ID: 925184393

View in Genome Browser
Species Human (GRCh38)
Location 2:1837024-1837046
Sequence ATTTGGGAAGGGGCGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925184393 Original CRISPR ATTTGGGAAGGGGCGTCATG GGG Intronic
900712161 1:4121303-4121325 GTTTGCAAAGGGGCATCATGAGG - Intergenic
903299131 1:22365602-22365624 ATGGGGGAAGGGGCGTCTTTGGG - Intergenic
903306855 1:22418801-22418823 AGGTGGGAAGGGCCGTCATGGGG - Intergenic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
908647144 1:66290459-66290481 ATTGTGGAAGGGGAGTCAAGAGG + Intronic
913456019 1:119031441-119031463 ATCTGGGATGGGGCGTTTTGTGG + Exonic
913530335 1:119729487-119729509 CCTGGGGAAGGGGAGTCATGGGG - Intronic
916695495 1:167231787-167231809 ATTTGGGAAGGGGCTCTCTGAGG + Intronic
917901022 1:179543451-179543473 AATTGGGAAGCAGCGTCACGGGG + Intronic
918094495 1:181323465-181323487 ACATGGGAAGGGGCCTCAAGTGG - Intergenic
923460685 1:234206904-234206926 ATTTGGGAAGGAGGTTGATGCGG - Intronic
923559131 1:235025170-235025192 CTGTGGGAAGGGGCGTCACTGGG + Intergenic
924502704 1:244652518-244652540 ATTTGGCAAGGGGAGTGGTGGGG - Intergenic
924617561 1:245625783-245625805 GTGTGGGAAGGGGCGGGATGTGG - Intronic
1068814211 10:61291502-61291524 ATTTGGAAAAGGCGGTCATGTGG + Intergenic
1070985593 10:80687033-80687055 TTTTGGGAGGGGGTATCATGAGG - Intergenic
1073922356 10:108473603-108473625 ATATGGGAAGGGGCATGTTGAGG + Intergenic
1075622395 10:123937387-123937409 ATTTGGGGTGGGGGGTCCTGAGG - Intronic
1078847138 11:15128596-15128618 ACTTGGGAAGGGGCATCATAAGG + Intronic
1082973072 11:59043794-59043816 ATTTGGGAAAGGGGTTCAAGGGG + Intergenic
1082977468 11:59087359-59087381 ATTAGGGAAAGGGGGTCAAGGGG + Intergenic
1083364355 11:62132564-62132586 TCTTGGGAAGGGGCTTCAAGCGG + Intronic
1084558565 11:69889833-69889855 CTTTGGGGAGGGGCCTCTTGGGG + Intergenic
1084957605 11:72699562-72699584 ATTTGGGCAGGGGAGCCATCAGG + Intronic
1084999816 11:73021843-73021865 CTTTGGGAGGTGGAGTCATGAGG + Intronic
1088471987 11:110196650-110196672 AGTTGGGAAGGGGCCTGAGGTGG - Intronic
1089446879 11:118560167-118560189 CTTTGGGAAGGGGAGGCAGGAGG + Intronic
1089883883 11:121800925-121800947 GTTTGGGAGGGGGGGTCACGGGG - Intergenic
1092160956 12:6315249-6315271 CCTTGGGAAGTGGGGTCATGTGG + Intronic
1095228193 12:39701649-39701671 ATTTTGGAATAGGTGTCATGTGG - Intronic
1096648548 12:53050830-53050852 AGTTGGGAAAGGGAGTGATGGGG - Intronic
1097864354 12:64547027-64547049 ATTTGGGAAGCCGAGGCATGTGG + Intergenic
1101400679 12:104384109-104384131 GATTGGGAAAGGGCTTCATGTGG + Intergenic
1102786702 12:115610939-115610961 GTGTGGGAAGGGACTTCATGAGG + Intergenic
1103322814 12:120101767-120101789 GCTTGGGAAGGGGCGGCCTGTGG - Intronic
1107897156 13:44976565-44976587 ACTTGGGGAGTGGTGTCATGAGG + Intronic
1112449155 13:99493608-99493630 ACTTGGCAAGGGGCTTTATGGGG + Intergenic
1113908244 13:113830257-113830279 ATTGGGGAGGGGTCCTCATGAGG + Intronic
