenic
1199830501 X:151544982-151545004 TGATAAAGTGGGAGCATCCAGGG + Intergenic
1199990241 X:152983706-152983728 TGGGAAAAGGGTGGCCCCCAGGG + Intergenic
1200833764 Y:7712824-7712846 TGGGAAAAGAGGAGAATAAAAGG + Intergenic
1200847683 Y:7848981-7849003 TAGGAAAAAGGCAGAATCCAGGG + Intergenic