1114929025 14:27444071-27444093 CTTTGGGAAGGGGAGGCAGGAGG - Intergenic
1117180516 14:53186561-53186583 AGTTGGGAAGGGGCCTTAAGAGG + Intergenic
1117436787 14:55722858-55722880 GTTTGGGAAGGGCTGCCATGTGG - Intergenic
1117626665 14:57647053-57647075 ATTTTGGAATAGGTGTCATGTGG + Intronic
1119538582 14:75423379-75423401 ATTTGGGAAGGTGAGGCAGGAGG - Intergenic
1122772827 14:104104854-104104876 GTTTGGGAAGGGGAGGGATGTGG + Intronic
1122979380 14:105184786-105184808 ATTTGGGGAGGGGCTCCAGGAGG + Intergenic
1123138316 14:106050857-106050879 ATTTGGGAAATGGAGTCATAGGG + Intergenic
1124153758 15:27207751-27207773 GTTTGGGAAGGGCAATCATGAGG + Intronic
1125445956 15:39756578-39756600 CTTTGGGAAGTGGAGTCAGGAGG - Intronic
1128532412 15:68463535-68463557 ATTTTGGAAAGAGCATCATGTGG + Intergenic
1130139174 15:81209275-81209297 GTGTGGGGAGGGGCGTCCTGGGG + Intronic
1130141395 15:81229279-81229301 GTGTGGGGAGGGGCGTCCTGGGG + Intronic
1131015271 15:89052813-89052835 CTCAGGGAAGGGGCGCCATGAGG - Intergenic
1131735530 15:95327260-95327282 ATTTGGGAAGGGGAGGCTCGCGG - Intergenic
1132695157 16:1198790-1198812 ATCTGGGCAGGGGCCTCACGGGG - Intronic
1134382645 16:13742332-13742354 ATTTGGGAGGATGAGTCATGAGG + Intergenic
1135851499 16:25968004-25968026 ATATGTGAAGGGTTGTCATGGGG + Intronic
1136450295 16:30350994-30351016 ATAAGGGAAGGGGAGTCACGAGG - Exonic
1136637709 16:31536330-31536352 CTTTGGGAAGCGGAGGCATGTGG + Intergenic
1138828429 16:60350422-60350444 ACTTGGGAAGGTGAGGCATGAGG - Intergenic
1138894702 16:61189447-61189469 ATTTGGGAAAGGTAGGCATGAGG + Intergenic
1138920012 16:61515871-61515893 AGTTGGGAAGCTGCGTGATGAGG - Intergenic
1140688573 16:77458250-77458272 ATTTGTGAAGGTGCATCTTGAGG + Intergenic
1141398457 16:83725377-83725399 ATCTGGGAAGGAGGGTCAAGTGG + Intronic
1142129269 16:88425338-88425360 ATGTGGGACTGGGCTTCATGTGG + Intergenic
1142694730 17:1627648-1627670 CTTTGGGAGGGGGCGGGATGGGG - Intronic
1146926513 17:36749471-36749493 ATTTGGGAAGGGGGGTAGAGGGG + Intergenic
1147440723 17:40445652-40445674 ATCTGGGAAGGGGGGTCCTGGGG + Intronic
1147898639 17:43769236-43769258 GTTGGGGAAGGGAGGTCATGAGG + Exonic
1149559843 17:57600759-57600781 ATGTGTGAAAGGGTGTCATGTGG - Intronic
1150371387 17:64641780-64641802 ATTTGGCAAGGGGCTTAATTGGG - Intronic
1150850961 17:68703311-68703333 ATTTGGGAAGGTACCTTATGAGG - Intergenic
1152063841 17:78098891-78098913 CTGTGCGAAGGGGAGTCATGGGG - Intronic
1152377753 17:79927505-79927527 ATGTGGGGAGGGTCGTGATGGGG + Intergenic
1153200993 18:2647664-2647686 ATTTTGGAAGGGGCTTACTGGGG + Intergenic
1159262475 18:66032334-66032356 ATTTGGGAAGCTGAGTCAGGAGG - Intergenic
1161874186 19:6894845-6894867 ATTTGGGAAGGGGGATCAACAGG + Intronic
1165068356 19:33241567-33241589 CTATGGGAAGGGGTGTCCTGGGG - Intergenic
1165529475 19:36386170-36386192 ATGTGGGAAGCAGAGTCATGAGG - Intronic
1166084392 19:40465540-40465562 CTTTAGGAAGGGGCACCATGGGG - Intronic
1166830402 19:45636077-45636099 ATTTGGGAAGCGGAGGCAGGAGG - Intronic
1168703087 19:58453129-58453151 ATTGAGGAGGGGGCGCCATGTGG + Intronic
925184393 2:1837024-1837046 ATTTGGGAAGGGGCGTCATGGGG + Intronic
925799466 2:7583528-7583550 AGCTGGGAAGGGGTGCCATGAGG + Intergenic
926765669 2:16320995-16321017 ATTTGGGAAGGTGCCTCAAGAGG - Intergenic
931692289 2:64845545-64845567 ATTAGGGAAGGGGCCCCATGAGG - Intergenic
933811823 2:86037384-86037406 ATTTGGGATGGTGGGTCTTGGGG - Intronic
933983685 2:87573698-87573720 ATTTGGGCCTGGGCCTCATGGGG - Intergenic
935497373 2:103797417-103797439 ATTTAGGAAAGGGTCTCATGTGG + Intergenic
936310166 2:111377096-111377118 ATTTGGGCCTGGGCCTCATGGGG + Intergenic
936464568 2:112735596-112735618 ATTTGGGAAGGAGATTCATAGGG - Intronic
938739531 2:134218344-134218366 TTTTGGGACAGGGTGTCATGTGG - Intronic
938754833 2:134370128-134370150 AATTGGGAATGGGAGTCATTTGG + Intronic
940205977 2:151202213-151202235 TTTTGGGTAGGAGAGTCATGTGG + Intergenic
945774965 2:214094963-214094985 ACTTGGGGAGGGGCTGCATGTGG + Intronic
945927230 2:215818052-215818074 AGTTGGGTAGGGGAGTCATGGGG + Intergenic
1170870482 20:20201521-20201543 ATTTGGGATGGGCCACCATGTGG + Intronic
1172028687 20:31967228-31967250 ATTTGAGCAGGGGAGTTATGTGG - Intergenic
1173532553 20:43781573-43781595 ATTTGAGAAGGGGCCCCGTGAGG - Intergenic
1174443609 20:50575569-50575591 ACTTGAGAAGGGGAGGCATGGGG - Intronic
1175839197 20:62015935-62015957 ATTTTGAAAGGGGCGTTTTGGGG - Intronic
1183357546 22:37367687-37367709 TTTTGGGAAGGGAGGTCATCAGG + Intergenic
1183749360 22:39711062-39711084 ATTTGGGAACGGGCGCTACGTGG - Intergenic
1184032779 22:41904750-41904772 GTGTGGGAAGGGATGTCATGAGG + Intronic
1184960870 22:47927578-47927600 ATTTGGGGGGGGGCGTCTAGGGG + Intergenic
949275126 3:2270404-2270426 ATTGGGGAAGGGGGGGAATGAGG + Intronic
950527848 3:13535134-13535156 AGATGGGCAGGTGCGTCATGGGG - Intergenic
950653016 3:14419387-14419409 ATCTGAGAAGGGGCATGATGCGG + Intronic
951363431 3:21751338-21751360 ACTTGGGAAGGGGCGGAGTGAGG + Exonic
953927912 3:46991710-46991732 CTTGGGGAAGGGGCACCATGAGG + Intronic
957422526 3:79989703-79989725 ATTTGGGAAGCAGCGGCAGGTGG - Intergenic
957719655 3:83977711-83977733 CTATGGGAATGGGGGTCATGTGG - Intergenic
958086578 3:88816602-88816624 ATTTGGCTAGGGGAGACATGAGG - Intergenic
960075046 3:113474498-113474520 ATTTTGGAATAGGTGTCATGTGG - Intronic
963604218 3:147400414-147400436 ATCTGGGAAGGAGCTCCATGGGG - Intronic
963762711 3:149300331-149300353 ATGTGGGAAAGGGAGTCCTGTGG - Intergenic
973738250 4:53893678-53893700 ATTTTGGAAGAGGTGACATGAGG - Intronic
974281087 4:59794874-59794896 ATTTGGGAGGTGGAGTCAGGTGG + Intergenic
975178953 4:71321326-71321348 ATTTGGGAAGGTGCTTAATGAGG + Intronic
982401707 4:154975208-154975230 AGTTTGGAAGGGGTGTTATGAGG - Intergenic
983538547 4:168884152-168884174 ATTTTGAAAGGGGAGGCATGAGG - Intronic
985526320 5:404399-404421 ATTTAGGAAGGAGAGTCTTGGGG + Intronic
985676579 5:1234609-1234631 ATGTGGGAAGGGCAGTTATGGGG - Intronic
987410566 5:17610819-17610841 ATGTGGGAAGGGGAGGCAGGGGG + Intergenic
991172241 5:63641882-63641904 CTTTGGGAAGCCGAGTCATGAGG + Intergenic
991384185 5:66066389-66066411 ATTTGGGAACTGACCTCATGAGG - Intronic
993602536 5:89946381-89946403 ATTTGGGAGGGGGGGTTCTGTGG + Intergenic
995456295 5:112356082-112356104 ATTTTGGAAGGGGGGTAAGGTGG + Intronic
1006147830 6:31969879-31969901 ATTTGGGAGAGGGAGTCTTGGGG + Exonic
1007739214 6:44000836-44000858 ACTTGTGAAGGGGCTTCAGGGGG + Intronic
1007836544 6:44678360-44678382 CTTTTGGAAGTGGAGTCATGGGG - Intergenic
1008210444 6:48717091-48717113 ATTTTGAAAGGAGCGTGATGTGG - Intergenic
1012089290 6:94871715-94871737 ATTTTGGAATAGGTGTCATGTGG + Intergenic
1012457594 6:99424873-99424895 TTGTGGGAAGGGGGTTCATGGGG - Intronic
1013462898 6:110392786-110392808 ACTTGGGAATGGGGGTCCTGAGG + Exonic
1013960553 6:115894045-115894067 ATTTGGGCAAGGGAGTGATGGGG + Intergenic
1018850897 6:167589432-167589454 AGGTGGGAAGGGGCTTCACGAGG + Intergenic
1019117225 6:169774808-169774830 AGTTGGCCAGGGGCTTCATGGGG + Intronic
1020713939 7:11646243-11646265 ATTTGGGAAGTGGGGTAAGGAGG - Intronic
1030742268 7:113124119-113124141 ATTTGGGAAGTGGTGACATAGGG + Intergenic
1033045787 7:137961348-137961370 ATTGGGGAAGGAACATCATGGGG + Intronic
1033366639 7:140677162-140677184 CTTTGGGAGGCGGCGTCAGGTGG + Intronic
1033976878 7:147113658-147113680 GTTGGGGGAGGGACGTCATGGGG - Intronic
1035771058 8:2147305-2147327 TTTTGGGAAGAGGAGTCATGTGG + Intronic
1036807183 8:11843409-11843431 AGTTGGGAAGGGGAGTACTGAGG + Exonic
1037556062 8:20023740-20023762 ATGTGGGAGGGGACTTCATGAGG - Intergenic
1040116719 8:43629956-43629978 ATTTGGGAAGGGACATTTTGGGG + Intergenic
1045035930 8:98176490-98176512 ATGTGGAAAGGGGCTACATGGGG - Intergenic
1048504018 8:135004440-135004462 ATTGGGGAAGGGGCATGAAGAGG + Intergenic
1049634665 8:143681097-143681119 ATTTGGAAGAGGGCGTCAGGGGG + Intergenic
1050534136 9:6616848-6616870 AATTGGGAAAGGGGGTTATGGGG + Intronic
1052725947 9:32228477-32228499 ATTTTGGAATGGGTGTCGTGTGG + Intergenic
1052805089 9:33006175-33006197 ATTTGGGAAGATGAGTCAGGAGG + Intronic
1055671956 9:78616507-78616529 ATTAAGGAAGGGAGGTCATGTGG + Intergenic
1057855045 9:98595297-98595319 CTTTGGGAAGGGGGGTGATTAGG - Intronic
1058155160 9:101506731-101506753 ATTTGGGAAGAGGCTTAGTGGGG - Intronic
1059527669 9:115007316-115007338 AATTCAGAAGGGGCCTCATGGGG - Intergenic
1062681285 9:137782941-137782963 ATCAGGGAAGGGGCGTCACAGGG - Intronic
1191683309 X:63863809-63863831 ATTTTGGAATAGGCGTGATGTGG + Intergenic
1194972633 X:100360959-100360981 ATTTGGGAAGGGGGATGAGGAGG + Intronic
1195197463 X:102513448-102513470 CCTTGGGAAGGGAGGTCATGTGG - Intergenic
1195578467 X:106475909-106475931 AAAAGGGAAGGGGCATCATGAGG - Intergenic
1200858444 Y:7964459-7964481 CTTTGGGAAGGTGAGTCAGGTGG - Intergenic